CN105925686A - Marker, primer and detection method for assisted detection of non-small cell lung cancer - Google Patents
Marker, primer and detection method for assisted detection of non-small cell lung cancer Download PDFInfo
- Publication number
- CN105925686A CN105925686A CN201610318306.0A CN201610318306A CN105925686A CN 105925686 A CN105925686 A CN 105925686A CN 201610318306 A CN201610318306 A CN 201610318306A CN 105925686 A CN105925686 A CN 105925686A
- Authority
- CN
- China
- Prior art keywords
- primer
- lung cancer
- cell lung
- detection
- mirna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Analytical Chemistry (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Microbiology (AREA)
- General Health & Medical Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Pathology (AREA)
- Oncology (AREA)
- Hospice & Palliative Care (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to the field of detection of non-small cell lung cancer, in particular to a marker, a primer and a detection method for assisted detection of non-small cell lung cancer. The marker for assisted detection of the non-small cell lung cancer comprises one or more of miR6801, miR22 and miR196. Based upon screening from a great amount of miRNAs, the stable existence of three markers in human serum is proved, and the markers, as lung cancer markers of the non-small cell lung cancer, can serve as assisted diagnosis indexes of the non-small cell lung cancer. The invention also provides a miRNA fluorescent quantitative PCR primer for the assisted detection of the non-small cell lung cancer, and the obtained primer, which is excellent in sensitivity and specificity on the detection of the non-small cell lung cancer, is well applicable to the assisted detection of the non-small cell lung cancer. Furthermore, the invention provides the kit and the detection for the assisted detection of the non-small cell lung cancer, so that the assisted detection of the non-small cell lung cancer can be completed conveniently.
Description
Technical field
The present invention relates to nonsmall-cell lung cancer detection field, in particular to being used for assisting detection nonsmall-cell lung cancer
Label, primer and detection method.
Background technology
Microrna (miRNA, miR) is the non-coding list of a length of 18-25 the nucleotide of a class endogenous high conservative
Chain RNA molecule, mankind miRNA can be as the new blood serum designated object index of diagnosing non-small cell lung cancer.Current miR-205,
MiR-125b, miR-25, miR-155 etc. have been found to can be used for the mark index of Diagnosis of Non-Small Cell Lung.
Up to now, the miRNA authoritative database of 21.0 versions has shown that the miRNA kind that the mankind presently, there are has
2581 kinds, wherein can need to be found further as the miRNA of Diagnosis of Non-Small Cell Lung mark.
In view of this, the special proposition present invention.
Summary of the invention
The first object of the present invention is the label provided for assisting detection nonsmall-cell lung cancer, described label
Obtain through a large amount of screenings, these the 3 kinds of serum miRNA molecule stable existences obtained, can be as the tumor marker of nonsmall-cell lung cancer
Thing, can be used for the auxiliary diagnostic index of nonsmall-cell lung cancer.
The second object of the present invention is to provide for assisting the miRNA quantitative fluorescent PCR of detection nonsmall-cell lung cancer to draw
Thing, the primer obtained has good Sensitivity and Specificity to the detection of nonsmall-cell lung cancer, can well assist non-little carefully
The detection of born of the same parents' pulmonary carcinoma.
The third object of the present invention is the test kit provided for assisting detection nonsmall-cell lung cancer, in order to auxiliary inspection
Survey the detection of nonsmall-cell lung cancer.
The fourth object of the present invention is the method providing auxiliary detection nonsmall-cell lung cancer, and the method is simple, surely
Fixed reliable, the diagnosis for nonsmall-cell lung cancer provides ancillary technique support.
In order to realize the above-mentioned purpose of the present invention, spy by the following technical solutions:
For assisting the label of detection nonsmall-cell lung cancer, including any one in miR6801, miR22, miR19b or
Multiple.
Existing miRNA kind has 2581 kinds, but can need into one as the miRNA of Diagnosis of Non-Small Cell Lung mark
Step is found.The present inventor from miR27d, miR125b, miR197, miR27b, miR15b, miR16, miR25, miR155,
MiR205 etc. screen, obtain for assist detection nonsmall-cell lung cancer label, for miR6801, miR22,
Any one or more in miR19b.These three label stable existence in human serum, can swelling as nonsmall-cell lung cancer
Tumor label, for the auxiliary diagnostic index of nonsmall-cell lung cancer.
What the present invention provided can be arbitrary in three labels for assisting the label of detection nonsmall-cell lung cancer
Kind, as being miR6801 or miR22 or miR19b；Can also be any two kinds in three labels, as being
MiR6801 and miR22；MiR6801 and miR19b；MiR22 and miR19b；Can also be three kinds in three labels.
Present invention also offers the miRNA fluorescence quantification PCR primer for assisting detection nonsmall-cell lung cancer, including internal reference
Primer and detection primer, described detection primer selected from the first primer to, the second primer to, three-primer centering any one or many
Kind；
The base sequence of the forward primer of described first primer pair is as shown in SEQ ID No.1；
The base sequence of the forward primer of described second primer pair is as shown in SEQ ID No.2；
The base sequence of the forward primer of described three-primer pair is as shown in SEQ ID No.3；
The base sequence of the forward primer of described internal reference primer is as shown in SEQ ID No.4；
Described first primer to, described second primer to, described three-primer to the downstream primer with described internal reference primer
The most identical, the base sequence of described downstream primer is as shown in SEQ ID No.5.
The miRNA fluorescence quantification PCR primer for assisting detection nonsmall-cell lung cancer that the present invention provides, to non-small cell
The detection of pulmonary carcinoma has good Sensitivity and Specificity, can well assist the detection of nonsmall-cell lung cancer.
Wherein, the first primer designs corresponding to miR6801；Second primer designs corresponding to miR22；3rd draws
Thing designs corresponding to miR19b.
The miRNA fluorescence quantification PCR primer for assisting detection nonsmall-cell lung cancer that the present invention provides, detection is all every time
Need the existence of internal reference primer, in order to detect the situation of change of each primer pair.
Present invention also offers the test kit containing above-mentioned miRNA fluorescence quantification PCR primer, in order to detection uses.
The method that present invention also offers detection nonsmall-cell lung cancer label, extracts the miRNA in test serum sample,
Obtain extract；
Described extract adds poly (A) tail, and then reverse transcription obtains cDNA product；
With described cDNA product as template, carry out real-time fluorescence quantitative PCR with above-mentioned miRNA fluorescence quantification PCR primer.
The method of the detection nonsmall-cell lung cancer label that the present invention provides, simple, testing result is reliable and stable, can
Symptom etc. in conjunction with nonsmall-cell lung cancer is made a definite diagnosis, and the diagnosis for nonsmall-cell lung cancer provides ancillary technique support.
Wherein, extract the miRNA in test serum sample and use conventional method to carry out, carry out according to test kit
Extract, then the step of reference reagent box is carried out, and extracts the mixture that extract is small fragment RNA obtained.
Preferably, as primer, described extract reverse transcription is obtained cDNA product using miRNA reverse transcription universal primer；
Described universal primer is: the primer sequence as shown in SEQ ID No.6, the primer sequence as shown in SEQ ID No.7
Row and the mixture of the primer sequence as shown in SEQ ID No.8.
Using above-mentioned universal primer to carry out reverse transcription, the cDNA product obtained carries out real-time fluorescence quantitative PCR again, and primer is special
The opposite sex is strong, and result is reliable and stable.
It is highly preferred that in described mixture, three primer sequences with etc. weight mixing.
Experiment proves that, the working concentration of universal primer is the non-specific expansion of cDNA that 0.4-0.6 μ g/ μ L reverse transcription obtains
Increase few, for the template that next step enforcement quantitative fluorescent PCR offer is good.Preferably, the working concentration of described universal primer is
0.4-0.6μg/μL。
The volume of the reaction system of real-time fluorescence quantitative PCR can select according to demand, for the ease of operation and joint
About cost, further, the volume of the reaction system of described real-time fluorescence quantitative PCR is 15-30 μ L.Such as real time fluorescent quantitative
The volume of the reaction system of PCR is 15 μ L, 20 μ L, 25 μ L, 30 μ L etc..
Consider, it is highly preferred that the volume of the reaction system of described real-time fluorescence quantitative PCR is 20 μ L.
Empirical tests, uses following real-time fluorescence quantitative PCR response procedures to react, and primer specificity is strong.Preferably,
The response procedures of real-time fluorescence quantitative PCR is:
94-95 DEG C keeps 2-5min；
94-95 DEG C keeps 15-20s, and 60 DEG C keep 34-35s, circulate 40-45 time.
Response procedures such as real-time fluorescence quantitative PCR can be:
95 DEG C keep 2min；
95 DEG C keep 15s, and 60 DEG C keep 34s, circulate 45 times.
Can also be:
94 DEG C keep 5min；
94 DEG C keep 20s, and 60 DEG C keep 35s, circulate 40 times.
Compared with prior art, the invention have the benefit that
(1) present invention obtain first any one or more in miR6801, miR22, miR19b can as auxiliary detection non-
The label of small cell lung cancer, the diagnosis for nonsmall-cell lung cancer provides technical support.
(2) present invention also offers the miRNA fluorescence quantification PCR primer for assisting detection nonsmall-cell lung cancer, obtain
Primer the detection of nonsmall-cell lung cancer is had good Sensitivity and Specificity, can well assist nonsmall-cell lung cancer
Detection.
(3) present invention also offers the test kit for assisting detection nonsmall-cell lung cancer, in order to auxiliary detection is non-little
The detection of cell lung cancer.
(4) method that present invention also offers detection nonsmall-cell lung cancer label, simple, testing result stably may be used
Leaning on, the diagnosis for nonsmall-cell lung cancer provides ancillary technique support.
Accompanying drawing explanation
In order to be illustrated more clearly that the embodiment of the present invention or technical scheme of the prior art, below will be to embodiment or existing
In having technology to describe, the required accompanying drawing used is briefly described.
Fig. 1 is the expression bar diagram of the different miRNA in the embodiment of the present invention in case group and matched group.
Detailed description of the invention
Below in conjunction with embodiment, embodiment of the present invention are described in detail, but those skilled in the art will
Understanding, the following example is merely to illustrate the present invention, and is not construed as limiting the scope of the present invention.In embodiment unreceipted specifically
Condition person, the condition advised according to normal condition or manufacturer is carried out.Agents useful for same or instrument unreceipted production firm person, be
Can be by the commercially available conventional products bought and obtain.
Embodiment 1
One, case group and matched group are selected
Case group: in August, 2012 in October, 2013, hospital accepted for medical treatment first controls NSCLC patient 120 example, wherein male 65
Example, women 55 example, age 41-73 year (average 50.1 years old), wherein adenocarcinoma of lung 69 example, lung squamous cancer 51 example.All NSCLC patients are complete
Portion makes a definite diagnosis through cytology or histology, does not carries out radiotherapy or chemotherapy in the past, without actute infection, acardia medical history, without nervus centralis
System transfer and malnutrition.NSCLC patient determines clinic through physical examination, rabat, abdominal part color ultrasound, brains CT, bone scanning etc.
By stages, stages of lung cancer was with reference to american cancer Joint Association (AJCC) standard in 2002.NSCLC patient has double footpath can measure focus,
Active state (PS) scoring 0-2 (eastern United States tumor cooperative groups ECOG standard), it is contemplated that life span >=3 month；Routine blood test is examined
Look into normal, neutrophilic granulocyte absolute value >=2.0 × 109/L, hemoglobin >=90g/L, platelet >=100 × 109/L；Liver, kidney
Function is normal, 2 times of transaminase≤normal value high limit, total bilirubin≤normal value high limit, creatinine≤normal value high limit.
Normal healthy controls group: certain Hospital Physical Examination health worker 45, wherein male 22, women 23, age 25-55 year
(average 39.4 years old), without underlying disease such as hypertension, hyperlipidemia, diabetes.
Two, collection of specimens
NSCLC patient and Healthy People peripheric venous blood 4mL on an empty stomach is collected with the vacuum test tube of band serum separation gel.All
Specimen isolates serum after 4000 revs/min centrifugal, and by each serum sample, (minimum 500 μ L are transferred to 1.5mL eppendorf
Guan Zhong, notes the blood clot avoiding liquid transfer gun head not touch blood taking tube bottom.All serum specimens are in latter 4 hours of blood sampling
Being disposed, the serum sample after collection puts to-80 DEG C of ultra cold storage freezers freezing, concentrates the extraction carrying out microRNA.
Three, serum specimen microRNA extracts
Behaviour with reference to miRNA extraction separating kit (lot number: DP501) that Beijing Tian Gen biochemical technology company limited produces
Making the miRNA (involved consumptive material is without RNase) in all serum specimens of Program extraction, idiographic flow is as follows:
1. taking serum sample 200 μ L, add equal-volume lysate buffer, vortex vibrates, and 30 seconds rear chamber are gentle and quiet puts 10 points
Clock.
2., in room temperature 12,000 rev/min is centrifuged 10 minutes, takes supernatant, proceed to one without in RNase centrifuge tube.
3. adding 200 μ L chloroforms acutely to vibrate 15 seconds, room temperature is placed 5 minutes.
4., in room temperature 12,000 rev/min is centrifuged 15 minutes, is transferred in new pipe by colourless aqueous phase (about 300 μ L).
5. it is slowly added to transfer liquid and amasss the dehydrated alcohol of 1/3 volume, mixing, system is all proceeded to adsorption column miR
Spin, room temperature placement 2 minutes, room temperature 12,000 rev/min is centrifuged 30 seconds, discards adsorption column miR spin after being centrifuged, and retains and flows out
Liquid.
6. it is slowly added to the dehydrated alcohol (about 300 μ L) of effluent volume (about 300 μ L) 2/3, mixing, the solution that will obtain
Proceeding to adsorption column miR elute together with precipitation, room temperature is placed 2 minutes, room temperature 12, and 000 rev/min is centrifuged 30 seconds, abandons after being centrifuged
Fall effluent, retain adsorption column miR elute.
7. adding 500 μ L protein liquid removal MRD (having added ethanol) in adsorption column miR elute, room temperature stands 2 minutes,
Room temperature 12,000 rev/min is centrifuged 30 seconds, discards waste liquid.
8. adding 600 μ L rinsing liquid RW (having added ethanol) in adsorption column miR elute, room temperature stands 2 minutes, room temperature
12,000 revs/min are centrifuged 30 seconds, discard waste liquid.
9. repetitive operation step 8 is once.
10. putting in 2mL collecting pipe by adsorption column miR elute, room temperature 12,000 rev/min is centrifuged 1 minute, removes remnants
Liquid.
Adsorption column miRelute is proceeded to, in a new 1.5mL centrifuge tube without RNase, add 20 μ L without RNase by 11.
Distilled water, room temperature places 2 minutes, room temperature 12, and 000 rev/min is centrifugal 2 minutes, after the microRNA detectable concentration of extraction-80 DEG C
Preserve or directly carry out reverse transcription.
12.MicroRNA Concentration Testing: take microRNA sample 1 μ L, uses Quawell Q3000 trace dna detector
Preliminary detection is carried out in RNA pattern.Testing result shows, comprises length at 20-in the tiny RNA product that the method is extracted
The small fragment RNAs such as microRNA, siRNA, snRNA of 200nt.
Four, the detection of serum microRNA
1.MicroRNA molecule 3 ' end poly (A) is changed and reverse transcription
1.1 miRNA 3 ' end poly (A) change the miRcute that handling process produces with reference to Beijing Tian Gen biochemical technology company
MiRNA First-Strand cDNA synthetic agent box (lot number: KR201), the miRNA specimen of extraction on ice thaw after in nothing
The component added in the centrifuge tube of nuclease is as shown in table 1.
Table 1 adds the constituent of poly (A) tail reaction system
Being kept 60 minutes at 37 DEG C by centrifuge tube, the poly obtained (A) product preserves in-80 DEG C of ultra cold storage freezers.
The microRNA reverse transcription flow process that 1.2 poly (A) have modified produces with reference to Beijing Tian Gen biochemical technology company
MiRcute miRNA First-Strand cDNA synthetic agent box (lot number: KR201), adds in the centrifuge tube of nuclease free
Enter component as shown in table 2.
The constituent of table 2 reverse transcription reaction system
| Reaction constituent | Volume |
| Poly (A) reactant liquor | 2μL |
| 10×RT Primer | 2μL |
| 10×RT Buffer | 2μL |
| dNTPs MIX | 1μL |
| RNasin | 1μL |
| Quant RTase | 0.5μL l |
| DEPC-ddH20 | 11.5μL |
Wherein, microRNA reverse transcription universal primer sequence is: three shown in table 3 primer is dissolved into 1.5 μ g/ μ L respectively
Mother solution, more each equal-volume mixing, make the working solution of 0.5 μ g/ μ L.
Table 3 microRNA reverse transcription universal primer sequence
The centrifuge tube of reverse transcription reaction being placed on 37 DEG C keep 60 minutes, the cDNA product obtained is directly used in and quantitatively divides
Analyse or preserve at-20 DEG C of cryogenic refrigerators.
2. real-time fluorescence quantitative PCR
2.1 room temperatures melt 2 × miRcutemiRNA premix (containing SYBR) and reverse transcriptase primer (10 μMs), will during use
2 × miRcutemiRNA premix turns upside down and the most uniformly mixes, it is to avoid bubble, and uses after gentle centrifugation.By reagent
Being placed on ice, reaction system is as shown in table 4.
Table 4 real-time fluorescence quantitative PCR reaction system
| 2×miRcutemiRNA premix | 10.0μL |
| Forward primer(10μM) | 0.4μL |
| Reverse primer(10μM) | 0.4μL |
| CDNA template | 1.0μL |
| DEPC-ddH2O | 8.2μL |
| Cumulative volume | 20μL |
Real-time fluorescence quantitative PCR response procedures is:
94 DEG C 2 minutes；(denaturation)
94 DEG C 20 seconds, 60 DEG C 34 seconds, 45 circulations.
In table 4, different primer used is as shown in table 5 to sequence, and wherein, Has-miR-103qPCRprimer is internal reference
Primer, all using this primer as internal reference every time when carrying out real-time fluorescence quantitative PCR.
Table 5 primer sequence
| Sequence number | Gene Name | Forward primer 5'-3' |
| 1 | Has-miR-6801qPCR primer | AACTTGGTCAGAGGCAGCA |
| 2 | Has-miR-22qPCR primer | AAGCTGCCAGTTGAAGAACTGT |
| 3 | Has-miR-19b qPCR primer | AGTTTTGCAGGTTTGCATCCAGC |
| 4 | Has-miR-103qPCR primer | AGCAGCATTGTACAGGGCTATGA |
Downstream primer is universal primer: 5'-TCAA CGAT ACGC TACG TAACG AAAAAAAAAA-3'.
The reactant liquor that different primers configures is positioned over Roche lightcycler 480II real time fluorescent quantitative by 2.2
PCR amplification instrument carries out reading.Arranging blank in each qRT-PCR reacts, the most only add and remove nuclease water, this is anti-
Answer the amplified signal being not detected by PCR in system.
2.3 compound concentrations are the agarose gel of 3%, choose miRNA sample pcr amplification product, add appropriate loading and delay
Rushing liquid, add glue hole according to sample hole order, electrophoresis, after 60 minutes, is placed in gel electrophoresis imaging system photographic analysis.
It is the microRNA of cDNA that 2.4 fluorescent quantitations expand reverse transcription, by melting curve, amplification curve and solidifying
Gel electrophoresis integrated survey qRT-PCR reaction system specific amplification.
2.5 qRT-PCR experimental datas are analyzed through lightcycler 480II software, and software arranges PCR automatically
The baseline value of reaction and dividing value, the expression detection of each cDNA sample is all repeated 3 times.
The relative expression quantity of 2.6 all miRNA is with 2-ΔCtRepresent, the △ Ct value of each sample=(genes of interest Ct value-interior
Ginseng gene C t value), Ct value is that thermal cycler detects the intensity level of fluorescence signal in reaction system.Ct value reaction detection sensitive
Property, detect at different conditions, if its value is the lowest shows that susceptiveness is the highest with a specimen.
Five, statistical analysis
Application SPSS17.0 software carries out statistical analysis, and all data carry out normal distribution-test, and normal distribution measures
Data represents with mean ± standard deviation, and partial velocities measurement data represents with median (range interquartile).Serum between many groups
MiRNA relative expression quantity compares employing Kruskal Wallis H inspection or t inspection, compares employing Mann-between two groups
Whitney U inspection or t inspection.All statistical test are bilateral probability inspection, are that difference has statistics to anticipate during P ＜ 0.05
Justice.
The expression of the different miRNA in case group (NSCLC) and matched group is as shown in Figure 1.It will be seen from figure 1 that
In NSCLC patients serum, the expression of miR-22 is significantly higher than normal healthy controls group, difference statistically significant (Z=2.129, P
＜ 0.05)；In NSCLC patients serum, the expression of miR-19b is significantly higher than normal healthy controls group, the statistically significant (Z of difference
=2.590, P ＜ 0.05)；In NSCLC patients serum, the expression of miR-6801 is substantially less than normal healthy controls group, and difference has system
Meaning (Z=2.238, P ＜ 0.05) learned by meter.
The Sensitivity and Specificity of the different miRNA in the different case group (NSCLC) of calculating and matched group, result such as table 6
Shown in.
Sensitivity that NSCLC is detected by table 6 serum miRNA, specificity (%)
| Group | miR-22 | miR-19b | miR-6801 | miR-22+miR-19b+miR-6801 |
| Sensitivity | 19 | 16.5 | 34.7 | 58.7 |
| Specificity | 86.7 | 82.2 | 95.6 | 86.7 |
As shown in table 6, the sensitivity that NSCLC is detected by serum miR-22 is 19%, specificity is 86.7%；Serum miR-
The sensitivity that NSCLC is detected by 19b is 16.5%, specificity is 82.2%；The sensitivity that NSCLC is detected by serum miR-6801
Be 34.7%, specificity be 95.6%；The sensitivity that NSCLC is detected by three associatings (miR-22+miR-19b+miR-6801)
Be 58.7%, specificity be 86.7%.
It addition, also to miR27d, miR125b, miR197, miR27b, miR15b, miR16, miR25, miR155,
The miRNA such as miR205 design primer, carry out real-time fluorescence quantitative PCR detection, found that these miRNA are at patient and healthy person
Between expression difference with insignificance.
More than study and find first, application quantitative real-time PCR detection human serum miR-6801, miR-22 and miR-
Any one or more in 19b can be used for assisting Diagnosis of Non-Small Cell Lung.
Additionally, also carry out following experiment:
The working concentration of universal primer is 0.4 or 0.6 μ g/ μ L, and result is consistent with the effect above.
The volume of the reaction system changing real-time fluorescence quantitative PCR is 15 μ L, 25 μ L, 30 μ L, result and the effect above one
Cause.
The response procedures changing real-time fluorescence quantitative PCR is:
95 DEG C keep 2min；
95 DEG C keep 15s, and 60 DEG C keep 34s, circulate 45 times.
Or
94 DEG C keep 5min；
94 DEG C keep 20s, and 60 DEG C keep 35s, circulate 40 times.
The result obtained is consistent with the above results.
To sum up, nonsmall-cell lung cancer label provided by the present invention is included in human serum stable existence and detectable
MiRNA molecule includes: miR-6801, miR-22 and miR-19b.These 3 kinds of serum miRNA molecule marks and primer thereof can be used for
Preparing diagnostic kit, the auxiliary for the early stage of lung cancer diagnoses.
Although illustrate and describing the present invention with specific embodiment, but it will be appreciated that without departing substantially from the present invention's
May be made that in the case of spirit and scope many other change and amendment.It is, therefore, intended that in the following claims
Including all such changes and modifications belonged in the scope of the invention.
Claims (10)
1. for assisting the label of detection nonsmall-cell lung cancer, it is characterised in that include in miR6801, miR22, miR19b
Any one or more.
2. for assisting the miRNA fluorescence quantification PCR primer of detection nonsmall-cell lung cancer, it is characterised in that include internal reference primer
And detection primer, described detection primer selected from the first primer to, the second primer to any one or more of, three-primer centering；
The base sequence of the forward primer of described first primer pair is as shown in SEQ ID No.1；
The base sequence of the forward primer of described second primer pair is as shown in SEQ ID No.2；
The base sequence of the forward primer of described three-primer pair is as shown in SEQ ID No.3；
The base sequence of the forward primer of described internal reference primer is as shown in SEQ ID No.4；
Described first primer to, described second primer to, described three-primer to homogeneous with the downstream primer of described internal reference primer
With, the base sequence of described downstream primer is as shown in SEQ ID No.5.
3. contain the test kit of miRNA fluorescence quantification PCR primer described in claim 2.
4. it is used for the method that test right requires the label described in 1, it is characterised in that comprise the following steps:
Extract the miRNA in test serum sample, obtain extract；
Described extract adds poly (A) tail, and then reverse transcription obtains cDNA product；
With described cDNA product as template, carry out real-time fluorescence with the miRNA fluorescence quantification PCR primer described in claim 2 fixed
Amount PCR.
Method the most according to claim 4, it is characterised in that using miRNA reverse transcription universal primer as primer to described
Extract reverse transcription obtains cDNA product；
Described universal primer is: the primer sequence as shown in SEQ ID No.6, the primer sequence as shown in SEQ ID No.7 and
The mixture of the primer sequence as shown in SEQ ID No.8.
Method the most according to claim 5, it is characterised in that in described mixture, three primer sequences with etc. weight mix
Close.
Method the most according to claim 6, it is characterised in that the working concentration of described universal primer is 0.4-0.6 μ g/ μ
L。
The method of auxiliary detection nonsmall-cell lung cancer the most according to claim 4, it is characterised in that described real-time fluorescence is fixed
The volume of the reaction system of amount PCR is 15-30 μ L.
The method of auxiliary detection nonsmall-cell lung cancer the most according to claim 8, it is characterised in that described real-time fluorescence is fixed
The volume of the reaction system of amount PCR is 20 μ L.
10. according to the method for the auxiliary detection nonsmall-cell lung cancer described in any one of claim 4-9, it is characterised in that described
The response procedures of real-time fluorescence quantitative PCR is:
94-95 DEG C keeps 2-5min；
94-95 DEG C keeps 15-20s, and 60 DEG C keep 34-35s, circulate 40-45 time.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610318306.0A CN105925686B (en) | 2016-05-12 | 2016-05-12 | For assisting marker, primer and the detection method of detection non-small cell lung cancer |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610318306.0A CN105925686B (en) | 2016-05-12 | 2016-05-12 | For assisting marker, primer and the detection method of detection non-small cell lung cancer |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105925686A true CN105925686A (en) | 2016-09-07 |
| CN105925686B CN105925686B (en) | 2019-08-09 |
Family
ID=56834775
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610318306.0A Active CN105925686B (en) | 2016-05-12 | 2016-05-12 | For assisting marker, primer and the detection method of detection non-small cell lung cancer |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105925686B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110699457A (en) * | 2019-10-30 | 2020-01-17 | 深圳瑞科生物科技有限公司 | Primer group and kit for detecting lung cancer |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101824464A (en) * | 2009-03-02 | 2010-09-08 | 中国医学科学院放射医学研究所 | Application of miRNA (Micro-Ribonucleic Acid) expression profile in predicting sensibilities of lung cancer patients to radiotherapy |
| WO2012174282A3 (en) * | 2011-06-16 | 2013-02-07 | Caris Life Sciences Luxembourg Holdings, S.A.R.L. | Biomarker compositions and methods |
-
2016
- 2016-05-12 CN CN201610318306.0A patent/CN105925686B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101824464A (en) * | 2009-03-02 | 2010-09-08 | 中国医学科学院放射医学研究所 | Application of miRNA (Micro-Ribonucleic Acid) expression profile in predicting sensibilities of lung cancer patients to radiotherapy |
| WO2012174282A3 (en) * | 2011-06-16 | 2013-02-07 | Caris Life Sciences Luxembourg Holdings, S.A.R.L. | Biomarker compositions and methods |
Non-Patent Citations (3)
| Title |
|---|
| XIAOCHUN WANG ET.AL.: "Expression and function of miRNA in postoperative radiotherapy sensitive and resistant patients of non-small cell lung cancer", 《LUNG CANCER》 * |
| 张宝秋等: "非小细胞肺癌患者血清中miR-22检测的临床意义", 《临床肺科杂志》 * |
| 张潍等: "血清中miR-19a和miR-19b定量检测非侵入性诊断非小细胞肺癌的意义", 《山西医科大学学报》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110699457A (en) * | 2019-10-30 | 2020-01-17 | 深圳瑞科生物科技有限公司 | Primer group and kit for detecting lung cancer |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105925686B (en) | 2019-08-09 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104561331B (en) | A kind of primer detecting leukaemia correlation fusion gene and probe and kit thereof | |
| CN104293914A (en) | MiRNA marker combination for detecting primary hepatocellular carcinoma serum and application thereof | |
| US20220127684A1 (en) | Serum miRNA Markers for Diagnosing Liver Cancer and Predicting Liver Cancer Metastasis and Detection Kit Thereof | |
| CN108660215B (en) | Application of reagent for detecting circMAN1A2 and circRNF13 and kit | |
| CN107475440A (en) | A kind of application of blood plasma excretion body biomarker in breast cancer diagnosis | |
| CN107312852A (en) | Myocardial infarction diagnosis mark compositions | |
| CN107142320A (en) | Gene marker for detecting liver cancer and application thereof | |
| CN107475363B (en) | Biomarker combination for non-small cell lung cancer, screening method of biomarker combination and application of biomarker combination | |
| Mar-Aguilar et al. | Use of serum-circulating miRNA profiling for the identification of breast cancer biomarkers | |
| CN104694623A (en) | Plasma miRNA marker for diagnosis of lung cancer and application | |
| CN105506156A (en) | Molecular marker for diagnosing osteosarcoma | |
| CN105441565A (en) | miRNA regarding as osteosarcoma treatment target | |
| CN105349666B (en) | Cerebral arterial thrombosis miRNA markers | |
| CN107299129B (en) | Application of circulating nucleic acid as breast cancer biomarker | |
| CN110257514B (en) | Novel esophageal cancer blood miRNA marker and application thereof | |
| CN105925686A (en) | Marker, primer and detection method for assisted detection of non-small cell lung cancer | |
| CN103602747B (en) | Internal reference substance for detecting bladder cancer serum miRNA and its detection primers and use | |
| CN115851958A (en) | Primer, probe, kit and method for detecting pancreatic cancer related gene methylation | |
| CN112522391B (en) | Application of hsa_circ_0008961 as gout diagnosis marker | |
| CN105154533A (en) | MiRNA composition and kit therefore for diagnosis of early hepatocellular carcinoma | |
| CN104630379A (en) | Non-small-cell lung cancer marker FAM107A and application thereof | |
| CN114410795A (en) | Liver cancer early detection based on miRNA (micro ribonucleic acid) feature marker | |
| CN102021169A (en) | Serum/plasma miRNA composition and use thereof | |
| CN111455037B (en) | Coronary heart disease molecular diagnosis marker based on plasma exosome cyclic RNA and application thereof | |
| CN113416784A (en) | Serum exosome tsRNA marker related to breast cancer diagnosis and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| EE01 | Entry into force of recordation of patent licensing contract | ||
| EE01 | Entry into force of recordation of patent licensing contract |
Application publication date: 20160907 Assignee: Jiansheng Medical Technology Co.,Ltd. Assignor: Beijing Chest Hospital, Capital Medical University Contract record no.: X2023980041828 Denomination of invention: Markers, primers, and detection methods for assisting in the detection of non-small cell lung cancer Granted publication date: 20190809 License type: Exclusive License Record date: 20230914 |