CN105925537B - A kind of monoclonal antibody of the glycoprotein gd of anti-HSV and the hybridoma for generating the antibody - Google Patents
A kind of monoclonal antibody of the glycoprotein gd of anti-HSV and the hybridoma for generating the antibody Download PDFInfo
- Publication number
- CN105925537B CN105925537B CN201610249934.8A CN201610249934A CN105925537B CN 105925537 B CN105925537 B CN 105925537B CN 201610249934 A CN201610249934 A CN 201610249934A CN 105925537 B CN105925537 B CN 105925537B
- Authority
- CN
- China
- Prior art keywords
- hsv
- monoclonal antibody
- infection
- cell
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
- C07K16/08—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from viruses
- C07K16/081—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from viruses from DNA viruses
- C07K16/085—Herpetoviridae, e.g. pseudorabies virus, Epstein-Barr virus
- C07K16/087—Herpes simplex virus
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
- G01N33/56983—Viruses
- G01N33/56994—Herpetoviridae, e.g. cytomegalovirus, Epstein-Barr virus
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/577—Immunoassay; Biospecific binding assay; Materials therefor involving monoclonal antibodies binding reaction mechanisms characterised by the use of monoclonal antibodies; monoclonal antibodies per se are classified with their corresponding antigens
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
- C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
- C07K2317/565—Complementarity determining region [CDR]
Abstract
The invention discloses a kind of hybridomas, are preserved in China typical culture collection center, deposit number on January 27th, 2016 are as follows: CCTCC NO:C201620.The invention also discloses a kind of monoclonal antibodies of the glycoprotein gd of anti-HSV, it includes light chain variable region complementary determining region CDR1 and CDR2 sequences shown in heavy chain variable region complementary determining region CDR1 and CDR2 sequence shown in SEQ ID NO:1 and SEQ ID NO:2 and SEQ ID NO:3 and SEQ ID NO:4.The monoclonal antibody can be used for diagnosing and treating HSV infection or disease relevant to HSV infection.The invention also discloses the methods of a kind of detection HSV or the cell of its infection, it include: to contact the HSV or the cell of its infection with said monoclonal antibody, the monoclonal antibody not with the HSV or the cell combination of its infection is washed away, then shows the monoclonal antibody of the cell combination with the HSV or its infection.The invention also discloses a kind of methods for neutralizing HSV, comprising: contacts monoclonal antibody described in any one of the HSV and claim 2 to 4.
Description
Technical field
The present invention relates to antibody arts, relate more particularly to a kind of monoclonal antibody of the glycoprotein gd of anti-HSV, Yi Jiyong
In the hybridoma for generating the antibody.
Background technique
Herpesviral includes the double stranded DNA virus of a major class.Two kinds of commonly known viruses are pure blisters
1 type of exanthema virus and 2 types, referred to as HSV1 and HSV2 and varicella virus (VZV).HSV1 causes mouthful a face lesion, usually quilt
Referred to as fever-blister or cold sore.In addition, there is about 30% case genital herpes to be caused by HSV1.HSV2 ratio HSV1 is seldom
See, causes anogenital lesion.
There are many HSV detection method at present, there is viral culture of isolated method, HSV virus antigen detection method, antibody act, PCR method.
Virus culture partition method, is the goldstandard of HSV detection method, and virus inoculation is proliferated in cell, and then separates identification poison
Plant type is other.But this method period is long, it is desirable that it is stringent, it is expensive, and it is cumbersome, it is suitable for scientific research, is unsuitable for routine clinical
Detection.HSV virus antigen detection method, it is clinical to mostly use enzyme linked immunosorbent assay (ELISA) for HSV antigen at skin injury greatly
Detection.HSV virus infection typical case person, clinic will appear ulcer, blister warts etc., dipped with cotton swab and make sample at ulceration, with double
Antibody sandwich detects antigen.The method sensibility, specificity are stronger, are suitble to detection clinical manifestation typical case person.Furthermore it is incubated for temperature
Degree, specimen quality and manual operation factor will lead to the appearance of false positive.Antibody act uses polypeptide or recombinant expression virus protein
Component has preferable specificity and antigenicity as antigen, can carry out parting to the IgG of HSV using enzyme-linked immunosorbent assay
Detection is clinically common detection means.PCR method, wherein FQ-PCR method applies fluorescent probe technique, has high sensitivity
And the advantages of high specific, it also can be used as clinically used detection means.
Although clinically there is antiviral chemotherapy method, HSV virus infection is still to seriously threaten the mankind to be good for
The global problem of health.It is growing with immune deficiency patient's drug resistance, so that it is aobvious to explore new effective treatment method
It obtains extremely urgent.
Screen one plant of the present invention can secrete the fusion cell line of the monoclonal antibody for HSV gD, the list of secretion
Clonal antibody specifically can identify the gD albumen of HSV-1 and HSV-2 virus, and can effectively neutralize HSV-2 virus sense
Contaminate cell.The monoclonal antibody that the present invention screens can be used in the treatment of diagnosis and its infection of HSV virus.
Summary of the invention
The invention discloses a kind of hybridoma cell strain 27E1, are preserved in Chinese Typical Representative culture on January 27th, 2016
Object collection (better address are as follows: Wuhan City, Hubei Province Bayi Road 229, Wuhan University's collection), deposit number are as follows:
CCTCC NO:C201620。
The invention also discloses a kind of monoclonal antibody of the glycoprotein gd of anti-HSV generated by above-mentioned hybridoma,
It includes heavy chain variable region complementary determining region CDR1 and CDR2 sequences shown in SEQ ID NO:1 and SEQ ID NO:2, and
Light chain variable region complementary determining region CDR1 and CDR2 sequence shown in SEQ ID NO:3 and SEQ ID NO:4.
Further, the heavy chain variable region of monoclonal antibody nucleic acid sequence encoding as shown in SEQ ID NO:5,
And the light chain variable region of the monoclonal antibody has nucleic acid sequence encoding shown in SEQ ID NO:6.
Monoclonal antibody disclosed by the invention can be used for preparing diagnosis HSV infection or infect the examination of relevant disease to HSV
Agent.
Monoclonal antibody disclosed by the invention can also be used in preparation treatment HSV infection or infect relevant disease to HSV
Drug.
The invention also discloses a kind of methods of the cell of HSV or its infection in test sample, comprising: makes the sample
It is contacted with monoclonal antibody as claimed in claim 2 or claim 3, washes away unbonded monoclonal antibody, then display and the HSV
Or the monoclonal antibody of the cell combination of its infection, substance or cell in conjunction with the monoclonal antibody are HSV or its sense
The cell of dye.The detection method can be used for lab-purpose, or can be used for medical usage.
Further, show that the monoclonal antibody of the cell combination with the HSV or its infection can take immunochemistry to contaminate
Color method or immunofluorescence staining carry out.For example, the total protein in extractable sample, is carrying out SDS polypropylene to total protein
After acyl ammonia gel electrophoresis, transferring film is then carried out, film is incubated for monoclonal antibody of the invention, is then directed to monoclonal of the invention
The secondary antibody that horseradish peroxidase has been conjugated of antibody is incubated for, and the substrate for adding horseradish peroxidase is developed the color to show
Show.Or in the western blotting method, other molecular labelings or fluorescent marker in addition to horseradish peroxidase can be used.
Molecular labeling or fluorescent marker can also be directly conjugated in monoclonal antibody of the invention.Other than using immunoblotting,
Immunohistochemistry, immunocytochemistry (the two general designation immunochemistry) and the method for immunofluorescence can be used to realize this hair
It is bright.These methods are well known in the present art.
The invention also discloses a kind of methods for neutralizing HSV, comprising: makes HSV monoclonal antibody of the present invention
Contact.The neutralization method can be used for lab-purpose, or can be used for medical usage.
Detailed description of the invention
Fig. 1 is the electrophoretogram that PCR amplification gD1 encodes segment, is wherein the coding truncated extracellular region of gD shown in swimming lane
The nucleic acid fragment of (1-343aa) gD1 albumen；
Fig. 2 is that prokaryotic expression product runs the coomassie brilliant blue staining figure after SDS-PAGE glue, wherein swimming lane 1 is after inducing
Inclusion body, swimming lane 2 be induction after supernatant, swimming lane 3 be induce after full bacterium solution, swimming lane 4 is the bacterium solution not induced, swimming lane M
For ladder marker；
Fig. 3 is that prokaryotic expression product runs the electrophoretogram obtained after SDS-PAGE glue by western blot, wherein swimming lane
1 is the inclusion body after induction, and swimming lane 4 is the bacterium solution figure not induced, and swimming lane M is ladder marker；
Fig. 4 is the gD albumen of the detection prokaryotic expression of antibody in two immune serums and the gD albumen of eukaryotic expression
Western blot figure, wherein it is that primary antibody carries out 1:1000,1 respectively that the top half of figure, which is by the eye socket blood of 1# mouse:
To the gD of prokaryotic expression (swimming lane 1,3,5) and to the gD albumen of eukaryotic expression after the dilution proportion of 10000 and 1:100000
(swimming lane 2,4,6) is detected.NC is that (swimming lane 7 is the gD of prokaryotic expression to not immune mouse serum control, and swimming lane 8 is eukaryon table
The gD reached)；
It is that primary antibody carries out 1:1000,1:10000 and 1 respectively that the lower half portion of figure, which is by the eye socket blood of 2# mouse:
After 100000 dilution proportion to the gD of prokaryotic expression (swimming lane 9,11,13) and to the gD albumen of eukaryotic expression (swimming lane 10,
12,14) it is detected.NC is that (swimming lane 15 is the gD of prokaryotic expression to not immune mouse serum control, and swimming lane 16 is eukaryotic expression
gD)；
Fig. 5 is that the fluorogram for having the sf9 cell of gD albumen is expressed in the antibody test in two immune serums, wherein
1#, 2# serum that mouse is immunized are carried out 1:300 the (the 2nd by the fixed sf9 cell with baculovirus expression system expression gD respectively
Row), 1:900 (the 3rd row), 1:2700 (the 4th row) gradient dilution be used as primary antibody, negative control (the 1st row) for 1#, 2# be immunized it is small
The preimmune serum of mouse, secondary antibody are the sheep anti-mouse igg of FITC label；
Fig. 6 is that the antibody-solutions of purifying run the coomassie brilliant blue staining figure after SDS-PAGE glue, wherein swimming lane 1,2,3,4,
5,6 be respectively purified antibodies eluent, the band in figure is respectively the heavy and light chain of purified monoclonal antibody；(antibody is incorporated in purifying
Eluted after on column with the eluent of 2mL, the every 200 μ L mono- of eluent is managed, about 10 pipes, 1-6 be remove in 10 pipes preceding 2 pipe with
6 pipes after 2 pipes afterwards, then take a certain amount of carry out electrophoresis respectively)；
Fig. 7 is the correlation curve figure of standard protein concentration-A595 value；
Fig. 8 is the Western blot figure that monoclonal antibody of the invention detects gD albumen, wherein a, b and c be respectively with
The gD albumen (swimming lane 1) of sf9 cell expression, the gD albumen (swimming lane 2) in the Vero cell of HSV-1 infection and HSV-2 infection
Vero cell in gD albumen (swimming lane 3) be antigen Western blot scheme, swimming lane is that M is albumen marker；
Fig. 9 is the fluorogram for the cell that HSV has been infected in monoclonal antibody detection of the invention, wherein the 1st is classified as recombination disease
The sf9 cell of malicious vAcBac-gD2 infection, the 2nd is classified as the Vero cell of HSV-2 infection；
Figure 10 is the vigor histogram for the cell that the HSV-2 after being neutralized by monoclonal antibody of the invention infects, wherein 1 is
Monoclonal antibody 27E1,2 be serum (negative control) before mouse immune, 3 be immune mouse polyclonal sera (positive control).
Specific embodiment
The principle and features of the present invention will be described below with reference to the accompanying drawings, and the given examples are served only to explain the present invention, and
It is non-to be used to limit the scope of the invention.
The preparation of 1. hybridoma of embodiment
1. the nucleic acid that virus is extracted in the preparation of immunogene from the Vero cell pyrolysis liquid that HSV-2 infects is template, pass through
PCR (the primer sequence: gD1-F:5 '-CCGGAATTCGCCACCATGGGGCGTTTGACCTCCG-3 ' gD1-R:5 '-CCCA
AGCTTCTAGCGCGGCACCAGGCCGCTGCTGATGATCAGGCCC GGGTTG-3') amplification obtain coding gD it is truncated extracellular
Then the nucleic acid fragment (Fig. 1) of area's gD1 albumen is cloned into prokaryotic expression carrier pET- with EcoRI/HindIII double digestion
On 32a, and it is named as pET-32a-gD1.After digestion and sequencing identification correctly, by pET-32a- in a manner of electroporation
GD1 is transferred in e. coli bl21, and 37 DEG C of IPTG (final concentration of 1mM) induce 4 hours.Pass through coomassie brilliant blue staining (Fig. 2)
Detect gD1 protein expression in inclusion body with western blot (Fig. 3).
2. mouse immune purifies gD1 albumen from inclusion body, is emulsified with not formula Freund's complete adjuvant (Sigma company), exempted from respectively
The BALB/c mouse (being purchased from Wuhan Virology Institute,Chinan academy of Sciences) of 2 6-8 week old of epidemic disease.Every mouse of abdominal part hypodermic 6
Point, dosage are 60 μ g/.Every 14 days booster immunizations are primary, and antigen is emulsified using Freund's complete adjuvant (Sigma company), dosage
Only for 30 μ g/.After 4 times immune, eye socket takes blood, is resisted by western blot and immunofluorescence in 2 immune serums
The specificity and potency of body carry out entry evaluation.Shown in as shown in Figures 4 and 5, obtained antibody is in dilution 105After times still
It can be used for western blot detection, after 2700 times of dilution, still can be used for Immunofluorescence test, and keep to gD1 egg
White specificity.
3. prepare hybridoma take above-mentioned 2# be immunized mouse spleen cell, be made steril cell suspension (Hanks liquid,
Formula: NaCl 8.01；KCl 0.4；CaCl20.14；NaHCO30.35；KH2PO40.06；Glucose 0.34g/l), with bone
Myeloma cells SP2/0 (Wuhan Virology Institute,Chinan academy of Sciences) is centrifuged 5min with the fusion of 5:1 ratio, 1500rpm.After abandoning supernatant
Centrifuge tube is put into 37 DEG C of water-baths, and the Hybri-Max of 1mL is slowly added in 1 minuteTM(Sigma company), and stir cell.
After standing 1min in warm water, the DMEM (Xin Zong section) of 10mL serum-free is added, mixes, 1000rpm is centrifuged 5min.After abandoning supernatant
Addition 10mL serum (GIBCO company) is careful to get up cell piping and druming, and 5mL mixing 10 × HAT (Sigma company) is added
Thymocyte mixes.The semisolid culturemedium that 25mL contains 2.1% NC Nitroncellulose (Sigma company) is added to mix well,
Then it uniformly pours into 20 Tissue Culture Dish.Cell is put into wet box, is placed in 37 DEG C, 5%CO2It is cultivated in incubator.
After fusion 7 days, round, real, big cloning cluster is selected under anatomical lens be transferred to and be ready in 96 orifice plates of culture medium in advance, be put into 37
DEG C, 5%CO2It is cultivated in incubator.Multi-turns screen is carried out to fused cell with the method for ELISA after 3 days, and combines Western
Bolt and immunofluorescence experiment are verified, and are obtained cell strain 27E1 and are committed to China typical culture collection center (CCTCC)
Preservation, deposit number are as follows: CCTCC NO:C201620.
Embodiment 2. generates monoclonal antibody with hybridoma
Ascites induces method preparation monoclonal antibody and logarithmic growth phase cell is washed and hanged with serum free medium, takes 1
×105, the suspension cell intraperitoneal injection of 1mL is in advance with the mouse of paraffin oil sensitization.Start to collect ascites, the abdomen of taking-up after 7 days
Water is in 4 DEG C of centrifugation 4000rpm 10min.The intermediate ascites of careful suction is collected in centrifuge tube, 4 DEG C or -20 DEG C preservations.With
HiTrap rProtein A (GE company) affinity chromatography antibody purification from ascites.SDS-PAGE glue identifies purity, such as Fig. 6
Shown, purified antibody-solutions purity is very high, two bands of heavy chain and light chain is only indicated, substantially without miscellaneous band.
Bradford method measures concentration (table 1), and the antibody of purifying is stored in -20 DEG C.Be abscissa according to the standard concentration in table 1,
It is y=1.204x+0.732 (Fig. 7) that corresponding A595 value, which is that ordinate does linear relationship chart and obtain linear equation,.By albumen sample
The A595 value of product dilution substitutes into the equation, and the concentration for calculating protein sample is 0.556mg/mL.
Table 1: standard items protein concentration and sample protein concentration and corresponding A595 value
| Sample | A595 value |
| Standard items (0mg/mL) | 0.735 |
| Standard items (0.025mg/mL) | 0.736 |
| Standard items (0.05mg/mL) | 0.794 |
| Standard items (0.1mg/mL) | 0.847 |
| Standard items (0.2mg/mL) | 1.019 |
| Standard items (0.3mg/mL) | 1.088 |
| Standard items (0.5mg/mL) | 1.222 |
| Standard items (0.5mg/mL) | 1.316 |
| Protein sample dilution | 1.402 |
Monoclonal antibody subgroup identification 100mL PBS (NaCl 137mmol/L, KCl 2.7mmol/L, Na2HPO4
10mmol/L, KH2PO42mmol/L, PH7.4) dilution coating sheep anti-mouse igg is to 0.5 μ g/mL, and every hole adds 100 μ L, and 4 DEG C are overnight.
It is emptied liquid, is washed 3 times with the PBS (PBS-T) containing 0.05%Tween, every hole is added 200 μ L confining liquids and (contains 2%BSA and 3% sugarcane
The PBS of sugar), 37 DEG C of incubation 1h.Liquid is emptied to be cleaned 3 times with PBS-T.0.1mL hybridoma supematant, 37 DEG C of incubations are added in every hole
1h.Liquid is emptied to be cleaned 3 times with PBS-T.With confining liquid 1:1000 dilution HRP label sheep anti mouse (comprising IgM, IgG1,
IgG2a, IgG2b, IgG2c and IgG3) antibody (newly vertical coe virus disease engineering technology Co., Ltd, Hubei), every hole is added
0.1mL, 37 DEG C of incubation 1h.Liquid is emptied to be cleaned 3 times with PBS-T.Every hole is added 50 μ L and contains 0.15%ABTS and 003%H2O2's
Citrate buffer solution carries out chromogenic reaction, the OD value in 10-20min under measurement 405nm wavelength.As the result is shown (table 2): the present invention
Monoclonal antibody is IgG2a type source of mouse monoclonal antibody.The subtype identification for the monoclonal antibody that table 2 purifies
Variable region of mab sequencing extracts the total serum IgE of cell strain 27E1 using TRIzol reagent.According to 5 '
Step described in Full RACE Kit operation instructions synthesizes cDNA and outer PCR by adaptor connection, reverse transcription
Reaction, obtains the weight chain variable region gene segment of antibody, is cloned on T Easy carrier, is sequenced.outer PCR
Reaction upstream primer used is the 5 '-RACE Outer Primer carried in 5 ' Full RACE Kit, downstream primer are as follows: weight
Chain CH-R:CCAGGGGCCAGTGGATAGACAAGCTTGGGTGTCGTTTT；Light chain CL-R:GGATACAGTTGGTGCAGCATC.
The weight chain variabl area sequence SEQ ID NO:5 that sequencing obtains encoding the monoclonal antibody can with the light chain for encoding the monoclonal antibody
Become region sequence SEQ ID NO:6.By it is Coding Sequence Transformed at amino acid sequence after, pass through analysis, wherein heavy chain variable region CDR1
It is respectively sequence shown in SEQ ID NO:1 and SEQ ID NO:2, light chain variable region CDR1 and CDR2 sequence point with CDR2 sequence
It Wei not sequence shown in SEQ ID NO:3 and SEQ ID NO:4.
Embodiment 3. detects HSV
Monoclonal antibody reactive specificity identification is respectively with gD2, Yi Jiyong of the sf9 cell expression of vAcBac-gD2 infection
The Vero cell of HSV-1 or HSV-2 (Wuhan virus institute, Chinese Academy of Sciences bacterium kind collection) infection uses immunoblotting as antigen
Method detects the specificity of monoclonal antibody identification gD albumen of the invention.Immunoblot experiment process is as follows: respectively by sf9 cell
Vero cell sample 5 × Sample Buffer (250mM of gD2 albumen and HSV-1 and the HSV-2 infection of expression
TrisHCl pH6.8,10%SDS, 30%Glycerol, 5% β-mercapitalethanol, 0.02%bromophenol
Blue it) cracks and runs glue after sufficiently boiling, by protein delivery to pvdf membrane, the closing of 5% 4 DEG C of skim milk is overnight, slow with TBST
Fliud flushing washes film 3 times, each 5min.Film is immersed into monoclonal hybridoma culture medium supernatant (wherein containing hybridoma point
The monoclonal antibody 27E1 secreted) in, 37 DEG C of incubations 2.5h, TBST wash film 3 times, each 5min.With the TBS 1 containing 0.5% skim milk:
The sheep anti mouse secondary antibody of 5000 dilution HRP labels, is added on washed film, 37 DEG C of incubation 2h.After TBST is washed 3 times, peroxide is used
Compound substrate (SuperSignal West Pico Chemiluminescent Subtrate, Fementas) and development system
System (MicroChemi Bio-imaging system, DNR) object observing albumen.As shown in figure 8, monoclonal cell strain 27E1
It can specifically and sensitively identify the gD albumen in the Vero cell of the expression of sf9 cell or HSV-1, HSV-2 infection.
Respectively with the gD2 of the sf9 cell expression of vAcBac-gD2 infection and with HSV-2 (Wuhan virus institute, Chinese Academy of Sciences bacterium
Seed culture of viruses collection) infection Vero cell be used as antigen, with immuno-fluorescence assay it is of the invention monoclonal antibody identification day
The specificity of right conformation gD albumen.Immunofluorescence experiment process is as follows: Sf9 cell and Vero cell are tiled respectively to 96 orifice plates
On, every hole about 1 × 104A cell.After adherent, (logarithmic growth phase will be in recombinant virus vAcBac-gD2 infection Sf9 cell
Sf9 cell inoculation into capsule, 28 DEG C of adhere-wall cultures are stayed overnight.Secondary daily lipofection transfects 5 μ gAcBac-gD2.Turn
The 5-7 days after dye, there is obvious CPE (cell rounding expands) collection supernatant and obtains recombinant baculovirus vAcBac- in cell
gD2.Sf9 cell monolayer is infected with 5 MOI recombinant baculovirus vAcBac-gD2, fixes cell with 4% paraformaldehyde after 4 days
Sample.), with HSV-2 vero cells infection, DMEM culture medium (the GIBCO public affairs of 2% fetal calf serum (GIBCO company) are changed after infection
Department), after 36h, 10min is fixed with 4% paraformaldehyde, 1 × PBS is washed 3 times.It is saturating with the 0.15%Triton-X 100 newly prepared
Change 10min, 1 × PBS is washed 3 times, each 5min.With 5% BSA closing cell, after 37 DEG C of incubation 30min, 1 × PBS washing 3
It is secondary, each 5min.Primary antibody is monoclonal hybridoma culture medium supernatant stoste, 37 DEG C of incubations 2h, 1 × PBS washing 3 times, often
Secondary 5min.Sheep anti-mouse igg (fluorescein isothiocyanate [FITC]-conjugated that secondary antibody is marked with FITC；
Proteintech it) is diluted by 1:1000,37 DEG C of incubations 2h, 1 × PBS washing 3 times, each 5min uses fluorescence microscope.
As shown in Figure 9: 27E1 can identify the sf9 cell for having infected recombinant virus vAcBac-gD2, can also identify and infect HSV-2 disease
The Vero cell of poison infection.
Embodiment 4. neutralizes HSV in vitro
With Cell Counting Kit (CCK-8/WST-8) kit (the green skies) detection monoclonal fused cell secretion
Antibody to the neutralization activity of HSV-2.Method particularly includes: Vero cell, every hole about 5 × 10 are inoculated in 96 orifice plates3A cell,
96 orifice plates are placed on 37 DEG C, 5%CO2Incubator in adhere-wall culture.By the HSV-2 of 0.1 MOI respectively with Monoclonal hybridomas
Cell culture medium supernatant stoste, immune rear mouse polyclonal serum (positive control) or preimmune serum (negative control) are incubated in 37 DEG C
1h is educated, uses Incubating Solution vero cells infection (100 hole μ l/) later.10 μ l CCK-8 solution are added into every hole by 48h after infection.
By 96 orifice plates in 37 DEG C of incubation 1h, with the absorbance at microplate reader measurement 450nm.The results are shown in Figure 10: Monoclonal hybridomas
The antibody of cell strain 27E1 secretion has stronger neutralization activity.
The foregoing is merely presently preferred embodiments of the present invention, is not intended to limit the invention, it is all in spirit of the invention and
Within principle, any modification, equivalent replacement, improvement and so on be should all be included in the protection scope of the present invention.
Claims (8)
1. a kind of hybridoma, the hybridoma was preserved in China typical culture collection on January 27th, 2016
The heart, deposit number are as follows: CCTCC NO:C201620.
2. a kind of monoclonal antibody of the glycoprotein gd of anti-HSV, which is characterized in that by hybridoma described in claim 1
The antibody for generating 2 subclass of mouse anti-human igg is determined comprising heavy chain variable region complementation shown in SEQ ID NO:1 and SEQ ID NO:2
Light chain variable region complementary determining region CDR1 shown in area's CDR1 and CDR2 sequence and SEQ ID NO:3 and SEQ ID NO:4 and
CDR2 sequence.
3. monoclonal antibody according to claim 2, which is characterized in that the heavy chain variable region of the monoclonal antibody by
Nucleic acid sequence encoding shown in SEQ ID NO:5, and the light chain variable region of the monoclonal antibody has shown in SEQ ID NO:6
Nucleic acid sequence encoding.
4. a kind of application of monoclonal antibody as claimed in claim 2 or claim 3, which is characterized in that be used to prepare diagnosis HSV infection
Or the reagent of relevant disease is infected to HSV.
5. a kind of application of monoclonal antibody as claimed in claim 2 or claim 3, which is characterized in that be used to prepare treatment HSV infection
Or the drug of relevant disease is infected to HSV.
6. a kind of method of the non-diagnostic purpose of the cell of HSV or its infection in test sample, which is characterized in that including following
Step: contacting the sample with monoclonal antibody as claimed in claim 2 or claim 3, washes away unbonded monoclonal antibody, so
The monoclonal antibody for showing the cell combination with the HSV or its infection afterwards, the substance or thin in conjunction with the monoclonal antibody
Born of the same parents are the cell of HSV or its infection.
7. according to the method described in claim 6, it is characterized in that, the list of display and the HSV or the cell combination of its infection
Clonal antibody take immunochemistry histochemical method, immunocytochemical method, Western blot or immunofluorescence staining come into
Row.
8. a kind of method for the non-treatment purpose for neutralizing HSV, which comprises the following steps: make the HSV and such as right
It is required that monoclonal antibody described in 2 or 3 contacts.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610249934.8A CN105925537B (en) | 2016-04-21 | 2016-04-21 | A kind of monoclonal antibody of the glycoprotein gd of anti-HSV and the hybridoma for generating the antibody |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610249934.8A CN105925537B (en) | 2016-04-21 | 2016-04-21 | A kind of monoclonal antibody of the glycoprotein gd of anti-HSV and the hybridoma for generating the antibody |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105925537A CN105925537A (en) | 2016-09-07 |
| CN105925537B true CN105925537B (en) | 2019-09-06 |
Family
ID=56839612
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610249934.8A Active CN105925537B (en) | 2016-04-21 | 2016-04-21 | A kind of monoclonal antibody of the glycoprotein gd of anti-HSV and the hybridoma for generating the antibody |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105925537B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| TWI815194B (en) | 2020-10-22 | 2023-09-11 | 美商基利科學股份有限公司 | INTERLEUKIN-2-Fc FUSION PROTEINS AND METHODS OF USE |
| CN113788892B (en) * | 2021-11-16 | 2022-02-18 | 南京黎明生物制品有限公司 | Rapid detection kit applying anti-herpes simplex virus monoclonal antibody |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1997026329A1 (en) * | 1994-09-13 | 1997-07-24 | Sandoz Pharmaceuticals Corporation | Monoclonal antibody to herpes simplex virus and cell line producing same |
-
2016
- 2016-04-21 CN CN201610249934.8A patent/CN105925537B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1997026329A1 (en) * | 1994-09-13 | 1997-07-24 | Sandoz Pharmaceuticals Corporation | Monoclonal antibody to herpes simplex virus and cell line producing same |
Non-Patent Citations (5)
| Title |
|---|
| Herpes simplex virus glycoprotein D protective immunity against murine herpetic keratitis;Inoue Y et al;《Investigative Ophthalmology》;19900301;第31卷(第3期);411-418 * |
| 单纯疱疹病毒I型糖蛋白D胞外区的真核表达及生物学活性分析;王正茂 等;《生物工程学报》;20100525;第26卷(第5期);657-663 * |
| 单纯疱疹病毒单克隆抗体的制备及鉴定;郭勇 等;《中国生物制品学杂志》;20020725;第15卷(第4期);232-234 * |
| 单纯疱疹病毒单克隆抗体靶抗原的鉴定及其编码基因的定位;俞启桂 等;《细胞与分子免疫学杂志》;19891001(第3期);1-6 * |
| 抗II型单纯疱疹病毒表面抗原gD单克隆抗体的制备及鉴定;王耀 等;《药物生物技术》;20121215;第19卷(第6期);495-497 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105925537A (en) | 2016-09-07 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103483447B (en) | The broad-spectrum monoclonal antibody of anti-HPV L1 albumen or its Fab and their purposes | |
| CN102498217A (en) | Antibodies specific to E6 proteins of HPV and use thereof | |
| CN105131113B (en) | For cervical carcinoma detection and the grand antibody of list being classified and its application | |
| WO2005063286A1 (en) | Antibodies for oncogenic strains of hpv and methods of their use | |
| CN107058239B (en) | Anti-classical swine fever virus E2 protein monoclonal antibody cell strain and application thereof | |
| CN105524166A (en) | Monoclonal antibody for identifying HPV18 positive cervical epithelial cancer cells, and applications thereof | |
| CN105504049A (en) | Monoclonal antibody against HPV E7 protein related to cervical carcinoma and application thereof | |
| CN109180810B (en) | Antibody specifically binding norovirus GI.1 genotype VP1 protein or VLP, and preparation method and application thereof | |
| CN105367652A (en) | Monoclonal antibody resistant to HPV16L1 protein and preparation method and application thereof | |
| Kobayashi et al. | Characterization and epitope mapping of monoclonal antibodies raised against rat hepatitis E virus capsid protein: An evaluation of their neutralizing activity in a cell culture system | |
| CN105153302B (en) | A kind of antibody, preparation method and the application of anti-HPV6L1 albumen | |
| CN112876559B (en) | Monoclonal antibody specifically binding to porcine rotavirus and application thereof | |
| US8828400B2 (en) | Antibody that binds to H-1 parvovirus | |
| CN114057868A (en) | Porcine delta coronavirus antibody, kit containing porcine delta coronavirus antibody and application | |
| CN105925537B (en) | A kind of monoclonal antibody of the glycoprotein gd of anti-HSV and the hybridoma for generating the antibody | |
| KR100832870B1 (en) | Monoclonal antibody against nucleocapsid protein of SARS coronavirus and the use thereof | |
| CN109082413A (en) | Anti-human igg monoclonal antibody, its hybridoma cell strain and application | |
| Croppo et al. | Identification of the microsporidian Encephalitozoon hellem using immunoglobulin G monoclonal antibodies | |
| CN108752471A (en) | The preparation method and applications of anti-PCV2 monoclonal antibodies | |
| CN115947835B (en) | Antibody targeting influenza B virus nucleoprotein and application thereof | |
| CN107868127A (en) | A kind of monoclonal antibody for being used to detect Oncoprotein Expression in histopathologic slide | |
| KR102029394B1 (en) | Monoclonal antibody for diagnosis of chikungunya virus infection, hybribodma producing the monoclonal antibody, and diagnosis method using the same | |
| CN103483446B (en) | The wide spectrum neutralizing monoclonal antibody of anti-HPV L2 albumen or its Fab and their purposes | |
| CN107556379A (en) | Identify monoclonal antibody and its application of high-risk HPV E7 albumen | |
| KR20070103547A (en) | Monoclonal antibody against nucleocapsid protein of sars coronavirus and the use thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |