CN105925574B - A kind of and the associated molecular labeling VMC2B1-1 of fruit white rot of grape resistance and its application - Google Patents
A kind of and the associated molecular labeling VMC2B1-1 of fruit white rot of grape resistance and its application Download PDFInfo
- Publication number
- CN105925574B CN105925574B CN201610512159.0A CN201610512159A CN105925574B CN 105925574 B CN105925574 B CN 105925574B CN 201610512159 A CN201610512159 A CN 201610512159A CN 105925574 B CN105925574 B CN 105925574B
- Authority
- CN
- China
- Prior art keywords
- grape
- vmc2b1
- molecular labeling
- white rot
- resistance
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
- 235000014787 Vitis vinifera Nutrition 0.000 title claims abstract description 107
- 235000009754 Vitis X bourquina Nutrition 0.000 title claims abstract description 96
- 235000012333 Vitis X labruscana Nutrition 0.000 title claims abstract description 96
- 238000002372 labelling Methods 0.000 title claims abstract description 54
- 240000006365 Vitis vinifera Species 0.000 title claims description 105
- 235000013399 edible fruits Nutrition 0.000 title abstract description 23
- 239000003550 marker Substances 0.000 claims description 27
- 238000012408 PCR amplification Methods 0.000 abstract description 15
- 238000009395 breeding Methods 0.000 abstract description 10
- 230000001488 breeding effect Effects 0.000 abstract description 8
- 241000219095 Vitis Species 0.000 abstract description 6
- 230000008485 antagonism Effects 0.000 abstract description 3
- 208000035240 Disease Resistance Diseases 0.000 abstract description 2
- 238000013467 fragmentation Methods 0.000 abstract description 2
- 238000006062 fragmentation reaction Methods 0.000 abstract description 2
- 239000000758 substrate Substances 0.000 abstract description 2
- 238000000034 method Methods 0.000 description 28
- 241000196324 Embryophyta Species 0.000 description 27
- 201000010099 disease Diseases 0.000 description 15
- 208000037265 diseases, disorders, signs and symptoms Diseases 0.000 description 15
- 238000004458 analytical method Methods 0.000 description 11
- 238000012098 association analyses Methods 0.000 description 11
- 239000003147 molecular marker Substances 0.000 description 11
- 235000017190 Vitis vinifera subsp sylvestris Nutrition 0.000 description 7
- 244000237969 Vitis vulpina Species 0.000 description 7
- 235000017242 Vitis vulpina Nutrition 0.000 description 7
- 238000001514 detection method Methods 0.000 description 6
- 230000003902 lesion Effects 0.000 description 6
- 108090000623 proteins and genes Proteins 0.000 description 6
- 238000012216 screening Methods 0.000 description 6
- 238000001962 electrophoresis Methods 0.000 description 5
- 238000004519 manufacturing process Methods 0.000 description 5
- 229920002401 polyacrylamide Polymers 0.000 description 5
- 238000004925 denaturation Methods 0.000 description 4
- 230000036425 denaturation Effects 0.000 description 4
- 238000011161 development Methods 0.000 description 4
- 230000018109 developmental process Effects 0.000 description 4
- 238000013507 mapping Methods 0.000 description 4
- 244000052769 pathogen Species 0.000 description 4
- 230000001717 pathogenic effect Effects 0.000 description 4
- 238000000611 regression analysis Methods 0.000 description 4
- 238000012360 testing method Methods 0.000 description 4
- LZZYPRNAOMGNLH-UHFFFAOYSA-M Cetrimonium bromide Chemical compound [Br-].CCCCCCCCCCCCCCCC[N+](C)(C)C LZZYPRNAOMGNLH-UHFFFAOYSA-M 0.000 description 3
- 230000009418 agronomic effect Effects 0.000 description 3
- 238000005516 engineering process Methods 0.000 description 3
- 241000326334 Coniella diplodiella Species 0.000 description 2
- 102000016928 DNA-directed DNA polymerase Human genes 0.000 description 2
- 108010014303 DNA-directed DNA polymerase Proteins 0.000 description 2
- 241000221785 Erysiphales Species 0.000 description 2
- 244000068988 Glycine max Species 0.000 description 2
- 235000010469 Glycine max Nutrition 0.000 description 2
- 241000233679 Peronosporaceae Species 0.000 description 2
- 235000009392 Vitis Nutrition 0.000 description 2
- 230000003321 amplification Effects 0.000 description 2
- 238000000137 annealing Methods 0.000 description 2
- 238000006243 chemical reaction Methods 0.000 description 2
- 210000000349 chromosome Anatomy 0.000 description 2
- 238000012258 culturing Methods 0.000 description 2
- 238000004043 dyeing Methods 0.000 description 2
- 238000012214 genetic breeding Methods 0.000 description 2
- 230000002068 genetic effect Effects 0.000 description 2
- 238000011081 inoculation Methods 0.000 description 2
- 238000013178 mathematical model Methods 0.000 description 2
- 239000011159 matrix material Substances 0.000 description 2
- 230000003020 moisturizing effect Effects 0.000 description 2
- 230000035772 mutation Effects 0.000 description 2
- 238000003199 nucleic acid amplification method Methods 0.000 description 2
- 230000002265 prevention Effects 0.000 description 2
- 239000000047 product Substances 0.000 description 2
- 238000011160 research Methods 0.000 description 2
- 230000004044 response Effects 0.000 description 2
- 238000000926 separation method Methods 0.000 description 2
- 238000010025 steaming Methods 0.000 description 2
- 239000013589 supplement Substances 0.000 description 2
- 238000002255 vaccination Methods 0.000 description 2
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Substances O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 description 2
- 108700028369 Alleles Proteins 0.000 description 1
- 208000002109 Argyria Diseases 0.000 description 1
- 201000004569 Blindness Diseases 0.000 description 1
- 206010059866 Drug resistance Diseases 0.000 description 1
- 241000233866 Fungi Species 0.000 description 1
- 235000004283 Vitis amurensis Nutrition 0.000 description 1
- 240000002503 Vitis amurensis Species 0.000 description 1
- 239000003905 agrochemical Substances 0.000 description 1
- 230000003698 anagen phase Effects 0.000 description 1
- 238000012097 association analysis method Methods 0.000 description 1
- 230000009286 beneficial effect Effects 0.000 description 1
- 230000015572 biosynthetic process Effects 0.000 description 1
- 239000003153 chemical reaction reagent Substances 0.000 description 1
- 238000007796 conventional method Methods 0.000 description 1
- 238000009826 distribution Methods 0.000 description 1
- 230000000694 effects Effects 0.000 description 1
- 238000003912 environmental pollution Methods 0.000 description 1
- 238000002474 experimental method Methods 0.000 description 1
- 239000000284 extract Substances 0.000 description 1
- 239000003292 glue Substances 0.000 description 1
- 235000002532 grape seed extract Nutrition 0.000 description 1
- 238000009396 hybridization Methods 0.000 description 1
- 238000005304 joining Methods 0.000 description 1
- 239000000463 material Substances 0.000 description 1
- 238000013508 migration Methods 0.000 description 1
- 230000005012 migration Effects 0.000 description 1
- 230000032696 parturition Effects 0.000 description 1
- 230000010152 pollination Effects 0.000 description 1
- 238000002264 polyacrylamide gel electrophoresis Methods 0.000 description 1
- 238000005204 segregation Methods 0.000 description 1
- 238000009394 selective breeding Methods 0.000 description 1
- 239000007787 solid Substances 0.000 description 1
- 241000894007 species Species 0.000 description 1
- 238000003786 synthesis reaction Methods 0.000 description 1
- 230000001988 toxicity Effects 0.000 description 1
- 231100000419 toxicity Toxicity 0.000 description 1
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Mycology (AREA)
- Botany (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention discloses a kind of and the associated molecular labeling VMC2B1-1 of the anti-white rot of grape and its applications.The molecular labeling VMC2B1-1 is that the DNA fragmentation that the resulting length of PCR amplification is 301bp is carried out by substrate of the genomic DNA of grape variety ' PINOT NOIR '.The forward primer sequence of the molecular labeling VMC2B1-1 is as shown in SEQ ID NO.1, and reverse primer sequences are as shown in SEQ ID NO.2.The contribution rate of molecular labeling VMC2B1-1 antagonism phenotype is to 58.7%, there is significant linkage disequilibriums, and the support (significant coefficient p < 0.01) of statistical probability is obtained, therefore VMC2B1-1 is and fruit white rot of grape resistance highlights correlations molecular labeling.Molecular labeling VMC2B1-1 of the present invention can be used for grape breeding for disease resistance and carry out Seedling selection, have important theory and practice directive significance for improving breeding efficiency.
Description
Technical field
The invention belongs to grape molecular genetic breeding fields, and in particular to a kind of and associated molecule of fruit white rot of grape resistance
Mark VMC2B1-1 and its application.
Background technique
Grape (Vitisvinifera) is the important industrial crops in China, and cultivated area and yield occupy first place in the world.With
The fast development of grape industry, disease become grape high-efficiency high-quality production major obstacle, wherein fruit white rot of grape is current
It is the second major disease in production, main harm fruit, blade and branch cause fruit rot in the grape growth phase, cause to subtract
It produces.At present in production to the prevention and treatment of the disease mainly based on Agro-chemicals control, Yi Yinqi fruit residual toxicity and environmental pollution,
And fungi can generate drug resistance.It is that prevention and treatment white rot is at all effective using molecular marker screening disease-resistant gene breeding resistant variety
Measure.How using Resistant gerplasm disease-resistant gene is excavated, promotes breeding for disease resistance, it is urgently to be resolved to be that current grape industry faces
The problem of.
Grape is perennial woody plant, and the generation cycle is long, as a result late.In traditional breeding method, using hybridization pollination, choosing of growing directly from seeds
The method of kind has certain blindness and randomness, for breeding resistant variety, period long low efficiency.Resist in grape
Property gene is primarily present in wild species, and such as Chinese wild grape and America population, but it lacks because of fruit low quality
Utility value, and Eurasian kind of favor due to its excellent fruit quality by the producer, but Eurasian kind lacks resistant gene.
With the development of molecular breeding technology, molecular labeling is excavated by full-length genome group association analysis, weight is carried out to Grape Germplasm resource
Economical character molecular marker analysis and positioning is wanted to become a reality, also the accuracy to improve the selection of destination number character excellent genes
It lays a good foundation with foresight.Using the molecular labeling of Molecular mapping Main Agronomic Characters, essence is exactly analyzing molecules
Exchange rate between label and objective trait, to determine the specific location of connective marker.Marker genetype separation based on acquisition
Relationship between quantitative character, can directly determine the site for character of controlling the size, and exploitation can be applied to molecular labeling auxiliary choosing
The technology of breeding is selected, this achieves successful application on many important crops.
Based on the association analysis method of linkage disequilibrium (linKage disequilibrium, LD), also known as association is mapped,
It is a kind of method for not needing to construct special group and can while be associated labeled analysis to multiple characters.With traditional base
It is compared in the QTL mapping of linkage analysis, group used in association analysis has widely heredity separation, can be simultaneously to same gene
Multiple allele of seat are analyzed, and the precision positioned can reach single-gene level, therefore association analysis is considered as pair
Effective supplement of linkage analysis.Many researchers carry out molecule marking research using the method for association analysis, explain between character
Genetic correlation.
The current research on location of molecular markers in relation to grape quantitative character still belongs to the starting stage, for the anti-white rot of grape
Molecular mapping is not yet.Therefore, carry out the association analysis of grape natural population using SSR molecular marker, and it is anti-to carry out grape
White rot Molecular mapping is the necessary means for widening molecular labeling application range.Chinese wild grape germplasm molecule of the present invention
It is to supplement the blank of the anti-white rot assisted selection technology of grape that label, which carries out positioning,.
Summary of the invention
The object of the present invention is to provide a kind of and the associated molecular labeling VMC2B1-1 of fruit white rot of grape resistance and this points
The primer pair of son label.
It is a further object of the present invention to provide a kind of with the associated molecular labeling VMC2B1-1 of fruit white rot of grape resistance in Portugal
Application in the anti-white rot marker assisted selection of grape.
The purpose of the present invention can be achieved through the following technical solutions:
A kind of and associated molecular labeling VMC2B1-1 of fruit white rot of grape resistance, the forward direction of the molecular labeling VMC2B1-1
Primer sequence is as shown in SEQ ID NO.1, and reverse primer sequences are as shown in SEQ ID NO.2.
It is with grape variety ' PINOT NOIR ' according to above-mentioned molecular labeling VMC2B1-1, the molecular labeling VMC2B1-1
Genomic DNA is the DNA fragmentation that substrate carries out that the resulting length of PCR amplification is 301bp.
A kind of primer pair with the associated molecular labeling VMC2B1-1 of fruit white rot of grape resistance, the forward direction of the primer pair are drawn
Object sequence is as shown in SEQ ID NO.1, and reverse primer sequences are as shown in SEQ ID NO.2.
Application of the above-mentioned molecular labeling VMC2B1-1 in the anti-white rot marker assisted selection of grape.
A kind of and associated molecular labeling VMC2B1-1 of fruit white rot of grape resistance, screening technique are as follows:
(1) totally 100 plants of grapevine seedlings from 17 kinds of Chinese wild grape germplasm informative population: are chosen as grape kind
Matter sources group.
(2) Grape Germplasm resource group white rot Resistance Identification: to step (1) building Grape Germplasm resource group it is white
Rot-resistant is identified, obtains the phenotypic data of the white rot Resistance Identification of Grape Germplasm resource group, specific steps are such as
Under:
Each plant chooses 20 blades (blade picks up from current-year branch third to the 5th in Grape Germplasm resource group
Piece is at age blade), fruit white rot of grape pathogen (Coniothyriumdiplodiella (Speq.) Sacc) is cultivated using PDA
Base, 28 DEG C of dark culturings 3-5 days to Pathogen culture go out spore, then according to 1 × 105Concentration by spore inoculating to grape leave simultaneously
Moisturizing, each blade set 2-4 vaccination, carry out the statistics of Lesion size after inoculation 3 days to blade.
Lesion size is counted using crossing method, and illness grade accounts for the percentage of blade area according to lesion area
Than be divided into 0-7 grade: 0=is without illness；1=0-5.0%；2=5.1-15.0%；3=15.1-30.0%；4=30.1-
45.0%；5=45.1-65.0%；6=65.1-85.0%；7=85.1-100.0%；Illness grade is also known as illness index,
Wherein, minimum illness index is 0, and highest illness index is 7.Blade area is measured with leaf area instrument, model AWOS-YMJ1.
Course of disease index (SI) is converted by illness grade, conversion formula is as follows:
Note: highest illness index: refer to that each grapevine seedling for the highest illness index (0-7) occurred in examination blade, has
Body can with bibliography (YIZHEN WAN, HEIDI SCHWANINGER, PUCHAO HE and YUEJIN WANG,
Comparison of resistance to powdery mildew and downy mildew in Chinese wild
grapes.Vitis 46(3),132–136(2007))。
Fruit white rot of grape resistance level grade is divided according to the size of course of disease index (SI), division result is shown in Table
1。
1 grape course of disease index (SI) of table and white rot resistance class divide
| Course of disease index (SI) | White rot resistance class |
| 0.0 | Immune (ER) |
| 0.1-50 | Disease-resistant (R) |
| 50.1-100.0 | Susceptible (S) |
(3) SSR marker is analyzed: the genome of 100 plants of grapevine seedlings of Grape Germplasm resource group is extracted using CTAB method
DNA, 160 SSR markers for choosing the covering full-length genome of independent separate on genome are (chain respectively from grape whole 19
Group) to Grape Germplasm resource group carry out PCR amplification, pcr amplification product electrophoresis in denaturing polyacrylamide gel, dyeing and
After development, the amplification of Grape Germplasm resource group is recorded, obtains molecular marker data.Wherein, the test operation of SSR marker
The method of procedure reference Yomamoto T. etc. (Euphytica, 2002,124:129-137), the primer is by giving birth to work biology section
The synthesis of skill company.SSR marker is detected with 8% polyacrylamide highly basic argentation.
(4) the group structure analysis in association analysis: reference literature (Wen Zixiang, Zhao Tuanjie, Zheng Yongzhan, Liu Shunhu, Wang Chun
The association analysis group structure and pass of pretty young woman, Wang Fang, Gai Junyi Chinese cultivated and wild soybean agronomic qualities proterties and SSR marker
Connection label Acta Agronomica Sinica, 2008,34 (7): 1169-1178) method, grape germplasm is provided using Structure 2.3.3 software
100 plants of grapevine seedlings of source group carry out the guild division based on mathematical model, calculate every plant of Portugal in Grape Germplasm resource group
The corresponding Q value of grape plant is (for examination its genome mutation of plant derived from the general of K group in i-th part of Grape Germplasm resource group
Rate), analyze the group structure of Grape Germplasm resource group.Concrete analysis process are as follows: number of groups K is 2-20, and assumes site
It is all independent, the suitable K value of foundation likelihood value maximum principle selection, when K value continues to increase, referring to the calculating of Evanno method
△ K=m [∣ L (K+1) -2L (K)+L (K-1) |] (K) ∣ obtains the Grape Germplasm resource group to select suitable K value to/s ∣ L
Group structure information.
(5) association analysis judges LD decay distance: according to the molecular marker data for each SSR marker that step (3) obtains, really
Determine allelic variation number and form allelic variation site matrix, is calculated between each SSR marker site using TASSEL2.0.1 software
LD value, using TASSEL2.0.1 software by the LD decay distance of calculating Grape Germplasm resource group, according to fit curve equation
Y=-0.0383ln (x)+0.2016 works as r2The value of LD is decay distance when=0.1, and it is hereditary during evolution to calculate grape
The frequency of exchange, in entirely analysis result, 23 SSR marker sites are there is significant LD and obtain statistical probability (p < 0.01)
Support, as shown in Figure 1.
(6) it determines association molecular labeling site: utilizing the GLM (generallinear model) of TASSEL2.0.1 software
Program, by the Q value (Structure analyzes destination file) of 100 plants of grapevine seedlings in each Grape Germplasm resource group as association
Variable, the white rot Resistance Identification phenotypic data that step (2) obtains carry out regression analysis to molecular marker data.To regression analysis
Result in MaKer R2(to the explanation rate of character) is analyzed, explanation rate (MaKer of four SSR marker sites to character
R2) it has been more than 40%, and significant difference coefficient p < 0.01；Wherein, the contribution rate of molecular labeling VMC2B1-1 antagonism phenotype
To 58.7% (significant coefficient p=3.48 × 10-5), it is far longer than other sites, therefore molecular labeling VMC2B1-1 is and Portugal
Grape white rot resistance highlights correlations molecular labeling site.Wherein, the length of the molecular labeling VMC2B1-1 is 301bp, described
The forward primer sequence of molecular labeling VMC2B1-1 is as shown in SEQ ID NO.1, reverse primer sequences such as SEQ ID NO.2 institute
Show.
Positive beneficial effect of the invention:
(1) present invention uses natural population as analysis object, changes traditional excavating using hybrid Population and highly closes
The mode for joining molecular labeling shortens to the fruit tree 4-5 experimentation that could be completed 1 year or even shorter.
(2) present invention utilizes 160 pairs of SSR primers, genome coverage has reached the requirement of genome-wide screening, obtains
Hereditary information it is more reliable.
(3) Chinese wild grape sources group of the present invention, artificial selection is few, and genetic diversity is high, in group
Resistance form is abundant, and trait segregation degree is higher than hybrid Population.
(4) resistance trait meets normal distribution in group, is suitable for GLM algorithm, therefore, it can be ensured that the anti-white rot of grape
The accuracy and repeatability of trait molecular marker site primer.
(5) present invention employs SSR marker methods to carry out the anti-white rot trait molecular marker positioning of grape and linked marker
Screening, SSR marker operates that more easy, repeatability is more preferable, technical requirements are low, accuracy in molecular mark
Height is codominance and anchor marker, is more easier to apply in molecular mark.
(6) present invention in highlights correlations molecular labeling site in grape group has been determined, to the quantitative character contribution rate compared with
Height, the contribution rate 58.7% in site, therefore, based on this site screening linkage molecule label to the accuracy of the disease-resistant judgement of grape compared with
It is good, especially resistance greatly with it is minimum between to identify accuracy higher.
(7) present invention has obtained the molecular labeling of one with fruit white rot of grape resistance highlights correlations by screening, utilizes this
Molecular labeling carries out the anti-white rot molecular breeding of grape, is remarkably improved the efficiency of selection and accuracy rate of the anti-white rot of grape, adds
The anti-white rot genetic breeding process of fast grape variety, thus efficiently solve heavy workload present in conventional breeding methods,
The disadvantages of period is long.
Detailed description of the invention
Fig. 1 is the attenuation curve of Grape Germplasm resource group, and that hollow dots indicate is r of the p value less than 0.052Value, curve
It is with the Trendline of the numerical value of hollow dots, that solid dot indicates is remaining r2Value, the equation of attenuation curve are as follows: y=-
0.0383ln(x)+0.2016.The LD decay distance of Grape Germplasm resource group can be obtained from the matched curve of the figure and formula
Out.
Fig. 2-A be the corresponding △ K of different K values value, that is, divide group be 2 when it is the most reasonable.
The Structure of Grape Germplasm resource group divides the public sentiment condition when Fig. 2-B is K=2, and entire test group is divided into two
Subgroup.
Fig. 3 is the electrophoresis detection that using the primer pair of molecular labeling VMC2B1-1 38 plants of grape samples are carried out with PCR amplification
(wherein, have 301bp master tape is resistance grape resource to figure, is susceptible grape resource without this master tape, and band considers when counting
Migration error of the DNA on glue).
Specific embodiment
Below by way of specific embodiment, the present invention is described in further detail, but is not intended to limit protection of the invention
Range.
Experimental method used in following embodiments is conventional method unless otherwise specified；Material used, reagent
Deng unless otherwise specified, can obtaining from commercial channels.
Embodiment 1: the acquisition with the associated molecular labeling VMC2B1-1 of fruit white rot of grape resistance
(1) totally 100 plants of grapevine seedlings from 17 kinds of Chinese wild grape germplasm informative population: are chosen as grape kind
Matter sources group.
(2) Grape Germplasm resource group white rot Resistance Identification: to step (1) building Grape Germplasm resource group it is white
Rot-resistant is identified, obtains the phenotypic data of the white rot Resistance Identification of Grape Germplasm resource group, specific steps are such as
Under:
Each plant chooses 20 blades (blade picks up from current-year branch third to the 5th in Grape Germplasm resource group
Piece is at age blade), fruit white rot of grape pathogen (Coniothyriumdiplodiella (Speq.) Sacc) is cultivated using PDA
Base, 28 DEG C of dark culturings 3-5 days to Pathogen culture go out spore, then according to 1 × 105Concentration by spore inoculating to grape leave simultaneously
Moisturizing, each blade set 2-4 vaccination, carry out the statistics of Lesion size after inoculation 3 days to blade.
Lesion size is counted using crossing method, and illness grade accounts for the percentage of blade area according to lesion area
Than be divided into 0-7 grade: 0=is without illness；1=0.1-5.0%；2=5.1-15.0%；3=15.1-30.0%；4=30.1-
45.0%；5=45.1-65.0%；6=65.1-85.0%；7=85.1-100.0%；Illness grade is also known as illness index,
Wherein, minimum illness index is 0, and highest illness index is 7.Blade area is measured with leaf area instrument, model AWOS-YMJ1.
Course of disease index (SI) is converted by illness grade, conversion formula is as follows:
Note: highest illness index: refer to that each grapevine seedling for the highest illness index (0-7) occurred in examination blade, has
Body can with bibliography (YIZHEN WAN, HEIDI SCHWANINGER, PUCHAO HE and YUEJIN WANG,
Comparison of resistance to powdery mildew and downy mildew in Chinese wild
grapes.Vitis 46(3),132–136(2007))。
Fruit white rot of grape resistance level grade is divided according to the size of course of disease index (SI), division result is shown in Table
1。
(3) SSR marker is analyzed: the genome of 100 plants of grapevine seedlings of Grape Germplasm resource group is extracted using CTAB method
DNA, 160 SSR markers for choosing the covering full-length genome of independent separate on genome are (chain respectively from grape whole 19
Group) to Grape Germplasm resource group carry out PCR amplification, pcr amplification product electrophoresis in denaturing polyacrylamide gel, dyeing and
After development, by carrying out interpretation to the molecular labeling banding pattern of acquisition, the amplification of Grape Germplasm resource group is recorded, is divided
Sub- flag data.Wherein, test operation procedure reference Yomamoto T. of SSR marker etc. (Euphytica, 2002,124:
Method 129-137), the primer are synthesized by Sheng Gong biotechnology company.8% polyacrylamide highly basic silver staining of SSR marker
Method detection.
Wherein, SSR molecular marker method are as follows: respectively to extract grape genomic DNA as template, with 160 SSR of selection
Label carries out PCR amplification to it, and amplified production is separated with 8% polyacrylamide gel electrophoresis.
PCR amplification system is (20 μ L): 10 × Buffer (Mg2+Plus) 2 μ L, 2.5mmol/L dNTP, 1.6 μ L,
0.6 μ L, 10mmol/L reverse primer of 10mmol/L forward primer, 0.6 μ L, Taq archaeal dna polymerase 0.5U, DNA profiling 50ng, it is double
Steaming water and adding to total volume is 20 μ L；
The response procedures of PCR amplification are as follows: 94 DEG C of initial denaturation 5min；94 DEG C of denaturation 30s, 55 DEG C of annealing 30s, 72 DEG C extend
45s, totally 32 recycle；72 DEG C of extension 10min.
(4) the group structure analysis in association analysis: reference literature (Wen Zixiang, Zhao Tuanjie, Zheng Yongzhan, Liu Shunhu, Wang Chun
The association analysis group structure and pass of pretty young woman, Wang Fang, Gai Junyi Chinese cultivated and wild soybean agronomic qualities proterties and SSR marker
Connection label Acta Agronomica Sinica, 2008,34 (7): 1169-1178) method, grape germplasm is provided using Structure 2.3.3 software
100 plants of grapevine seedlings of source group carry out the guild division based on mathematical model, calculate every plant of Portugal in Grape Germplasm resource group
The corresponding Q value of grape plant is (for examination its genome mutation of plant derived from the general of K group in i-th part of Grape Germplasm resource group
Rate), analyze the group structure of Grape Germplasm resource group.Concrete analysis process are as follows: number of groups K is 2-20, and assumes site
It is all independent, the suitable K value of foundation likelihood value maximum principle selection, when K value continues to increase, referring to the calculating of Evanno method
△ K=m [∣ L (K+1) -2L (K)+L (K-1) |] (K) ∣ obtains the Grape Germplasm resource group to select suitable K value to/s ∣ L
Group structure information.There are two peak values 2 and 8 by K it can be seen from Fig. 2-A；It can be seen from Fig. 2-B when K is 2, divide group
It is neat clear, it is the most reasonable that two subgroups are divided into Grape Germplasm resource group when △ K=2.
(5) association analysis judges LD decay distance: according to the molecular marker data for each SSR that step (3) obtains, determine etc.
Position variation number simultaneously forms allelic variation site matrix, calculates the LD between each SSR marker site using TASSEL2.0.1 software
Value, using TASSEL2.0.1 software by the LD decay distance of calculating Grape Germplasm resource group, according to fit curve equation y
=-0.0383ln (x)+0.2016 works as r2The value of LD is decay distance when=0.1, and it is hereditary during evolution to calculate grape
The frequency of exchange, in entirely analysis result, 23 SSR marker sites are there is significant LD and obtain statistical probability (p < 0.01)
Support, as shown in Figure 1.
(6) it determines association molecular labeling site: utilizing the GLM (generallinear model) of TASSEL2.0.1 software
Program, by the Q value (Structure analyzes destination file) of 100 plants of grapevine seedlings in each Grape Germplasm resource group as association
Variable, the white rot Resistance Identification phenotypic data that step (2) obtains carry out regression analysis to molecular marker data.To regression analysis
Result in MaKer R2(to the explanation rate of character) is analyzed, explanation rate (MaKer of four SSR marker sites to character
R2) it has been more than 40%, and significant difference coefficient p < 0.01；Wherein, the contribution rate of molecular labeling VMC2B1-1 antagonism phenotype
To 58.7% (significant coefficient p=3.48 × 10-5), it is far longer than other sites, therefore molecular labeling VMC2B1-1 is and Portugal
Grape white rot resistance highlights correlations molecular labeling site, as shown in table 2.Wherein, the length of the molecular labeling VMC2B1-1 is
The forward primer sequence of 301bp, the molecular labeling VMC2B1-1 are as shown in SEQ ID NO.1, reverse primer sequences such as SEQ
Shown in ID NO.2.
Table 2 is the character explanation rate and significant coefficient that molecular labeling VMC2B1-1 is obtained in GLM calculating
| SSR marker title | VMC2B1-1 |
| Chromosome numbers | 18 |
| Physical distance (cm) on chromosome apart from top | 37 |
| MarKer R2(%) | 58.7 |
| Significant FACTOR P | 3.48×10-5 |
Embodiment 2: the application examination of molecular labeling VMC2B1-1 of the invention in the anti-white rot marker assisted selection of grape
It tests
(1) choosing identified white rot resistance class is disease-resistant 10 plants of amur grape germ plasm resource and white rot resistance etc.
Grade is used as sample for susceptible 28 plants of grape strain, wherein white rot resistance class identification method is the same as the step in embodiment 1
(2)；38 plants of samples are verified with molecular labeling VMC2B1-1.
(2) molecular labeling VMC2B1-1 label detection is carried out to 38 plants of samples obtained, method particularly includes: use CTAB
Method extracts the genomic DNA of 38 plants of grape samples respectively, and then, the genomic DNA with the 38 plants of grape samples extracted respectively is
Template carries out PCR amplification, 8% polyacrylamide gel of amplified production by primer of the primer pair of molecular labeling VMC2B1-1
It is separated by electrophoresis (result is shown in Fig. 3).Corresponding label is determined whether there is after electrophoresis according to the presence or absence of molecular labeling VMC2B1-1,
If there is molecular labeling VMC2B1-1, illustrate that the single plant is white rot resistant strain, there is no illustrate that the single plant is white rot
Susceptible strain；It is mutually authenticated simultaneously with the result of the actually measured white rot resistance result of step (1) and Markers for Detection.
Wherein, the forward primer sequence (SEQ ID NO.1) of the primer pair of the molecular labeling VMC2B1-1 are as follows:
GGCACATGAGCGATTACATTTC；Reverse primer sequences (SEQ ID NO.2) are as follows: TGAGCTTTGTGTGCACATTTTC；
PCR amplification system is (20 μ L): 10 × Buffer (Mg2+Plus) 2 μ L, 2.5mmol/L dNTP, 1.6 μ L,
0.6 μ L, 10mmol/L reverse primer of 10mmol/L forward primer, 0.6 μ L, Taq archaeal dna polymerase 0.5U, DNA profiling 50ng, it is double
Steaming water and adding to total volume is 20 μ L；
The response procedures of PCR amplification are as follows: 94 DEG C of initial denaturation 5min；94 DEG C of denaturation 30s, 55 DEG C of annealing 30s, 72 DEG C extend
45s, totally 32 recycle；72 DEG C of extension 10min.
As the result is shown: being all to be detected in PCR amplification result in 10 plants of disease-resistant samples in white rot resistance class
Length is the amplified band (i.e. molecular labeling VMC2B1-1) of 301bp, is susceptible 28 plants of samples in white rot resistance class
In, detect the amplified band (molecular labeling VMC2B1-1) that length is 301bp in the PCR amplification result that there are 2 plants, other 26
The amplified band is not detected in strain.Therefore, reach 94.7% using molecular labeling VMC2B1-1 detection accuracy, detection is accurate
Rate is higher.Thus it can also be seen that there is preferable prediction effect with molecular labeling VMC2B1-1 prediction fruit white rot of grape resistance.
Claims (1)
1. application of the molecular labeling VMC2B1-1 in the anti-white rot marker assisted selection of grape, the molecular labeling VMC2B1-
1 forward primer sequence is as shown in SEQ ID NO.1, and reverse primer sequences are as shown in SEQ ID NO.2.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610512159.0A CN105925574B (en) | 2016-06-29 | 2016-06-29 | A kind of and the associated molecular labeling VMC2B1-1 of fruit white rot of grape resistance and its application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610512159.0A CN105925574B (en) | 2016-06-29 | 2016-06-29 | A kind of and the associated molecular labeling VMC2B1-1 of fruit white rot of grape resistance and its application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105925574A CN105925574A (en) | 2016-09-07 |
| CN105925574B true CN105925574B (en) | 2019-05-07 |
Family
ID=56829861
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610512159.0A Expired - Fee Related CN105925574B (en) | 2016-06-29 | 2016-06-29 | A kind of and the associated molecular labeling VMC2B1-1 of fruit white rot of grape resistance and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105925574B (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103131772A (en) * | 2013-01-18 | 2013-06-05 | 山东农业大学 | CYP3A88-molecular-marker breeding method for sorting porcine reproductive and respiratory syndrome (PRRS)-resistant pigs and application thereof |
| CN103740856A (en) * | 2014-02-12 | 2014-04-23 | 中国农业科学院棉花研究所 | Molecular method for predicting verticillium wilt resisting capability of different cotton materials |
| CN104450694A (en) * | 2014-11-24 | 2015-03-25 | 广西壮族自治区农业科学院水稻研究所 | q SRBSDV6 (Southern rice black-streaked dwarf virus 6) and molecular marker method thereof |
-
2016
- 2016-06-29 CN CN201610512159.0A patent/CN105925574B/en not_active Expired - Fee Related
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103131772A (en) * | 2013-01-18 | 2013-06-05 | 山东农业大学 | CYP3A88-molecular-marker breeding method for sorting porcine reproductive and respiratory syndrome (PRRS)-resistant pigs and application thereof |
| CN103740856A (en) * | 2014-02-12 | 2014-04-23 | 中国农业科学院棉花研究所 | Molecular method for predicting verticillium wilt resisting capability of different cotton materials |
| CN104450694A (en) * | 2014-11-24 | 2015-03-25 | 广西壮族自治区农业科学院水稻研究所 | q SRBSDV6 (Southern rice black-streaked dwarf virus 6) and molecular marker method thereof |
Non-Patent Citations (1)
| Title |
|---|
| Whole-genome genotyping of grape using a panel of microsatellite multiplex PCRs;Belkacem Zarouri et al;《Tree Genetics & Genomes》;20150205;表1以及表S2，摘要 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105925574A (en) | 2016-09-07 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Tar’an et al. | Genetic mapping of ascochyta blight resistance in chickpea (Cicer arietinum L.) using a simple sequence repeat linkage map | |
| Stockinger et al. | ‘Glomus intraradices DAOM197198’, a model fungus in arbuscular mycorrhiza research, is not Glomus intraradices | |
| Douhan et al. | Population genetics of ectomycorrhizal fungi: from current knowledge to emerging directions | |
| CN103146691B (en) | SNP loci linked with blight resistant gene Fon-1 in watermelon, and markers thereof | |
| Afanasenko et al. | Mapping of the loci controlling the resistance to Pyrenophora teres f. teres and Cochliobolus sativus in two double haploid barley populations | |
| CN106446596A (en) | Molecular marker remarkably related to flooding tolerance of flos chrysanthemi and identification method and application of molecular marker | |
| CN103409418B (en) | With the closely linked molecule marker of rice big grain gene GS2 and application thereof | |
| CN102140506B (en) | Molecular marker linked with gummy stem blight resistance gene Gsb-2 and application thereof | |
| CN103243092B (en) | Nucleic acid, method for identifying pathotype of fungus strain and kit | |
| CN103243093A (en) | Nucleic acid, method for identifying pathotype of fungus strain and kit | |
| CN103146831B (en) | Method for identifying rice and dry rice | |
| CN103255136B (en) | Nucleic acid, and method and kit used for identifying fungal strain pathogenic type | |
| CN107674922A (en) | Cucumber anti cucumber mosaic virus ospc gene cmv InDel marks and its application | |
| CN102080080B (en) | Molecular marker for assisted selective breeding of upland cotton with greensickness resistant traits | |
| CN104293774A (en) | Functional SSR labels obviously related with wood quality characters in populus CesAs gene, and applications and kit thereof | |
| CN107619875A (en) | A kind of insertion and deletion marker site, primer and application for being used to identify Watermelon Fruit shape | |
| CN109735650B (en) | Four single nucleotide polymorphism-based molecular markers for resisting gummy stem blight of melon and application thereof | |
| CN109797238B (en) | Two molecular markers developed based on gummy stem blight resistance identification and application thereof | |
| CN105925574B (en) | A kind of and the associated molecular labeling VMC2B1-1 of fruit white rot of grape resistance and its application | |
| CN105821153A (en) | Molecular marker related to oilseed rape pod-shattering resistance quantitative trait loci (QTL) and application | |
| CN105803083A (en) | Molecular marker of pear fruit single fruit weight main-effect QTL (quantitative trait loci) site MSF, and application thereof | |
| CN103215289A (en) | Gene sequence a for causing watermelon bisexual flower development and obtaining method thereof | |
| CN106011136B (en) | SSR (simple sequence repeat) marker related to ramie yield and application thereof | |
| CN105462971A (en) | Specific molecular marker for rice blast resistance gene Pi2 and dedicated primers thereof | |
| CN101845504B (en) | Primer sequence for identifying resistance of cucumber against alternaria cucumerina and identification method thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20190507 |