CN105925698B - The SNP primer and screening technique of early screening Strongylocentrotus intermedius breeding - Google Patents
The SNP primer and screening technique of early screening Strongylocentrotus intermedius breeding Download PDFInfo
- Publication number
- CN105925698B CN105925698B CN201610385880.8A CN201610385880A CN105925698B CN 105925698 B CN105925698 B CN 105925698B CN 201610385880 A CN201610385880 A CN 201610385880A CN 105925698 B CN105925698 B CN 105925698B
- Authority
- CN
- China
- Prior art keywords
- strongylocentrotus intermedius
- primer
- breeding
- snp
- dna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention discloses the SNP primer and screening technique of a kind of early screening Strongylocentrotus intermedius breeding, it is that Japan has been selected to breed five female individuals (♀) more than generation from numerous Strongylocentrotus intermedius two generations male (♂) and on the Chinese Lvshun Dragon King pool as Parent crossbreed F1 generation, building includes the mapping population of 194 F1 generation individuals and 2 parents, it is cultivated in same environment, by extracting the technological means such as DNA, sequencing, the genetic marker of Strongylocentrotus intermedius is had found for the first time and designs relevant primer, can be used for early screening Strongylocentrotus intermedius breeding.Compared with prior art, it can not only use manpower and material resources sparingly, reduce seed selection cost, and can ensure that parent's gene are excellent, to guarantee that progeny character is good.
Description
Technical field
The present invention relates to a kind of Strongylocentrotus intermedius Variety Selection primers and method, especially one kind to use manpower and material resources sparingly,
The SNP primer and screening technique for reducing seed selection cost, ensuring the good early screening Strongylocentrotus intermedius breeding of progeny character.
Background technique
Currently, for the breeding method that the breeding of Strongylocentrotus intermedius mostly uses greatly crossbreeding, selection and use etc. traditional, nothing
It is using the good sea urchin of growth traits as standard Selection parent by being crossbreeding or selection and use.Thus need
In sea urchin developmental process, the shell of regular (such as every month) measurement sea urchin is high, shell diameter and the living body indexs such as again, is carried out step by step with this
Screening, not only expends a large amount of manpower and material resources, but also can there is a problem of that selected parent's gene are not excellent, causes excellent
The filial generation seed quantum of output of good genotype is low.
Summary of the invention
The present invention be in order to solve above-mentioned technical problem present in the prior art, provide one kind can use manpower and material resources sparingly,
The SNP primer and screening technique for reducing seed selection cost, ensuring the good early screening Strongylocentrotus intermedius breeding of progeny character.
The technical solution of the invention is as follows: a kind of SNP primer of early screening Strongylocentrotus intermedius breeding, it is characterised in that
The SNP primers DNA sequences are as follows:
Upstream primer: 5'- CAGGTATCCTAAAGCAAT-3'；
Downstream primer: 5'- GTTTGTTGGTAAGCACTG -3'.
More than one state the method for SNP primer early screening Strongylocentrotus intermedius breeding, it is characterised in that in accordance with the following steps
It carries out:
A. prepared by DNA profiling:
It takes Strongylocentrotus intermedius seedling pipe sufficient, extracts genomic DNA；
B. PCR amplification target gene:
It is template with obtained DNA, PCR reaction is carried out with the upstream primer and downstream primer；
C. to PCR product Genotyping:
Genotyping is carried out to obtained PCR product with 96 instrument of HRM, is filtered out containing following DNA sequence dna heterozygosis base
Because of the Strongylocentrotus intermedius seedling of type:
5'-CAGGTATCCTAAAGCAATTGTTCGTCCAGTGCTTACCAACAAAC-3'
CAGGTATCCTAAAGCAATTGTTCGTCCAGCGCTTACCAACAAAC
The present invention is to have selected Japan numerous from numerous Strongylocentrotus intermedius two generations male (♂) and on the Chinese Lvshun Dragon King pool
Educating five female individuals (♀) more than generation is Parent crossbreed F1 generation, and building includes 194 F1 generation individuals and 2 parents
Mapping population cultivates in same environment, by extracting the technological means such as DNA, sequencing, has found the something lost of Strongylocentrotus intermedius for the first time
It passes and marks and design relevant primer, can be used for early screening Strongylocentrotus intermedius breeding.Compared with prior art, it can not only save
Manpower and material resources reduce seed selection cost, and can ensure that parent's gene are excellent, to guarantee that progeny character is good.
Detailed description of the invention
Fig. 1 is 4% agarose gel electrophoresis figure of PCR product of the embodiment of the present invention.
Specific embodiment
The relevant SNP marker screening process of one, growth traits:
1. high density genetic linkage maps construct
The building of 1.1 mapping populations
Using quasi- top-cross strategy, select Japan from numerous Strongylocentrotus intermedius two generations male (♂) and in Chinese Lvshun dragon
The female individuals (♀) more than generation of Wang Tang breeding five are Parent crossbreed F1 generation, and building includes 194 F1 generation individuals and 2
The mapping population of parent cultivates in same environment.
1.2 digestion schemes determine
Select purple ball sea urchin genome to carry out electronics digestion prediction with reference to genome sequence, final determine uses RsaI+
HaeIII enzyme carries out digestion, and endonuclease bamhi length is in 414-464bp.
The exploitation of 1.3 SLAF labels and screening
Tissue DNA is extracted with marine animal genome DNA extracting reagent kit, SLAF-seq technology carries out letter to mapping population
Change gene order-checking, the both-end Reads that sequencing is generated carries out sequence alignment by Blat software, is greater than according to sequence similarity
90% is clustered, and the sequence definition clustered together is 1 SLAF label；It is by the SLAF tag definition containing 2-4 tag
Polymorphism SLAF label.To guarantee genetic map quality, SLAF label is filtered, final determining upper icon remembers 150
Body obtains 4678, SLAF label that can be used for mapping, by recombination fraction and MLOD value between calculating two-by-two label, according to MLOD value
Label is divided into 21 linkage groups, it is final to determine upper icon note totally 4387.
1.4 genetic map construction
As unit of linkage group, using the linear array of Marker in HighMap software analysis linkage group, Marker is estimated
Between genetic distance, finally obtain total figure away from the genetic map for 1907.21cM, for mean chart away from 0.44cM, upper icon label are complete
Degree 99.75%.
2.QTL positioning
The phenotypic number of 2.1 growth traits measures and analysis
Digital display electronic vernier caliper (precision 0.01mm) measures 150 individual shell height (TH), shell diameter of final upper figure
(TD)；Electronic balance (precision 0.01g) measures living body weight (BW).Normal state is carried out to phenotypic data using 16.0 software of SPSS
Distribution inspection.
The QTL of 2.2 growth traits is positioned
Character association analysis is carried out using the map and growth traits phenotypic number of 21 linkage groups of Strongylocentrotus intermedius.Pass through
Permutation inspection (1000 times) determines the significance threshold value (LOD) of 95% confidence interval of each character；Using
Composite interval mapping (CIM) algorithm of RQTL software and Interval mapping (IM) algorithm of MapQTL software carry out shell height, shell diameter, work
3 growth traits positioning of weight, common location to 97 SLAF labels.
3. the screening of polymorphism SNP marker, design of primers and parting
By 97 SLAF sequence labels and purple ball sea urchin genome alignment, similarity given threshold is 0.9, and obtaining has base
Because of 15 SLAF labels of annotation, wherein finding SNP site 8 for capable of designing small fragment primer.Utilize Primer
5.0 software of Premier designs small fragment primer near SNP site (makes the control of Tm value between 50 DEG C~60 DEG C, PCR product
Length is 40~120bp, and primer only includes a SNP site, and does not include any insertion and deletion) grads PCR amplification is carried out,
4% agarose gel electrophoresis (150V, 200mA, 20min) detects all primers, determines optimum annealing temperature.Mesh is detected through HRM
The melting curve of segment be single no miscellaneous peak, and the primer being distributed between high/low temperature internal standard peak is used for Genotyping.
Garbled small fragment primer (is selected at random in mapping population using 96 analyzer of Light Scanner
50 individuals) Genotyping is carried out, obtain 3 candidate SNP labels relevant to Strongylocentrotus intermedius growth traits.
4. the verifying of Strongylocentrotus intermedius growth traits related SNP label
Select Strongylocentrotus intermedius F5 for apparent 3 familys (15 monthly age) of growth traits difference, each family takes 30 at random
Individual, extraction tube foot DNA, the growth traits of family to be checked is measured according to 2.1 methods, according to the method pair of above-mentioned third step
3 SNP markers of above-mentioned acquisition carry out Genotyping in 90 individuals of family, by shell height, shell diameter, weight character living with
SNP genotype significance test (P< 0.05 is significant difference,P< 0.01 is extremely significant for difference), SNP-29 label shell it is high,
On shell diameter, weight character living, heterozygous genotypes it is extremely significant be greater than homozygous genotype (P< 0.01), it is shown in Table 1, i.e. heterozygous genes
Type is preponderant genotype.
The specifying information of SNP-29 is as follows:
The SNP primers DNA sequences of early screening Strongylocentrotus intermedius breeding are as follows:
Upstream primer: 5'- CAGGTATCCTAAAGCAAT-3'；
Downstream primer: 5'- GTTTGTTGGTAAGCACTG -3'.
Affiliated chain group number: LG20；
Affiliated SLAF bookmark name: 19255；
SNP type: T/C；
Product length: 44bp；
DNA sequence dna is as follows:
5'-CAGGTATCCTAAAGCAATTGTTCGTCCAGTGCTTACCAACAAAC-3'
CAGGTATCCTAAAGCAATTGTTCGTCCAGCGCTTACCAACAAAC
*
* nucleotide variation point, that is, SNP site is indicated.
Related check such as table 1 between SNP-29 loci gene type and character:
Related check between 1 SNP-29 loci gene type of table and character
Note: the correlation analysis between the different genotype and various trait of same SNP site.Same SNP site it is same
The right mark capitalization difference of a line indicate between genotype difference it is extremely significant (P< 0.01), contribution rate (P)= SS t / SS T ×
100%.Similarly hereinafter.
Two, are with SNP-29 labeled primer early screening Strongylocentrotus intermedius breeding
1. the selection and cultivation of parent
2 familys that growth traits is best in 3 familys are selected to carry out group's breeding, by Strongylocentrotus intermedius growth traits
The confirmatory experiment of related SNP label screens the heterozygous genotypes individual for containing SNP-29 label in 2 familys as breeding parent
This, the parental number for obtaining this 2 familys is respectively 16 and 14 individuals, for the purpose of inbreeding, to this 2 familys
Male and female carry out intersection breeding, first filial generation number is A group；16 are respectively randomly selected from identical two familys of laboratory cultures
Intersection breeding is carried out by male and female, first filial generation number is control group without the genotype detection that SNP-29 is marked with 14 individuals
B.It is placed in same breeding environment and cultivates to sexal maturity.
2. artificial breeding and the measurement of growth traits phenotypic number
Propagation method uses Strongylocentrotus intermedius healthy aquaculture technology.Cultivation density is adjusted in due course according to sea urchin shell diameter size,
It is each from two groups of A, B when sea urchin grew to for 10 monthly age to select 300 sea urchin measurement shell height, shell diameter, weight characters living at random.
3. detection and assessment that growth traits related SNP -29 marks
Two groups of filial generations of A, B are screened in accordance with the following steps, and carry out Genotyping, as a result such as table 2
A. prepared by DNA profiling:
It takes Strongylocentrotus intermedius seedling pipe sufficient, extracts genomic DNA；
B. PCR amplification target gene:
It is template with obtained DNA, PCR reaction is carried out with the upstream primer and downstream primer；
Obtained PCR product is subjected to 4% agarose gel electrophoresis, obtains the display band of 44bp, as a result such as Fig. 1；
C. to PCR product Genotyping:
Genotyping is carried out to obtained PCR product with 96 instrument of HRM, is filtered out containing following DNA sequence dna heterozygosis base
Because of the Strongylocentrotus intermedius seedling of type:
5'- CAGGTATCCTAAAGCAATTGTTCGTCCAGTGCTTACCAACAAAC-3'
CAGGTATCCTAAAGCAATTGTTCGTCCAGCGCTTACCAACAAAC
The difference test of first filial generation and control group first filial generation of the table 2 by SNP-29 label guidance
The result shows that:
It is noticeably greater than control group B by the parent first filial generation A group character value that SNP-29 labeled primer screens, and A group contains
The number of individuals of SNP-29 label heterozygous genotypes is also greater than control group B, illustrates SNP-29 label polymerization effect in the A group of first filial generation
More preferably, further prove that SNP-29 label relevant to growth traits is suitable for Strongylocentrotus intermedius and chooses seeds in early days.
Sequence table
<110>Dalian Ocean University
<120>the SNP primer and screening technique of early screening Strongylocentrotus intermedius breeding
<160> 4
<210> 1
<211> 18
<212> DNA
<213>artificial sequence
<220>
<223>primer
<400> 1
CAGGTATCCTAAAGCAAT 18
<210> 2
<211> 18
<212> DNA
<213>artificial sequence
<220>
<223>primer
<400> 2
GTTTGTTGGTAAGCACTG 18
<210> 3
<211> 44
<212> DNA
<213>Strongylocentrotus intermedius
<400> 3
CAGGTATCCTAAAGCAATTGTTCGTCCAGTGCTTACCAACAAAC 44
<210> 4
<211> 44
<212> DNA
<213>Strongylocentrotus intermedius
<400> 4
CAGGTATCCTAAAGCAATTGTTCGTCCAGCGCTTACCAACAAAC 44。
Claims (2)
1. a kind of SNP primer of early screening Strongylocentrotus intermedius breeding, it is characterised in that the SNP primers DNA sequences are as follows:
Upstream primer: 5'- CAGGTATCCTAAAGCAAT-3'；
Downstream primer: 5'- GTTTGTTGGTAAGCACTG -3'.
2. a kind of method with SNP primer early screening Strongylocentrotus intermedius breeding described in claim 1, it is characterised in that according to such as
Lower step carries out:
A. prepared by DNA profiling:
It takes Strongylocentrotus intermedius seedling pipe sufficient, extracts genomic DNA；
B. PCR amplification target gene:
It is template with obtained DNA, PCR reaction is carried out with the upstream primer and downstream primer；
C. to PCR product Genotyping:
Genotyping is carried out to obtained PCR product with 96 instrument of HRM, is filtered out containing following DNA sequence dna heterozygous genotypes
Strongylocentrotus intermedius seedling:
5'-CAGGTATCCTAAAGCAATTGTTCGTCCAGTGCTTACCAACAAAC-3'
5'-CAGGTATCCTAAAGCAATTGTTCGTCCAGCGCTTACCAACAAAC-3'。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610385880.8A CN105925698B (en) | 2016-06-03 | 2016-06-03 | The SNP primer and screening technique of early screening Strongylocentrotus intermedius breeding |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610385880.8A CN105925698B (en) | 2016-06-03 | 2016-06-03 | The SNP primer and screening technique of early screening Strongylocentrotus intermedius breeding |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105925698A CN105925698A (en) | 2016-09-07 |
| CN105925698B true CN105925698B (en) | 2019-07-16 |
Family
ID=56833107
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610385880.8A Active CN105925698B (en) | 2016-06-03 | 2016-06-03 | The SNP primer and screening technique of early screening Strongylocentrotus intermedius breeding |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105925698B (en) |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108411002B (en) * | 2018-05-22 | 2021-07-13 | 大连海洋大学 | PCR primer and method for identifying hybrid of echinus purpureus and echinus intermedius |
| CN108660225B (en) * | 2018-07-18 | 2021-06-15 | 大连海洋大学 | Molecular marker assisted breeding primer for growth traits of echinococcus intermedius and screening method |
| CN109182540B (en) * | 2018-10-10 | 2021-06-15 | 大连海洋大学 | Primer and method for screening high-temperature-resistant strongylocentrotus intermedius |
| CN113718038B (en) * | 2021-07-26 | 2023-05-23 | 大连海洋大学 | Molecular marker assisted breeding primer group for fatty acid content of echinacea intermedius and application |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102443637A (en) * | 2011-11-29 | 2012-05-09 | 大连海洋大学 | SSR marker screening method related to metamorphosis of sea urchins |
-
2016
- 2016-06-03 CN CN201610385880.8A patent/CN105925698B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102443637A (en) * | 2011-11-29 | 2012-05-09 | 大连海洋大学 | SSR marker screening method related to metamorphosis of sea urchins |
Non-Patent Citations (3)
| Title |
|---|
| High-Density Genetic Mapping with Interspecific Hybrids of Two Sea Urchins,Strongylocentrotus nudus and S. intermedius,by RAD Sequencing;Zunchun Zhou等;《PLOS ONE》;20150923;第1-13页 |
| 中间球海胆生长分化相关的AFLP标记;初冠囡等;《中国水产科学》;20100531;第17卷(第3期);第448-455页 |
| 利用cDNA-AFLP技术筛选与海胆数量性状相关显著的分子标记;邹林林等;《水产科学》;20081130;第27卷(第11期);第561-565页 |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105925698A (en) | 2016-09-07 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Han et al. | Domestication footprints anchor genomic regions of agronomic importance in soybeans | |
| Wang et al. | High-density genetic linkage mapping in turbot (Scophthalmus maximus L.) based on SNP markers and major sex-and growth-related regions detection | |
| Bensch et al. | Ten years of AFLP in ecology and evolution: why so few animals? | |
| CN105925698B (en) | The SNP primer and screening technique of early screening Strongylocentrotus intermedius breeding | |
| Heesch et al. | A sequence‐tagged genetic map for the brown alga Ectocarpus siliculosus provides large‐scale assembly of the genome sequence | |
| Singh et al. | Genomic analysis confirms population structure and identifies inter-lineage hybrids in Aegilops tauschii | |
| CN106636393B (en) | SNP marker and its application with pumpkin peel color gene linkage | |
| CN106834439B (en) | Molecular marker related to growth of litopenaeus vannamei and application thereof | |
| Kapan et al. | Localization of Mullerian mimicry genes on a dense linkage map of Heliconius erato | |
| Zubrzycki et al. | Main and epistatic QTL analyses for Sclerotinia head rot resistance in sunflower | |
| CN110129455A (en) | A kind of application growing relevant molecular labeling in litopenaeus vannamei genetic breeding | |
| Kim et al. | Population genetic structure of eelgrass (Zostera marina) on the Korean coast: Current status and conservation implications for future management | |
| CN110129456A (en) | A kind of anti-vibrios molecular labeling combination of prawn and its application in breeding | |
| Vergilino et al. | Genome size evolution and polyploidy in the Daphnia pulex complex (Cladocera: Daphniidae) | |
| Li et al. | Genetic divergence and population structure in weedy and cultivated broomcorn millets (Panicum miliaceum L.) revealed by specific-locus amplified fragment sequencing (SLAF-Seq) | |
| CN109055580A (en) | Litopenaeus vannamei c-type scavenger receptor is interior and grows related molecular marker and application | |
| CN106399530A (en) | Spinibarbus dneticulatus microsatellite family identification method | |
| CN104328119B (en) | The related microsatellite molecular marker of megalobrama amblycephala growth traits and application | |
| Martínez-Garrido et al. | Multilocus genetic analyses provide insight into speciation and hybridization in aquatic grasses, genus Ruppia | |
| CN109486961B (en) | Construction method of scylla paramamosain high-density genetic map | |
| CN107815502B (en) | dCAPS marker development and application for identifying waterlogging tolerance of chrysanthemum | |
| CN110331217A (en) | A kind of microsatellite marker paternity identification primer, method and application suitable for bolti, Oreochromis aureus and its cenospecies | |
| CN111370058B (en) | Method for tracing buffalo blood line source and carrying out genome matching based on whole genome SNP information | |
| CN112080570A (en) | KASP labeled primer combination for identifying hybrid stichopus japonicus in Zhongrussia and application thereof | |
| Lane et al. | The phylogeography and population genetics of Polyprion oxygeneios based on mitochondrial DNA sequences and microsatellite DNA markers |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB03 | Change of inventor or designer information |
Inventor after: Ding Jun Inventor after: Chang Yaqing Inventor after: Li Dan Inventor after: Zhang Weijie Inventor before: Chang Yaqing Inventor before: Li Dan Inventor before: Ding Jun Inventor before: Zhang Weijie |
|
| CB03 | Change of inventor or designer information | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |