CN105916990B - Adeno-associated virus vector for transduction of adipose tissue - Google Patents

Abstract

The present invention relates to adeno-associated viral vectors for transduction of adipose tissue. The invention also relates to polynucleotides, plasmids, vectors and methods for producing such adeno-associated viral vectors. The invention also relates to methods for the treatment of diseases where modulation of gene expression levels is desired.

Description

Adeno-associated virus vector for transduction of adipose tissue

Technical Field

The present invention relates to adeno-associated virus (AAV) vectors for transduction of adipose tissue. The vector can transduce white or brown adipose tissue in a tissue-specific manner.

Background

Adipose tissue, in addition to its known role as a fat depot and regulator of energy balance, has recently been considered to be a major metabolic and endocrine organ. It has been suggested that impaired White Adipose Tissue (WAT) function, as well as reduced Brown Adipose Tissue (BAT) activity or BAT mass, are major factors in the development of obesity. In this regard, human adipocytes and WAT dysfunction have been described. In addition, an inverse correlation between BAT activity and Body Mass Index (BMI) was reported. See Yee J et al, Lipids Health Dis.2012, 11:19-30, Ichimura A et al, Nature 2012; 483: 350-; 118(3) 112-; 1509-; 360:1500-1508.

The onset of obesity has increased significantly over the past decades to reach epidemic proportions. It is estimated that more than 5 billion people are obese. Obesity is today a major public health problem. See IASO, "Global Presence of Adult Obetivity, Report IOTF 2008" (IASO, London, GB, 2009). Obesity itself increases the risk of death and is strongly associated with insulin resistance and type 2 diabetes for a long time. See Peeters a et al, ann.lntern.med.2003; 138:24-32 and Moller D et al, N.Engl.J.Med.1991; 325:938-948. Furthermore, adipocyte dysfunction and obesity are also significant risk factors for certain types of cancer and many other serious diseases, such as heart disease, immune dysfunction, hypertension, arthritis, and neurodegenerative diseases. See Roberts D et al, annu.rev.med.2010; 61:301-316, Spiegelman B et al, J.biol.chem.1993; 268(10) 6823-6826 and Whitmer R et al, curr. Alzheimer Res.2007; 4(2):117-122.

Diet and exercise are the primary treatment for obesity, but an increasing number of patients also require pharmacotherapeutic intervention to reduce and maintain body weight. However, drug treatment does not induce involuntary or significant weight loss, and in addition, anti-obesity drugs often exhibit serious side effects due to their systemic effects. Therefore, there is an urgent need for new and safe approaches to the prevention and to combat the current obesity epidemic. In this regard, elucidating the pathological events underlying obesity is crucial for the development of new anti-obesity therapies. Gene transfer of candidate genes to white and brown adipose tissues in vivo may offer great potential to understand the molecular mechanisms underlying the onset and onset of obesity. Furthermore, gene therapy approaches targeting adipocytes can open opportunities for future treatment of obesity and its related disorders while minimizing systemic reactions. However, the efficient and specific genes transferred to white and brown adipose tissue have so far remained difficult to identify.

Recently, AAV of serotype 1(AAV 1) was shown to have WAT in its mildly infected mice when combined with a non-ionic surfactant or tripterine. See Mizukami H et al, hum. Gene ther.2006; 17:921-928, Zhang F, etc., Gene ther.2011; 18:128-134. Other AAV serotypes, such as AAV6, AAV7, AAV8, or AAV9, have been reported to be highly infectious, but their efficiency of fat transduction is unclear. See Gao G et al, proc.natl.acad.sci.usa 2002; 99:11854-11859, Nakai H, et al, J.Virol.2005; 79: 214-; 99: e3-e9, Broekman M, etc., Neuroscience 2006; 138: 501-; 55:875-884, Taymans J, et al, hum. Gene ther.2007; 195, 206, Bish L, etc., hum. Gene ther.2008; 19: 1359-; 10:375-382. Thus, there is a need in the art to develop vectors that specifically transduce adipose tissue, and, in addition, specific types of adipocytes.

Disclosure of Invention

The present invention relates to adeno-associated viral vectors (AAV) that transfer polynucleotides of interest to specific types of adipocytes and allow their expression. The use of the adipose tissue-specific regulatory elements of the present invention limits the expression of the polynucleotide of interest in white adipose tissue or brown adipose tissue. Furthermore, the vectors of the present invention have proven useful for the treatment of adipose tissue-related diseases, such as, for example, type 2 diabetes. Inventive aspects of the invention are disclosed in the claims.

Preservation of microorganisms

The plasmids pAAV-mini/aP2-null and pAAV-mini/UCP1-null were deposited at 6, 8 of 2012 with the accession numbers DSM 26057 and DSM 26058, respectively, in DSMZ (Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH), Inhoffenstra β e 7B, D-38124 Braunschweig, Federal republic of Italy.

Drawings

FIG. 1 transduction of white adipocytes by internal administration of AAV eWAT. Immunostaining for green fluorescent protein (GFP, green) in sections of eWAT treated with AAV-CAG-GFP of serotypes 1,2, 4 and 5(a) with or without pluronic F88(Pluronics F88) and sections of eWAT treated with AAV-CAG-GFP of serotypes 6, 7, 8 and 9 (B). Blue, nuclear. Arrows indicate transduced adipocytes. Initial magnification 100 (B, left panel) and 200 (A; B, right panel). C. GFP content in ewats treated with AAV-CAG-GFP of serotypes 1,6, 7, 8, or 9 (n-5 per group). Values shown are mean ± SEM. RLU, relative light unit (relative light unit). D. All X-gal staining of eWAT received AAV 8-CMV-LacZ. The X-gal staining was distributed throughout the transduced eWAT. In contrast, no X-gal staining was detected in eWAT from animals treated with physiological saline solution. E. Relative mhkhi expression levels in isolated cells obtained from eWAT of animals treated with AAV 9-CMV-mhkhiii or AAV0-CMV-null vectors. F. Derived from plants derived from the plants using AAV9-CMV-null and AAV-CMV-mHKIIBasal and insulin-stimulated 2[1-³H]deoxy-D-glucose. Adipocytes were obtained from at least 5 mice/group. G. At 2X 10¹¹Immunostaining for GFP (brown) in Inguinal White Adipose Tissue (iWAT) fractions after two weeks internal administration of either AAV8 for vg or iWAT for AAV9-CAG-GFP vector. Initial magnification x 100. H: injection 2X 10¹¹GFP expression levels in iWAT two weeks after vg AAV8 or AAV9-CAG-GFP (n ═ 6). Values shown are mean ± SEM. P<0.05、**p<0.01 and x p<0.001; relative to AAV9-CMV-null # p at the same insulin concentration<0.05. All analyses were at 2X 10¹¹Two weeks after the eWAT internal administration of vg/eWAT.

FIG. 2 specific transduction of white adipocytes following internal eWAT administration of AAV through the mini/aP2 regulatory region. A. At reception 10¹²Immunochromatosis against GFP (brown) in AAV8 for vg/eWAT and in eWAT for AAV9-mini/aP2-GFP vector. The analysis was performed two weeks after injection. Initial magnification x 400. B. Circulating hSeAP levels. Will be 4X 10¹²AAV9-mini/aP2-hsea vector at a dose of vg/mouse was injected bilaterally into eWAT and circulating hsea levels were measured at several time points post-injection. RLU, relative light units. Values shown are mean ± SEM. n-3 (saline) and n-4 (AAV9-mini/aP 2-SeAP). C.4X 10¹²Relative hSeAP expression levels in liver and eWAT one year after internal administration of vg/murine AAV9-mini/aP2-hSeAP in eWAT. D. Internal administration (1.4X 10) of EWAT of AAV9-mini/aP2-null and AAV9-mini/aP2-mHKII vectors¹²vg/mouse) two weeks later, 2- [1-³H]deoxy-D-glucose uptake. Values shown are mean ± SEM. n-7 mice per group. P<0.05。

FIG. 3 transduction of brown adipocytes by internal administration of iBAT of AAV. A. In use at 2X 10⁹vgs/murine portions of AAV8 or AAV9-CAG-GFP treated iBAT, immunostaining against GFP (brown). Initial magnifications x 200 and x 400 (small panels). B. Receiving 2 x 10⁹Relative GFP expression levels in iBAT of vg/murine AAV8 or AAV 9-CAG-GFP. The values shown areMean. + -. SEM. n-5 mice per group. P<0.05. C. Receiving 2 x 10¹⁰vg/mouse AAV 4or AAV8-CMV-RFP or 2X 10¹⁰vg/relative Red Fluorescent Protein (RFP) expression level in iBAT of murine AAV1, AAV2, AAV5, AAV6, AAV7, AAV8, or AAV 9-CMV-RFP. Transduction patterns were similar to eWAT. See fig. 1.AAV 6, AAV7, AAV8, and AAV9 are the most efficient serotypes for transducing iBAT. D. In use 10¹¹vgs/murine AAV9-CMV-RFP treated iBAT fractions were immunostained against RFP (brown). Initial magnifications x 200 and x 400 (small panels). The analysis was performed two weeks after AAV administration.

FIG. 4 specific transduction of brown adipocytes following internal administration of iBAT of AAV via the mini/UCP1 regulatory region. A. By injection 2X 10¹¹Transduction of brown adipocytes was assessed two weeks after vg/murine AAV8 or AAV9-mini/UCP1-GFP vector against immunostaining for GFP (brown). Initial magnifications x 200 and x 400 (small panels). B. AAV8-mini/UCP1-null and AAV8-mini/UCP1-mHKII vector (7X 10) were administered¹⁰vg/mouse) two weeks later, in vivo 2- [1-³H]deoxy-D-glucose. n-6 (AAV8-mini/UCP1-mHKII) and n-10 (AAV8-mini/UCP1-null) mice per group. Delivery of 2X 10C-E¹¹vg/murine AAV9-mini/UCP1-mVEGF₁₆₄Or two weeks after AAV9-mini/UCP1-null vector, relative mVEGF in iBAT₁₆₄(C) Total mvegf (d), and mPECAM1(E) expression levels. n-5 mice per group. F. Injection 2X 10¹¹vg/murine AAV9-mini/UCP1-mVEGF₁₆₄Or AAV9-mini/UCP1-null vectors two weeks after immunostaining for α -SMA (brown) in iBAT initial magnification 400 values shown are mean + SEM<0.05. Red arrows indicate capillary structures.

Figure 5 transduction of white and brown adipocytes systemically delivered to lean mice by AAV vectors. Immunostaining for GFP (green) in ewat fractions. Blue, nuclear. Initial magnification × 100 (left picture) and × 200 (right picture). Relative GFP expression levels in ewat. GFP content in ewat. Immunostaining against GFP (brown) in ibat fraction. Initial magnifications x 200 and x 400 (small panels). Phases in E.IBATFor GFP expression levels. GFP content in ibat. Relative GFP expression levels in groin (iWAT), retroperitoneum (rWAT), mesentery (mWAT), eWAT and iBAT following intravenous (iv) administration of vector to ICR mice (G) and C57Bl6 mice (H) (ICR: 3 for AAV8n and 5 for AAV9 n; C57Bl 6: n-4). All analyses were at 5X 10¹²vg/mouse AAV8 or AAV9-CAG-GFP vector two weeks after tail vein administration. AU, arbitrary unit. RLU, relative light units.

FIG. 6 specific transduction of Brown adipocytes by systemic administration of AAV to the mini/UCP1 regulatory region. A. Immunostaining against GFP (brown) in iBAT that received AAV8 or AAV9-mini/UCP1-GFP vectors. Initial magnifications x 200 and x 400 (small panels). B-C. two months after injection with 2X 10¹²AAV9-mini/UCP1-mVEGF of vg mouse₁₆₄Or relative mVEGF in AAV9-mini/UCP 1-null-treated iBAT₁₆₄(B) And total mvegf (c) expression levels. Administration of 8X 10 in vein¹²vg AAV9-mini/UCP1-VEGF₁₆₄Or AAV9-mini/UCP1-null (n-5) one month later, VEGF164(B) and PECAM1(C) expression levels in iBAT F-g, immunostaining for CD105 (brown) (D) and α -SMA (brown) (E) in the same group as B-C red arrows indicate vessels x 400 and x 1000 (panel) initial magnifications n-5 mice per group p<0.05。

FIG. 7 transduction of adipocytes expressed by mini/aP2 regulatory region and fat-restricted transgene following systemic administration of AAV. A. Transduction of brown adipocytes was assessed by immunostaining against GFP (brown) in the iBAT fraction from animals receiving AAV8 or AAV9-mini/aP2-GFP vector. Initial magnifications x 200 and x 400 (small panels). B-c transduction of non-adipose tissue was assessed by immunostaining against GFP (brown) two weeks after injection. GFP expression was minimal in the liver of animals treated with AAV8 or AAV9-mini/aP2-GFP (b) and AAV8 or AAV9-mini/UCP1-GFP (c) and was absent from the heart. Initial magnifications × 100 and × 400 (small panels). All analyses were at 2X 10¹²Systemic injections of vg/mouse were performed two weeks after.

FIG. 8. eWAT internal administration of AAVThereafter, off-target (off-target) transgenes are expressed. A. Immunostaining against GFP (brown) in iBAT from animals receiving AAV 9-CAG-GFP. Initial magnifications x 200 and x 400 (small panels). B. Relative GFP expression levels in iBAT and eWAT from animals treated with AAV 9-CAG-GFP. Values shown are mean ± SEM. n-5 mice per group. P<0.05. C. Transduction of non-animal adipose organs was assessed by immunostaining against GFP (green). GFP expression was evident in the heart and liver from animals injected with AAV7, AAV8, or AAV 9. Initial magnification x 100. In AAV-CAG-GFP vector (4X 10)¹¹vg mice) was given two weeks internally for analysis.

FIG. 9 AAV-mediated transgene expression restricted by adipose tissue of the mini/aP2 regulatory region. At 10¹²After two weeks of local eWAT internal administration of vg AAV8 and AAV9-mini/aP2-GFP vector, no GFP expression was detected in liver and heart by immunostaining for GFP. Initial magnification x 100.

FIG. 10 transduction of non-animal adipose organs by internal administration of iBAT of AAV vectors. Transduction of non-adipose organs was assessed after two weeks of injection by immunostaining against GFP (brown). In the application of 2X 10⁹The expression of GFP was evident in the heart and liver of animals injected internally with vg/mouse AAV8 and AAV9-CAG-GFP vector iBAT. Initial magnification x 200.

FIG. 11 transduction of brown adipocytes with transgene expression via mini/aP2 regulatory region and fat restriction following internal administration of iBAT of AAV. A.2X 10¹¹Transduction of brown adipocytes was assessed two weeks after internal delivery of vbat of vg/murine AAV9-mini/aP2-GFP vector by immunostaining (brown) against GFP. Initial magnifications x 200 and x 400 (small panels). B. AAV8 or AAV9-mini/UCP1-GFP vector (2X 10)¹¹vg/mouse) transduction of non-adipose organs was assessed by immunostaining against GFP (brown) two weeks after local injection of iBAT. GFP expression in liver was less. Initial magnifications × 100 and × 400 (small panels).

Figure 12. broad transgene expression following caudal vein delivery of AAV. By tail vein injection of 5X 10¹²vg/mouseTwo weeks after AAV9-CAG-GFP vector (g) immunostaining for GFP (green) showed transduction of liver, heart, skeletal muscle, testis, and kidney. Blue, nuclear. Initial magnification x 200.

FIG. 13 transduction of WAT and BAT following systemic administration of AAV vectors to obese-diabetic mice. A-B. A-B, 3X 10¹²Immunostaining against GFP (brown) in epididymal white adipose tissue (eWAT), Inguinal White Adipose Tissue (iWAT) and Interscapular Brown Adipose Tissue (iBAT) fractions after intravenous administration of vg AAV8 or AAV9-CAG-GFP vector to ob/ob (a) and db/db mice (B). Initial magnification x 200. (ob/ob: n-4; db/db: n-4). GFP expression in the groin (iWAT), retroperitoneal (rWAT), mesenteric (mWAT), eWAT and iBAT pools from the same group of ob/ob (C) and db/db mice (D). AU, arbitrary unit. All analyses were performed two weeks after vector delivery. Values shown are mean ± SEM. Relative to AAV9<0.05。

FIG. 14 de-targeting of efficient adipocyte transduction and transgene expression in liver and heart with mirT sequences. Intravenous injection 10¹²vg AAV9-CAG-GFP, AAV9-CAG-GFP-miRT122, AAV9-CAG-GFP-miRT1 or AAV 9-CAG-GFP-double miRT vectors epididymal white adipose tissue (eWAT), Inguinal White Adipose Tissue (iWAT), Interscapular Brown Adipose Tissue (iBAT), GFP immunostaining in liver and heart after two weeks. Initial magnifications × 100 (liver and heart), × 200(eWAT and iWAT), and × 400(iBAT and panels).

Detailed Description

The invention discloses adeno-associated virus vectors based on AAV6, AAV7, AAV8 and AAV9 serotypes, which are capable of efficiently mediating gene transfer to WAT or BAT when locally administered. See fig. 1B and 1C and fig. 3A-3D. Systemic administration of these vectors also resulted in efficient gene delivery into both WAT and BAT. See fig. 5A and 5D. Although gene delivery mediated by AAV8 and AAV9 vectors is highly efficient, it is not restricted to adipose tissue. The combination of AAV8 and AAV9 vectors with adipose tissue-specific promoter regions to provide for specific expression of a polynucleotide of interest in adipose tissue is disclosed. In particular, local administration of AAV8 or AAV9 comprises an expression cassette in which a heterologous gene (e.g., GFP) under the control of the mini/aP2 regulatory region results in its expression in WAT but not in liver or heart. See fig. 2A and 9. Furthermore, local administration of AAV8 or AAV9 comprises an expression cassette, wherein a heterologous gene (e.g. GFP) under the control of the mini/UCP1 regulatory region results in its expression in BAT without expression in the heart and with only minor liver expression. See fig. 4A and 11B. Thus, local administration of the combination formed by the vector and promoter of the present invention provides a safe mechanism for in vivo adipocyte-based transduction for the treatment of various diseases.

Furthermore, systemic administration of the combination of the invention constitutes an alternative route for transduction of adipocytes. In this regard, the present invention discloses that systemic administration of a combination of AAV8 or AAV9-mini/UCP1 and AAV9 or AAV9-mini/aP2 is highly effective for transducing BAT and WAT, respectively. See fig. 6A and 7A. Regardless of which two regulatory regions are used, systemic administration of the combination of the invention results in highly restricted expression of the polynucleotide of interest in adipose tissue, with no expression in the heart and only minor expression in the liver. See fig. 7B and 7C.

1. Definitions of general terms and expressions

The terms "adeno-associated virus", "AAV virion", and "AAV particle", as used interchangeably herein, refer to a virion composed of at least one AAV capsid protein (preferably all capsid proteins of a particular AAV serotype) and an encapsidated polynucleotide AAV genome. If the particle comprises a heterologous polynucleotide flanked by AAV inverted terminal repeats (i.e., a polynucleotide that is not a wild-type AAV genome, e.g., a transgene is delivered to a mammalian cell), it is often referred to as an "AAV vector particle" or "AAV vector". AAV refers to a virus belonging to the genus dependovirus parvoviridae. The AAV genome is approximately 4.7 kilobases long and consists of single-stranded deoxyribonucleic acid (ssDNA), which can be in either the positive or negative orientation. The genome comprises Inverted Terminal Repeats (ITRs), and two Open Reading Frames (ORFs), at both ends of the DNA strand: rep and cap. The Rep framework is formed by four overlapping genes encoding the Rep proteins required for the AAV life cycle. The cap framework contains overlapping nucleotide sequences of the capsid proteins: VP1, VP2, and VP3, which interact together to form an icosahedral symmetric capsid. See Carter B, Adeno-assisted viruses and ado-assisted viruses vectors for genetic drive, Lassic D, et al, eds., "Gene Therapy:therapeuticmechanisms and Strategies" (Marcel Dekker, Inc., New York, NY, US, 2000) and Gao G, et al, J.Virol.2004; 78(12):6381-6388.

The term "adeno-associated virus ITR" or "AAV ITR" as used herein refers to inverted terminal repeats present at both ends of the DNA strand of the genome of an adeno-associated virus. The ITR sequences are required for efficient proliferation of the AAV genome. Another characteristic of these sequences is their ability to form hairpins. This property contributes to its own priming, which allows synthesis of the second DNA strand independent of the priming enzyme. It has also been shown that ITRs are essential for integration and rescue of wild-type AAV DNA into the host cell genome (i.e., chromosome 19 of humans) and for efficient encapsidation of AAV DNA that binds to the resulting fully assembled, dnase-resistant AAV particles.

The term "AAV 2" as used herein refers to a serotype of adeno-associated virus having a genomic sequence as defined in GenBank accession No. NC 001401.

The term "AAV vector" as used herein further refers to a vector comprising one or more polynucleotides of interest (or transgenes) flanked by AAV terminal repeats (ITRs). Such AAV vectors can be replicated and packaged as infectious viral particles when present in a host cell that has been transfected with a vector that can encode and express Rep and Cap gene products (i.e., AAV Rep and Cap proteins), and wherein the host cell has been transfected with a vector that encodes and expresses proteins from adenovirus open reading frame E4orf 6. When an AAV vector is incorporated into a larger polynucleotide (e.g., a chromosome or another vector, such as a plasmid for cloning or transfection), then the AAV vector is typically referred to as a "protein-vector". This protein-vector can be "rescued" by replication and encapsidation in the presence of AAV packaging functions and the necessary helper functions provided by E4orf 6.

The term "adipose tissue" as used herein refers to a tissue consisting of mature adipocytes (i.e., fat cells) and a combination of small blood vessels, neural tissue, lymph nodes, and Stromal Vascular Fraction (SVF). SVF is composed of endothelial cells, fibroblasts, adipocyte precursor cells (i.e., preadipocytes) and immune cells such as macrophages and T cells. In mammals, two different types of adipose tissue are generally distinguished: white Adipose Tissue (WAT) and Brown Adipose Tissue (BAT). Adipose tissue primarily functions to store energy in the form of fat, produce heat through non-shivering heat production, and secrete fat factors.

The term "adipose tissue cells" or "adipocytes" as used herein refers to cell types that comprise adipose tissue and are specialized to store energy as fat, or to produce heat by non-brisk thermogenesis, and to secrete adipokines. Adipose tissue cells include white adipocytes and brown adipocytes.

The term "adipose tissue-specific transcriptional regulatory region" as used herein refers to a nucleic acid sequence that functions as a promoter (i.e., regulates the expression of a selected nucleic acid sequence operably linked to a promoter) and that affects the expression of the selected nucleic acid sequence in a particular tissue cell, such as an adipose cell. The adipose tissue-specific transcriptional regulatory region may be constitutive or inducible.

The term "alkaline phosphatase" or "AP" as used herein refers to an enzyme that catalyzes the hydrolysis of phosphate groups from many types of molecules, including nucleotides, proteins, and alkaloids (EC 3.1.3.1).

The term "angiogenesis" as used herein refers to the process of forming new blood vessels from other pre-existing blood vessels, and includes angiogenesis (vasculogenesis) and arteriogenesis (arteriogenesis).

The term "arteriogenesis" as used herein refers to the formation, growth or development of blood vessels with smooth muscle media layers.

The term "brown adipose tissue cells" or "brown adipocytes" as used herein refers to a type of polygonal shaped adipocytes and are characterized by the accumulation of lipids as a plurality of smaller "multilumen" droplets, and their large number of large mitochondria with a stack of lamellar ridges within the cytoplasm. Unlike white adipocytes, these cells have considerable cytoplasm. The nucleus is circular and, although it is located off-center, is not in the periphery of the cell. The abundant vascularity of the numerous mitochondria and brown adipose depots of brown adipocytes is the main reason BAT is the brown color. Brown adipocytes are located in the typical BAT reservoir and are responsible for the production of heat by non-shivering heat. See enerbb S, n.engl.j.med.2009; 360:2021-2023.

The term "CAG regulatory region" as used herein refers to the combination formed by the early enhancer element of cytomegalovirus and the chicken β -actin promoter see Alexopoulu A et al, BMC Cell Biology 2008; 9(2): 1-11.

The term "Cap gene" or "AAV Cap gene" as used herein refers to a gene encoding a Cap protein. The term "Cap protein" as used herein refers to a polypeptide having the functional activity of at least one native AAV Cap protein (e.g., VP1, VP2, VP 3). Examples of functional activities of Cap proteins (e.g., VP1, VP2, VP3) include the ability to induce capsid formation, promote accumulation of single-stranded DNA, promote AAV DNA packaging into the capsid (i.e., encapsidation), bind to cellular receptors, and promote entry of virions into the host.

The term "capsid" as used herein refers to the structure in which the viral genome is packaged. The capsid is composed of a variety of oligomeric building subunits formed by proteins. For example, AAV has a capsid that is encoded by three capsid proteins: the icosahedral capsid formed by the interaction of VP1, VP2 and VP 3.

The term "cellular component" as used herein refers to a composite of materials comprising the adipocytes of the present invention and at least one other component. The ingredients may be formulated as a single preparation or may be presented as separate preparations of the individual components which may be combined in a combined preparation for combined use. The composition may be a kit-of-parts (kit-of-parts) in which each component is formulated and packaged separately.

The term "constitutive promoter" as used herein refers to a promoter whose activity is maintained at a relatively constant level in all cells of an organism, or during most of the developmental stage, and is associated with fewer or no cellular environmental conditions.

The term "enhancer" as used herein refers to a DNA sequence element into which a transcription factor binds to increase transcription of a gene.

The term "expression cassette" as used herein refers to a nucleic acid construct generated recombinantly or synthetically with a series of specialized nucleic acid elements that permit transcription of a particular nucleic acid in a target cell.

The term "gene providing helper function" as used herein refers to a gene encoding a polypeptide that performs a function upon which AAV relies for replication (i.e., a "helper function"). Helper functions include those functions necessary for AAV replication, including, but not limited to, those involving activation of AAV gene transcription, stage-specific AAV mRNA splicing, AAV DNA replication, synthesis of cap expression products, and AAV capsid assembly of those parts. The virus-based accessory functions may be derived from any known helper virus, such as adenovirus, herpes virus (rather than herpes simplex virus type 1), and vaccinia virus. Helper functions include, but are not limited to, adenovirus El, E2a, VA and E4or herpes virus UL5, UL8, UL52 and UL29 and herpes virus polymerase.

The term "hexokinase" or "HK" as used herein refers to an enzyme that catalyzes the phosphorylation of hexoses to form hexose phosphates. In most organisms, glucose is the main substrate for HK, and glucose-6-phosphate is the most important product.

The term "high blood pressure" or "arterial pressure" as used herein refers to a medical condition in which the blood pressure of an artery is elevated. Blood pressure includes two measurements, systolic and diastolic, depending on whether the myocardium contracts between beats (systole) or relaxes (diastole). The normal blood pressure at rest is in the range of 100-. If it persists at or above 140/90mmHg, then hypertension is said to be present. Hypertension (Hypertension) is classified into primary (idiopathic) Hypertension and secondary Hypertension; approximately 90-95% of cases are classified as "essential hypertension", which refers to hypertension without a significant underlying medical cause. The remaining 5-10% of cases (i.e., secondary hypertension) are caused by other conditions affecting the kidneys, arteries, heart or endocrine system. Insulin resistance, which is common in obesity, is also thought to contribute to hypertension. Hypertension is a major risk factor for stroke, myocardial infarction (i.e., heart attack), heart failure, aneurysms of the arteries (e.g., aortic aneurysm), peripheral arterial disease, and is the cause of chronic kidney disease. Even moderate increases in arterial blood pressure are associated with a shortened life expectancy.

The term "hyperglycemia" as used herein refers to a state in which abnormally high blood glucose levels occur, as compared to a fasting baseline level. In particular, hyperglycemia is understood to occur when fasting blood glucose levels are consistently above 126mg/dL, postprandial glucose levels are above 140mg/dL, or glucose levels in venous plasma exceed 200mg/dL after 2 hours of administration of a dose of 1.75 grams of glucose per kilogram of body weight.

The term "insulin resistance" as used herein refers to a disorder in which cells respond incorrectly to insulin. As a result, the body produces more insulin in response to high blood glucose levels. Patients with insulin resistance often exhibit high glucose levels and high circulating insulin levels. Insulin resistance is often associated with obesity, hypertension and hyperlipidemia. Furthermore, insulin resistance often occurs in patients with type 2 diabetes.

The term "topical administration" as used herein refers to the administration of a polynucleotide, vector, polypeptide, or pharmaceutical composition of the invention to a subject at or near a particular site.

The term "obesity" as used in the present invention refers to a determination provided by the WHO based on the Body Mass Index (BMI) which is the ratio between the weight of an individual (in kg) and the square of their height in metersAnd (5) defining. According to this standard, less than 18.5kg/m²The BMI of (A) is considered to be insufficient weight or lean, 18.5-24.9kg/m²The BMI of (B) is considered to be the normal weight of 25.0-29.9kg/m²BMI of (B) is considered as being overweight class 1, 30.0-39.0kg/m²Is considered overweight class 2 and is greater than or equal to 40.0kg/m²The BMI of (a) is considered morbid obesity. Alternatively, there are other methods for defining the degree of obesity in a subject, such as waist diameter (in cm) measured at the midpoint between the lower rib edge and the upper pelvic edge, thickness of skin folds, bio-impedance, which is based on the principle that lean tissue (lean mass) transmits current better than adipose tissue (fat mass).

The term "operably linked" as used herein refers to the functional relationship and position of a promoter sequence relative to a polynucleotide of interest (e.g., a promoter or enhancer is operably linked to a coding sequence if it affects the transcription of that sequence). Typically, an operably linked promoter is contiguous with the sequence of interest. However, enhancers need not be contiguous with the sequence of interest to control its expression.

The terms "pharmaceutically acceptable carrier", "pharmaceutically acceptable diluent", "pharmaceutically acceptable excipient", or "pharmaceutically acceptable vehicle" (vehicle), used interchangeably herein, refer to a non-toxic solid, semi-solid, or liquid filler, diluent, encapsulating material, or formulation adjuvant of all conventional types. Pharmaceutically acceptable carriers are substantially non-toxic to recipients at the dosages and concentrations employed, and are compatible with other ingredients of the formulation. The number and nature of the pharmaceutically acceptable carriers depends on the desired form of administration. Pharmaceutically acceptable carriers are known and can be prepared by methods known in the art. See faucii Trillo C, "Tratado defacia galvenica" (ed.luz a n 5, s.a., Madrid, ES,1993) and Gennaro a, ed., "Remington: the Science and Practice of Pharmacy "version 20 (Lippincott Williams & Wilkins, Philadelphia, PA, US, 2003).

The term "promoter" as used herein refers to a nucleic acid fragment located upstream of a polynucleotide sequence that functions to control transcription of one or more polynucleotides and is structurally recognized by the presence of binding sites for: a binding site for a DNA-dependent RNA polymerase, a transcription initiation site, and any other DNA sequences including, but not limited to, transcription factor binding sites, repressor and activator protein binding sites, and any other sequence of nucleotides known in the art to act directly or indirectly to regulate the amount of transcription from a promoter. By "tissue-specific" promoter is meant a promoter that is active only in a particular type of differentiated cell or tissue.

The term "polynucleotide" as used herein refers to a nucleic acid molecule, DNA or RNA, containing deoxyribonucleotides or ribonucleotides. The nucleic acid may be double-stranded, single-stranded, or contain portions of both double-stranded or single-stranded sequences. The term "polynucleotide" includes, but is not limited to, nucleic acid sequences having the ability to encode polypeptides and nucleic acid sequences that are partially or fully complementary to endogenous polynucleotides of the cell or subject treated therein, following transcription thereof, which results in RNA molecules (e.g., micrornas, shrnas, sirnas) capable of hybridizing and inhibiting expression of the endogenous polynucleotides.

The term "post-transcriptional regulatory region" as used herein refers to any polynucleotide that facilitates the expression, stabilization, or localization of sequences contained in an expression cassette or the resulting gene product.

The terms "preventing", "preventing" and "prevention" as used herein refer to inhibiting the onset or reducing the incidence of a disease in a subject. Prevention may be complete (e.g., complete absence of pathological cells in the subject) or partial. Prevention also refers to reducing susceptibility to a clinical state.

The term "recombinant viral genome" as used herein refers to an AAV genome in which at least one exogenous expression cassette polynucleotide is inserted into a naturally occurring AAV genome.

The term "Rep gene" or "AAV Rep gene" as used herein refers to a gene encoding a Rep protein. The term "Rep protein" as used herein refers to a polypeptide having the functional activity of at least one native AAV Rep protein (e.g., Rep 40, 52, 68, 78). The "functional activity" of a Rep protein (e.g., Rep 40, 52, 68, 78) is any activity associated with the physiological function of the protein, including through the recognition of AAV origins which promote DNA replication, ligation and nicking (nicking) DNA replication, and DNA helicase activity. Additional functions include regulating transcription from AAV (or other heterologous) promoters and site-specific integration of AAV DNA into the host chromosome.

The term "subject" as used herein refers to an individual, plant, or animal, such as a human, a non-human primate (e.g., chimpanzees and other apes and monkey species), a farm animal (e.g., avian, fish, bovine, ovine, porcine, caprine, and equine), or an experimental animal (e.g., a rodent, such as a mouse (rat), and guinea pig). The term does not denote a particular age or gender. The term "subject" encompasses embryos and fetuses.

The terms "systemically administered" and "systemically administered" as used herein refer to the administration of a polynucleotide, vector, polypeptide, or pharmaceutical composition of the invention to a subject in a non-topical manner. Systemic administration of the polynucleotides, vectors, polypeptides, or pharmaceutical compositions of the invention may reach multiple organs or tissues throughout the body of the subject, or may reach specific organs or tissues of the subject. For example, intravenous administration of a pharmaceutical composition of the invention can result in transduction of more than one tissue or organ in a subject.

The term "transcriptional regulatory region" as used herein refers to a nucleic acid segment capable of regulating the expression of one or more genes. Regulatory regions of the polynucleotides of the invention include promoters and enhancers.

The term "transduction" or "transduction" as used herein refers to a process by which an exogenous nucleotide sequence is introduced into a cell through a viral vector.

The term "transfection" as used herein refers to the introduction of DNA into a recipient eukaryotic cell.

The term "treatment" or "treatment" as used herein refers to the administration of a compound or composition of the invention to control the progression of a disease after its clinical signs have occurred. Controlling disease progression is understood to mean a favorable or desired clinical outcome, which includes, but is not limited to: reduction of symptoms, reduction of the duration of the disease, stabilization of the pathological state (in particular, avoiding additional exacerbations), delay of progression of the disease, improvement of the pathological state and remission (both partial and total). Control of progression of the disease also includes prolonging survival compared to expected survival if no treatment is applied.

The term "type 2 diabetes" as used herein refers to a disease characterized by an inappropriate increase in blood glucose levels the chronic hyperglycemia of diabetes is associated with long-term damage, dysfunction and failure of different organs, leading to various complications such as retinopathy, nephropathy and peripheral neuropathy type 2 diabetes is caused by insulin resistance of peripheral tissues (mainly skeletal muscle, adipose tissue and liver) and an inappropriate compensatory insulin secretory response due to a reduced combination of β -cell mass and function.

The term "angiogenesis" as used herein refers to the formation, growth, development or proliferation of blood vessels derived from undifferentiated or differentiating cells.

The term "vector" as used herein refers to a structure capable of delivering, and optionally expressing, one or more polynucleotides of interest to a host cell. Examples of carriers include, but are not limited to: viral vectors, naked DNA or RNA expression vectors, plasmids, cosmids (cosmids) or phage vectors, DNA or RNA expression vectors associated with cationic condensing agents (condensing agents), DNA or RNA expression vectors encapsulated in liposomes, and certain eukaryotic cells, such as producer cells. The vector may be stable and may replicate itself. There is no limitation with respect to the type of carrier that may be used. The vector may be a cloning vector suitable for propagation and obtainment of polynucleotides, genetic constructs or expression vectors which are combined to various heterologous organisms. Suitable vectors include prokaryotic expression vectorsVectors (e.g., pUC18, pUC19, Bluescript and derivatives thereof), mp18, mp19, pBR322, pMB9, CoIEl, pCRl, RP4, bacteriophages and shuttle vectors (e.g., pSA3 and pAT28), and eukaryotic expression vectors based on viral vectors (e.g., adenovirus, adeno-associated virus, and retrovirus and lentivirus), and non-viral vectors such as pSilencer 4.1-CMV (C.) (II: (R))

Life Technologies Corp., Carslbad, CA, US), pcDNA3, pcDNA3.1/hyg pHCMV/Zeo, pCR3.1, pEFl/His, pIND/GS, pRc/HCMV2, pSV40/Zeo2, pTRACER-HCMV, pUB6/V5-His, pVAXl, pZeoSV2, pCI, pSVL and pKSV-10, pBPV-1, pML2d and pTDTl.

The term "VEGF" as used herein refers to vascular endothelial growth factor. "VEGF" includes but is not limited to VEGF variants A, B, C, D, E and F. See Hamawy a et al, curr. opin. cardio.1999; 14:515-522, Neufeld G et al, prog.growth Factor Res.1994; 89-97, Olofsson B et al, Proc. Natl. Acad. Sci. USA 1996; 93:2576, 2581, Chilov D et al, J.biol.chem.1997; 272:25176-25183 and Olofsson B et al, curr, Opin, Biotechnol.1999; 10:528-535. VEGF variants include, but are not limited to, the isoform VEGF₁₆₄、VEGF₁₂₁、VEGF₁₄₅、VEGF₁₆₇、VEGF₁₆₅、VEGF₁₈₉And VEGF₂₀₆. See Tischer E et al, j.biol.chem.1991; 266:11947-11954 and Poltorak Z et al, J.biol.chem.1997; 272:7151-7158. The term "VEGF" also includes vascular permeability factors or angioopsins (VPFs). See Keck P et al, Science 1989; 246: 1309-; 219:983-985. VPF is currently known in the art as VEGF a. Other members of the VEGF family, including placental growth factors PIGF I and II, may also be used. Suitable VEGF sequences are readily available (e.g., National Center for Biotechnology Information, http:// www.ncbi.nlm.nih.gov/June 2012.) for example, the loci (loci) of members of the human VEGF family include VEGF-A-P15692 and NP003367, VEGF-B-NP003368, P49765, AAL79001, AAL79000. AAC50721, AAB06274, and AAH 08818; VEGF-C-NP005420, P49767, S69207, AAB36425, and CAA 63907; VEGF-D-NP004460, AAH27948, O43915, CAA03942, and BAA 24264; VEGF-E-AAQ 88857; VEGF-F-2 VPFF; PIGF-1-NP002623, AAH07789, AAH07255, AAH01422, P49763, CAA38698 and CAA 70463; the synthetic structure of chain A-1FZVA and chain B-1FZVB of PIGF-1; and PIGF-2-AAB25832 and AAB 30462. Preferably, the VEGF is of human origin. However, VEGF from other species, such as mouse, may also be used according to the present invention.

The term "white adipose tissue phase cells" or "white adipocytes" as used herein refers to types of adipocytes that are polyhedral to spherical and contain large, "single-chambered" lipid droplets surrounded by a thin layer of cytoplasm. The nucleus of the cell is flat and located peripherally. The diameter of white adipocytes varies in a range between 30 and 70 μm depending on the depot site. The stored fat is in a semi-liquid state and consists mainly of triglycerides and cholesterol esters. White adipocytes secrete a variety of peptides and proteins, collectively known as adipokines, such as resistin, adiponectin, and leptin.

The term "woodchuck hepatitis virus post-transcriptional regulatory element" or "WPRE" as used herein refers to a DNA sequence that when transcribed yields a tertiary structure capable of enhancing gene expression. See Lee Y et al, exp. physiol.2005; 90(1) 33-37 and Donello J et al, J.Virol.1998; 72(6):5085-5092.

The term "microRNA" or "miRNA" as used herein is a small (-22-nt), evolutionarily conserved regulatory RNA involved in RNA-mediated gene silencing at the post-transcriptional level. See Bartel dp. cell 2004; 116:281-297. Mirnas can act to inhibit mRNA translation by base pairing with complementary regions, most often in the 3 'untranslated region (3' UTR) of cellular messenger rna (mRNA), or at high sequence homology, cause catalytic depolymerization of mRNA. Due to the highly differentiated tissue expression of many mirnas, cellular mirnas can be employed to mediate tissue-specific localization of gene therapy vectors. Transgene expression in undesirable tissues can be efficiently suppressed by engineered tandem copies of the target element within the viral vector that are fully complementary to the tissue-specific mirna (mirt).

2. Adeno-associated virus vector providing adipose tissue specific expression

In a first aspect, the invention relates to an adeno-associated virus (AAV) vector comprising a recombinant viral genome, wherein the recombinant viral genome comprises an expression cassette comprising an adipose tissue-specific transcriptional regulatory region operably linked to a polynucleotide of interest.

The AAV according to the present invention includes any of the 42 serotypes of known AAV. In general, serotypes of AAV have genomic sequences with significant homology at the amino acid and nucleic acid levels, provide an equivalent set of genetic functions, produce virions that are virtually identical in physical and functional respects, and replicate and assemble by virtually identical mechanisms. In particular, the AAV of the invention may belong to the group of AAV serotype 1(AAV 1), AAV2, AAV3 (including types 3A and 3B), AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, avian AAV, bovine AAV, canine AAV, equine AAV, ovine AAV and any other AAV. Examples of genomic sequences of different AAV serotypes can be found in the literature or in public databases, such as GenBank. See GenBank accession numbers AF028704.1(AAV6), NC006260(AAV7), NC006261(AAV8), and AX753250.1(AAV 9). In a preferred embodiment, the adeno-associated viral vector of the invention is selected from the group of serotypes consisting of AAV6, AAV7, AAV8 and AAV9 serotypes.

The genome of an AAV according to the present invention typically comprises cis-acting 5 'and 3' terminal inverted repeats and an expression cassette. See Tijsser P, Ed., "Handbook of Parvoviruses" (CRC Press, Boca Raton, FL, US, 1990, pp.155-168). The ITR sequences are about 145bp long. Although some minor modification of these sequences is permissible, it is preferred that substantially the entire ITR-encoding sequence be used for the molecule. Methods for modifying these ITR sequences are known in the art. See Brown T, "Gene Cloning" (Chapman & Hall, London, GB, 1995), Watson R et al, "Recombinant DNA", 2 nd edition (Scientific American Books, New York, NY, US, 1992), Alberts B et al, "Molecular Biology of the Cell" (Garland Publishing Inc., New York, NY, US, 2008), Innis M et al, eds., "PCR protocols. A Guide to Applications") Academic Press Inc., SanN.Diego, CA, US, Sa1990), error H, Ed., "PCR technology. principles and Applications for DNA Amplification" (Press, New, Inc., Press, sample, Press, davis L et al, "Basic Methods in molecular biology" (Elsevier Science Publishing Co., New York, NY, US, 1986) and Schleef M, Ed., "Plasmid for Therapy and Vaccination" (Wiley-VCH Verlag GmbH, Weinheim, DE, 2001). In a preferred embodiment, the AAV recombinant genome comprises 5 'and 3' AAV ITRs. In another embodiment, the 5 'and 3' AAV ITRs are derived from AAV 2. In a more preferred embodiment, the AAV recombinant genome lacks a rep open reading frame and a cap open reading frame. In one embodiment, AAV2 ITRs are selected to generate pseudotyped AAV (i.e., AAV having a capsid and ITRs derived from different serotypes).

The polynucleotides of the invention may comprise ITRs derived from any AAV serotype. In a preferred embodiment, the ITRs are derived from AAV2 serotype.

The AAV of the invention comprises a capsid from any serotype. In a particular embodiment, the capsid is derived from an AAV in the group consisting of: AAV1, AAV2, AAV4, AAV5, AAV6, AAV7, AAV8, and AAV 9. In a preferred embodiment, the AAV of the invention comprises a capsid derived from AAV8 or AAV9 serotype. In another preferred embodiment, the VP1 sequence of the AAV capsid has the sequence Listing SEQ ID NO. 18. See GenBank accession No. AY 530579.

In some embodiments, an AAV Cap for use in the methods of the invention can be produced by mutating (i.e., by insertion, deletion, or substitution) one of the AAV caps described above or a nucleic acid encoding therefor. In some embodiments, the AAV Cap is at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% similar to one or more of the AAV caps described above.

In some embodiments, the AAV Cap is chimeric, comprising domains from two, three, four, or more of the foregoing AAV caps. In some embodiments, the AAV Cap is a chimera of VP1, VP2, and VP3 monomers derived from two or three different AAV or recombinant AAV. In some embodiments, the rAAV composition comprises more than one of the foregoing caps.

In some embodiments, AAV caps for use in rAAV compositions are designed to contain heterologous sequences or other modifications. For example, peptide or protein sequences that confer selective localization or immune evasion may be introduced into Cap proteins. Alternatively or additionally, Cap may be chemically modified such that the surface of the rAAV is pegylated (i.e., pegylated), which may facilitate immune evasion. Cap proteins can also be mutagenized (e.g., to remove their native receptor binding, or to mask immunogenic epitopes).

In another specific embodiment, the AAV vector is a pseudotyped AAV vector (i.e., the vector comprises sequences or components derived from at least two different AAV serotypes). In particular embodiments, a pseudotyped AAV vector comprises an AAV genome derived from one AAV serotype (e.g., AAV2), and a capsid derived at least in part from a different AAV serotype. Specific examples of such pseudotyped AAV vectors include, but are not limited to, vectors comprising a genome derived from any AAV serotype (e.g., from AAV1 through AAV11), in a capsid derived from AAV6, AAV7, AAV8, or AAV 9.

In one embodiment, the AAV vector comprises a promoter, wherein at least one target sequence of at least one miRNA is added, which miRNA may be selected from the list of: miR122(miRBase database accession number MI0000442), miR152(MI0000462), miR199(MI0000242), miR215(MI0000291), miR192(MI0000234), miR148a (MI0000253), miR194(MI0000488), miR1(MI0000651), miRT133(MI0000450), miR206(MI0000490), miR208(MI0000251), miR124(MI0000443), miR125(MI0000469), miR216(MI0000292), and miR130(MI 0000448). The reference sequence has been obtained from miRBase (version 31/07/2013, http:// www.mirbase.org /).

In one embodiment the AAV vector comprises a promoter to which is added at least one miRNA target sequence which may be selected from the list of:

list 1

miRT122a(5’CAAACACCATTGTCACACTCCA3’)、

miRT152(5’AGTCACGTACTGTCTTGAACC3’)、

miR199a-5p(5’GGGTCACAAGTCTGATGGACAAG3’)、

miR99a-3p(5’TGTCATCAGACGTGTAACCAAT3’)、

miRT215(5’TACTGGATACTTAACTGTCTG3’)、

miRT192(5’GGCTGTCAATTCATAGGTCAG3’)、

miRT194(5’ACATTGTCGTTGAGGTACACCT3’)、

miRT1(5’TTACATACTTCTTTACATTCCA3’)、

mirT148(5’AGTCACGTGATGTCTTGAAACA3’)、

mirT133a(5’AAACCAGGGGAAGTTGGTCGAC3’)、

miRT206(5’ACCTTACATTCCTTCACACACC3’)、

miRT124(5’ATTCCGTGCGCCACTTACGG3’)、

miRT125(5’AGGGACTCTGGGAAATTGGACACT3’)、

miRT216(5’ATTAGAGTCGACCGTTGACACT3’)、

miRT130(5’GTCACGTTACAATTTTCCCGTA3’)。

In one embodiment the AAV vector contains a promoter to which is added at least one miRNA target sequence having 85% homology to a miRNA target sequence selected from list 1 mentioned above.

In one embodiment the AAV vector contains a promoter to which is added at least one miRNA target sequence having functional equivalence to a miRNA target sequence selected from list 1 mentioned above. In this case, the term functional equivalent refers to any nucleotide sequence capable of binding to the same miRNA, which binds to the original sequence. For example, a functional equivalent of miRT122a is any sequence that hybridizes to the same miRNA that hybridizes to miRT122 a.

Functionally equivalent nucleotide sequences retain the relevant biological activity of the reference mirT sequence. This means that a functional equivalent of mirT has the ability to inhibit transgene expression in undesired tissues in the same way as the reference mirT sequence.

In another particular embodiment, the miRNA target sequence may be selected from mirT122a (5'CAAACACCATTGTCACACTCCA3'), referenced as SEQ ID NO:19 or mirT1(5'TTACATACTTCTTTACATTCCA3'), referenced as SEQ ID NO:20 of the sequence Listing.

The transcriptional regulatory region may comprise a promoter, and optionally an enhancer region. Preferably, the promoter is specific for adipose tissue. Enhancers need not be specific for adipose tissue. Alternatively, the transcriptional regulatory region may comprise an adipose tissue-specific promoter and an adipose tissue-specific enhancer.

In one embodiment, the tissue-specific promoter is an adipocyte-specific promoter, such as an adipocyte protein 2(aP2, also known as fatty acid binding protein 4(FABP4)), PPARy promoter, adiponectin promoter, phosphoenolpyruvate carboxykinase (PEPCK) promoter, derived from the human aromatase cytochrome p450(p450arom), or Foxa-2 promoter. See Graves R et al, Genes Dev.1991; 428-; 87:9590-9594, Simpson E et al, US 5,446,143, Mahondro M et al, J.biol.chem.1993; 268: 19463-; 39: 317-; 76:103-115. In a preferred embodiment, the enhancer region is selected from the group consisting of the fat specific aP2 enhancer and the fat specific UCP1 enhancer.

In a preferred embodiment, the adipose tissue-specific regulatory region of an AAV according to the present invention comprises the adipose-specific aP2 enhancer and aP2 basic promoter (basic aP2 promoter, basal aP2 promoter). See Rival Y et al, J.Pharmacol. exp. ther.2004:311(2): 467-475). This region containing the fat specific aP2 enhancer and the aP2 basic promoter is also referred to as the "mini/aP 2 regulatory region" and is formed by the basic promoter of the aP2 gene and the fat specific enhancer of the aP2 gene. Preferably, the aP2 promoter is murine. See Graves R et al, mol.cell biol.1992; 12(3) 1202-; 87:9590-9594. In a particular embodiment, the mini/aP2 regulatory region has the sequence set forth in SEQ ID NO 2 of the sequence Listing.

In another preferred embodiment, the adipose tissue-specific regulatory region of an AAV according to the present invention comprises the adipose-specific UCP1 enhancer and the UCP1 basic promoter (basic UCP1 promoter, basal UCP1 promoter). See del MarGonz a lez-Barroso M et al, J.biol.chem.2000; 275(41) 31722 and Rim J, J.biol.chem.2002; 277(37):34589-34600. This region comprising the fat-specific UCP1 enhancer and the UCP1 basic promoter is also referred to as the "mini/UCP regulatory region" and refers to the combination of the basic promoter of the UCP1 gene and the fat-specific enhancer of the UCP1 gene. Preferably, the rat UCP1 promoter is used. See Larose M, et al, j.biol.chem.1996; 271(49), 31533, 31542 and Cassard-Doulcier A et al, biochem. J.1998; 333:243-246. In a particular embodiment, the mini/UCP1 regulatory region has the sequence set forth in SEQ ID NO. 3 of the sequence Listing.

In another embodiment, the expression cassette that makes up the portion of the AAV of the present invention further comprises expression control sequences including, but not limited to, appropriate transcription sequences (i.e., initiation, termination, promoter, and enhancer), efficient RNA processing signals (e.g., splicing and polyadenylation (polyA) signals), sequences that stabilize cytoplasmic mRNA, sequences that enhance translation efficiency (i.e., Kozak consensus sequences), sequences that enhance protein stability, and sequences that enhance secretion of the encoded product, when desired. A wide variety of expression control sequences, including native, constitutive, inducible, or tissue-specific promoters, are known in the art and can be utilized in accordance with the present invention.

In another embodiment, the expression cassette comprising a portion of an AAV of the invention further comprises a post-transcriptional regulatory region. In a preferred embodiment, the post-transcriptional regulatory region is the woodchuck hepatitis virus post-transcriptional region (WPRE) or functional variants and fragments thereof, and PPT-CTS or functional variants and fragments thereof. See Zufferey R et al, j.virol.1999; 73:2886-2892 and kappa J et al, WO 2001/044481. In a particular embodiment, the post-transcriptional regulatory region is a WPRE.

The expression cassette constituting part of the AAV according to the invention comprises a "polynucleotide of interest". In a preferred embodiment, the polynucleotide of interest encodes a protein that acts systemically. In another embodiment, the polynucleotide of interest encodes a protein that acts on the adipocytes or regions near them. In a preferred embodiment, the protein acting on the adipocytes or regions near them is a Hexokinase (HK), comprising any four mammalian HK isozymes (EC 2.7.1.1) that differ in subcellular location and kinetics relative to different substrates. For example, HK includes HK1(GenBank accession nos. NP000179, NP277031, NP277032, NP277033, NP277035), HK2(GenBank accession No. NP000180), HK3(GenBank accession No. NP002106), and HK 4or glucokinase (GenBank accession nos. NP000153, NP277042, NP 277043). In another preferred embodiment, HK is glucokinase, which is used interchangeably herein with hexokinase 4or HK4, and refers to the isoform of hexokinase with a Km of glucose 100 times higher than HK1, HK2, or HK 3.

In embodiments, the protein acting on the adipocytes or their vicinity is an Alkaline Phosphatase (AP), including but not limited to intestinal or IAP (GenBank accession NP001622), placental or PLAP (GenBank accession NP001623), and non-tissue specific isozyme or ALPL (GenBank accession NP000469, NP001120973.2, and NP 001170991.1). In another embodiment, the protein that acts on the adipocytes or regions near them is VEGF, including but not limited to VEGF variants A, B, C, D, E and F.

In another embodiment, the polynucleotide of interest encodes a polypeptide that is normally produced and secreted by adipocytes. In another embodiment, the polypeptide produced and secreted by the adipocytes is a protein product of a lipase (e.g., a serine protease homolog lipase), adiponectin, leptin, resistin, or adipocyte gene (ob gene), among others.

Still other useful polynucleotides of interest include those encoding hormones and growth and differentiation factors, including, but not limited to, insulin, glucagon, Growth Hormone (GH), parathyroid hormone (PTH), growth hormone releasing factor (GRF), Follicle Stimulating Hormone (FSH), Luteinizing Hormone (LH), human chorionic gonadotropin (hCG), angiogenin, angiostatin, Granulocyte Colony Stimulating Factor (GCSF), Erythropoietin (EPO), Connective Tissue Growth Factor (CTGF), basic fibroblast growth factor (bFGF), acidic fibroblast growth factor (aFGF), Epidermal Growth Factor (EGF), Platelet Derived Growth Factor (PDGF), insulin growth factors I and II (IGF-I and TGF-II), any of the transforming growth factor superfamilies, including TGFa, activin, and any of the transforming growth factor superfamilies, Inhibin, or any of the Bone Morphogenetic Protein (BMP) BMP 1-15, regulatory protein of growth factor (heregulin)/neuregulin/ARIA/Neu Differentiation Factor (NDF) family, nerve growth factor (nerve growth factor) (NGF), brain-derived neurotrophic factor (BDNF), neurotrophins NT-3 and NT-4/5, ciliary neurotrophic factor (CNTF), glial cell-derived neurotrophic factor (GDNF), nerve growth factor (neurturin), agrin (agrin), any of the semaphorins/crash protein family, neurite-directing factor (netrin) -1 and neurite-directing factor-3, Hepatocyte Growth Factor (HGF), ephrin (ephrin), noggin (noggin), sonic hedgehog (sonic hedgehog), and tyrosine hydroxylase.

Other useful polynucleotides of interest include those encoding proteins that modulate the immune system, including, but not limited to, cytokines and lymphokines, such as Thrombopoietin (TPO), Interleukins (IL) IL-1 through IL-25 (e.g., IL-2, IL-4, IL-12, and IL-18), monocyte chemotactic proteins, leukemia inhibitory factor, granulocyte-macrophage colony stimulating factor, Fas ligand, tumor necrosis factors α and β, interferons α, β, and γ, stem cell factor, flk-2/flt3 ligand.

Other useful polynucleotides of interest include those encoding any of hormones, growth factors, cytokines, lymphokines, regulatory proteins, and receptors for immune system proteins. The present invention encompasses receptors for cholesterol regulation or lipid regulation, including Low Density Lipoprotein (LDL) receptors, High Density Lipoprotein (HDL) receptors, Very Low Density Lipoprotein (VLDL) receptors, and scavenger receptors. The invention also encompasses gene products such as members of the steroid hormone receptor superfamily including glucocorticoid receptors and estrogen receptors, vitamin receptors and other nuclear receptors. In addition, useful gene products include transcription factors such as jun, fos, max, mad, serum effector (SRF), AP1, AP2, myb, MyoD and myogenin, protein-containing ETS-cassette (ETS-box associating protein), TFE3, E2F, ATF1, ATF2, ATF3, ATF4, ZF5, NFAT, CREB, HNF-4, C/EBP, SP1, CCAAT-box binding protein (CCAAT-box protein), interferon regulatory factor (IRF-1), nephroblastoma (Wilms tumor) protein, ETS binding protein, STAT, GATA-cassette binding protein (e.g., GATA-3) and forkhead (forkhead) family of winged helix protein (winged helix protein).

Other useful polynucleotides of interest include those encoding enzymes such as carbamoyl synthetase I, ornithine transcarbamylase, arginosuccinate synthase, arginosuccinate lyase, arginase, fumarylacetoacetate hydrolase, phenylalanine hydroxylase, α -1 antitrypsin, glucose-6-phosphatase, porphobilinogen deaminase, cystathionine (cystathione) β -synthase, branched chain keto acid decarboxylase, albumin, isovaleryl-coa dehydrogenase, propionyl-coa carboxylase, methylmalonyl-coa mutase, glutaryl-coa dehydrogenase, insulin, β -glucosidase, pyruvate carboxylase (pyruvate carboxylate), liver phosphorylase, phosphorylase kinase, glycine decarboxylase, H protein, T protein, cystic fibrosis regulator (CFTR) sequence, and dystrophin (dystrophin, strophin) gene products (e.g., mini-dystrophin or mini-transmembrane dystrophy) gene products, including those useful for treating diseases such as phosphate esters, e.g., glucokinase (e.g., glucuronidase) containing enzymes (glucuronyl-35) for example.

Packaging size limitations of AAV vectors are limited to the size of the parental wild-type AAV genome, which is in a range based on the size of the AAV serotype (i.e., 4087 to 4767). See Wu Z et al, mol. 7(l) 80-86. For example, wild type AAV02 has a genomic size of 4679 and wild type AAV-6 has a genomic size of 4683. In some embodiments, the cloning capacity of the recombinant RNA vector may be limited and the desired coding sequence may involve a complete replacement of the 4.8 kilobase genome of the virus. Thus large genes may not be suitable for standard recombinant AAV vectors in some cases. The skilled person will appreciate that options for overcoming limited coding capacity are available in the art. For example, AAV ITRs of two genomes can be annealed to form a head-to-tail concatemer (concatamer), nearly doubling the capacity of the vector. Insertion of a splice site allows for the removal of ITRs from the transcript. Other options for overcoming the limited cloning capacity will be apparent to the skilled person.

3. Therapeutic methods based on the tropism of AAV6, AAV7, AAV8, and AAV9 for adipose tissue

In a second aspect, the invention discloses adeno-associated viral vectors of AAV6, AAV7, AAV8 and AAV9 serotypes, capable of efficiently transducing adipose tissue cells. This feature makes it possible to develop methods for treating diseases that require or may benefit from expression of a polynucleotide of interest in adipocytes. In particular, this finding facilitates the delivery of a polypeptide of interest to a subject in need thereof by administering an AAV vector of the invention to the patient, thereby generating adipocytes capable of expressing the polynucleotide of interest and encoding the polypeptide in vivo. If the encoded polypeptide is a secreted polypeptide, it may be secreted by adipocytes, so that the polypeptide is delivered systemically in this manner.

Thus, in another embodiment, the invention provides an adeno-associated viral vector comprising a recombinant viral genome, wherein the recombinant viral genome comprises an expression cassette comprising a transcriptional regulatory region operably linked to a polynucleotide of interest, wherein the serotype of the AAV is selected from the group consisting of AAV6, AAV7, AAV8 and AAV9, for use in the treatment or prevention of a disease requiring the expression of the polynucleotide of interest.

In another embodiment, the invention provides an adeno-associated viral vector comprising a recombinant viral genome, wherein the recombinant viral genome comprises an expression cassette comprising an adipose tissue-specific transcriptional regulatory region operably linked to a polynucleotide of interest, for use in the treatment or prevention of a disease requiring the expression of the polynucleotide of interest.

In another embodiment, the invention provides a method for the treatment or prevention of a disease requiring expression of a polynucleotide of interest in a subject, comprising administering to the subject an adeno-associated viral vector comprising a recombinant viral genome, wherein the recombinant viral genome comprises an expression cassette comprising a transcriptional regulatory region operably linked to a polynucleotide of interest, wherein the serotype of AAV is selected from the group consisting of AAV6, AAV7, AAV8 and AAV 9.

In another embodiment, the invention provides a method for the treatment or prevention of a disease requiring expression of a polynucleotide of interest in a subject, comprising administering to the subject an adeno-associated viral vector comprising a recombinant viral genome, wherein the recombinant viral genome comprises an expression cassette comprising an adipose tissue-specific transcriptional regulatory region operably linked to a polynucleotide of interest.

The AAV used in the therapeutic methods of the invention comprises an expression cassette comprising a polynucleotide of interest and a transcriptional regulatory region. The transcriptional regulatory region may comprise a promoter, and optionally an enhancer region.

Examples of constitutive promoters include, but are not limited to, the retroviral Rous Sarcoma Virus (RSV) LTR promoter (optionally with the RSV enhancer), the Cytomegalovirus (CMV) promoter (optionally with the CMV enhancer), the SV40 promoter, the dihydrofolate reductase promoter, the β -actin promoter, the glycerophosphate kinase (PGK) promoter, and the EFla promoter see Boshart M et al, Cell 1985; 41: 521-.

In another embodiment, the transcriptional regulatory region comprises the β -actin promoter β -actin promoter may be derived from any mammal, including humans and rodents, or avian species, including chickens.

In yet another embodiment, the transcriptional regulatory region further comprises an enhancer region. Preferably, the enhancer region is a CMV enhancer region.

In a particular embodiment, the regulatory region is a CAG regulatory region. In a preferred embodiment, the CAG regulatory region has the sequence of SEQ ID NO 1 of the sequence Listing.

In another embodiment, the transcriptional regulatory region is an adipose tissue-specific transcriptional regulatory region.

If the promoter is specific for adipose tissue, the enhancer need not be specific for adipose tissue as well. Alternatively, the transcriptional regulatory region may comprise an adipose tissue-specific promoter and an adipose tissue-specific enhancer.

In one embodiment, the tissue-specific promoter is an adipocyte-specific promoter, such as, for example, adipocyte protein 2(aP2, also known as fatty acid binding protein 4(FABP4)), PPARy promoter, adiponectin promoter, phosphoenolpyruvate carboxykinase (PEPCK) promoter, derived from the human aromatase cytochrome p450(p450arom) and Foxa-2 promoter. See Graves (1991), Ross (1990), Simpson (US 5,446,143), Mahendro (1993), Simpson (1993) and Sasaki (1994) supra.

In one embodiment, the enhancer region is selected from the group consisting of the fat specific aP2 enhancer and the fat specific UCP1 enhancer.

In a preferred embodiment, the adipose tissue-specific regulatory region of an AAV according to the present invention comprises the adipose-specific aP2 enhancer and the murine aP2 basic promoter (basic murine aP2 promoter, basal Murine aP2 promoter). In a particular embodiment, the mini/aP2 regulatory region has the sequence set forth in SEQ ID NO 2 of the sequence Listing.

In another preferred embodiment, the adipose tissue-specific regulatory region of an AAV according to the present invention comprises the adipose-specific UCP1 enhancer and the rat UCP1 basic promoter (basic rat UCP1 promoter, basal rat UCP1 promoter). In a particular embodiment, the mini/UCP1 regulatory region has the sequence set forth in SEQ ID NO. 3 of the sequence Listing.

In another embodiment, the expression cassette further comprises a post-transcriptional regulatory region. In preferred embodiments, the post-transcriptional regulatory region is a WPRE or functional variants and fragments thereof, and a PPT-CTS or functional variants and fragments thereof.

Other suitable polynucleotides of interest may be used with the AAV vectors of the invention and for the treatment or prevention of disease. See table 1.

TABLE 1

Polynucleotides of interest

The term "disease requiring expression of a polynucleotide of interest" as used herein refers to any disease in which expression of a polynucleotide of interest is desired. A polynucleotide of interest as described herein can be a gene encoding a polypeptide of interest, or alternatively, a nucleic acid sequence that, when transcribed, produces a molecule capable of modulating the expression of an endogenous polynucleotide in a cell. Thus, a disease requiring expression of a polynucleotide of interest may be one in which it is desirable to increase or decrease the expression level of a gene.

In addition, the polynucleotide of interest may encode a protein that is secreted and acts systemically, or a protein that acts on adipocytes or their vicinity. In a particular embodiment, the disease requiring expression of a polynucleotide of interest is a disease requiring expression of a polynucleotide of interest in adipose tissue, more preferably, white adipose tissue or brown adipose tissue.

Examples of diseases in which expression of the polynucleotide of interest is desired include, but are not limited to, obesity, hyperglycemia, insulin resistance, type 2 diabetes, hypertension, cancer, heart disease, immunological diseases, arthritis, diseases of the central nervous system, and aging-related diseases.

AAV of the invention has proven useful for gene therapy of adipose tissue-associated diseases, such as hexokinase delivery mediated by AAV of the invention in both WAT and BAT to increase basal glucose uptake. See fig. 2D and 4B. Thus, in a particular embodiment, the disease for which modulation of the expression of the polynucleotide of interest is desired is a disease selected from the group consisting of obesity, hyperglycemia, insulin resistance, type 2 diabetes, and hypertension.

Exemplary disease states related to the genes include, but are not limited to, insulin for treating diabetes, CFTR for treating cystic fibrosis, factor IX for treating hemophilia B (hemophilia B), factor VIII for treating hemophilia A (hemophilia A), glucose-6-phosphatase, associated with glycogen storage disease type 1A, phosphoenolpyruvate-carboxykinase, associated with Pepck deficiency, galactose-1-phosphouridyltransferase, associated with galactosemia, phenylalanine hydroxylase, associated with phenylketonuria, branched chain α -dehydrogenase, associated with maple syrup urine disease, fumarylacetoacetate hydrolase, associated with tyrosine-type 1, methylmalonyl-CoA mutase, associated with methylmalonyl-CoA dehydrogenase, medium chain acyl-CoA dehydrogenase, associated with medium chain acyl-CoA deficiency, ornithine carbamoyltransferase, associated with guanylate transferase deficiency, arginine succinyl succinate synthetase, associated with citrullinated blood glucose dehydrogenase, antisense tyrosine kinase, serine transferase, beta-D, beta-D, beta-D, beta-D, beta-.

Examples of polynucleotides of interest that can be delivered by the AAV of the present invention include, but are not limited to, hexokinase, glucokinase, UCP2, UCP3, PPAR- α, leptin receptor OB-Rb, and GLP-1 in particular embodiments, the gene of interest is selected from the group consisting of Hexokinase (HK), Glucokinase (GK), Alkaline Phosphatase (AP), and Vascular Endothelial Growth Factor (VEGF).

Illustrative, but non-limiting examples of diseases that can be treated with the methods of the present invention include obesity, hyperglycemia, insulin resistance, type 2 diabetes, hypertension, and arterial hypertension. Preferably, type 2 diabetes can be treated by expressing leptin in the area near adipocytes or systemically to reach the hypothalamus.

Furthermore, it has been demonstrated that the AAV of the present invention is useful for genetic engineering of BAT, since internal iBAT administration of VEGF164 by AAV9-mini/UCP1 results in an increase in the level of total VEGF expression and an increase in the number of blood vessels in the iBAT. See fig. 4C-4F. Thus, in a particular embodiment, the invention relates to the use of an AAV or pharmaceutical composition of the invention for the treatment or prevention of a disease in which VEGF expression is desired, e.g., a disease in which management of the disease may benefit from induction of angiogenesis, arteriogenesis, or angiogenesis. Examples of diseases in which expression of VEGF is desired include, but are not limited to, acute surgical and traumatic wounds, burns, scalds, venous ulcers, arterial ulcers, decubitus ulcers (decubitus ulcers), diabetic ulcers, post-radiation wounds, skin grafts, ulcers of mixed etiology, and other chronic or necrotic wounds.

Furthermore, internal eWAT administration with the hSeAP gene of the AAV9-mini/aP2 viral vector (i.e., secreted alkaline phosphatase derived from the human placenta) resulted in a sustained increase in circulating levels of hSeAP. Thus, in a particular embodiment, the invention relates to an AAV or pharmaceutical composition of the invention for use in the treatment or prevention of a disease requiring expression of AP, LPS (i.e. lipopolysaccharide) mediated or exacerbated. Examples of diseases where expression of AP is desired include, but are not limited to, inflammatory bowel disease, sepsis or septic shock, Systemic Inflammatory Response Syndrome (SIRS), meningococcemia, traumatic hemorrhagic shock, bodily injury (hum injury), cardiovascular surgery or cardiopulmonary bypass, liver surgery or transplantation, liver disease, pancreatitis, necrotizing enterocolitis, periodontal disease, pneumonia, cystic fibrosis, asthma, coronary heart disease, congestive heart failure, renal disease, hemolytic uremia, renal dialysis, cancer, alzheimer's disease, and autoimmune diseases such as rheumatoid arthritis and systemic lupus erythematosus.

4. Methods for in vitro transduction of cells

In a third aspect, the invention relates to methods for transducing cells in vitro by using the AAV vectors of the invention. Accordingly, the invention also relates to a method for transducing a cell in vitro comprising contacting the cell with an AAV comprising a recombinant viral genome, wherein the recombinant viral genome comprises an expression cassette comprising an adipose tissue-specific transcriptional regulatory region operably linked to a polynucleotide of interest.

In a preferred embodiment, the adeno-associated viral vector used in the method of transducing cells in vitro has a serotype selected from the group consisting of AAV6, AAV7, AAV8 and AAV9 serotypes. In another embodiment, the adeno-associated viral ITRs are AAV2 ITRs.

In another embodiment, the adeno-associated viral vector comprises an adipose tissue-specific transcriptional regulatory region. In yet another embodiment, the adipose tissue-specific transcriptional regulatory region comprises a promoter region selected from the group consisting of the murine aP2 basic promoter and the rat UCP1 basic promoter. In yet another embodiment, the adipose tissue-specific transcriptional regulatory region further comprises an enhancer region operably linked to the promoter region. In yet another embodiment, the enhancer region is selected from the group consisting of the fat specific aP2 enhancer and the fat specific UCP1 enhancer. In a more preferred embodiment, the adipose tissue-specific transcriptional regulatory region is selected from the group consisting of:

i) polynucleotides comprising the fat-specific aP2 enhancer and the murine aP2 basic promoter and

ii) a polynucleotide comprising the fat specific UCP1 enhancer and the rat UCP1 basal promoter.

In another embodiment, the expression cassette further comprises a post-transcriptional regulatory region. In yet another embodiment, the post-transcriptional regulatory region is a WPRE.

In another embodiment, the polynucleotide of interest encodes a protein selected from the group consisting of a secreted protein that acts systemically and a protein that acts on the adipocytes or their vicinity. In a more preferred embodiment, the polynucleotide of interest encodes a protein selected from the group consisting of hexokinase, glucokinase, alkaline phosphatase, and vascular endothelial growth factor.

In another embodiment, the invention relates to a method for in vitro transduction of a cell with an AAV comprising a recombinant viral genome, wherein the recombinant viral genome comprises an expression cassette comprising a transcriptional regulatory region operably linked to a polynucleotide of interest, wherein the serotype of the AAV is selected from the group consisting of AAV6, AAV7, AAV8, and AAV 9.

In one embodiment, the adeno-associated viral ITRs are AAV2 ITRs.

In another embodiment, the adeno-associated viral vector comprises a recombinant genome comprising transcriptional regulatory regions. In one embodiment, the transcriptional regulatory region is a constitutive promoter. In a preferred embodiment, the constitutive transcriptional regulatory region comprises an actin promoter. In yet another embodiment, the constitutive transcription regulatory region further comprises an enhancer region operably linked to the promoter region. In a more preferred embodiment, the enhancer region is the cytomegalovirus enhancer.

In one embodiment, the transcriptional regulatory region is an adipose tissue-specific transcriptional regulatory region. In yet another embodiment, the adipose tissue-specific transcriptional regulatory region comprises a promoter region selected from the group consisting of the murine aP2 basic promoter and the rat UCP1 basic promoter. In yet another embodiment, the adipose tissue-specific transcriptional regulatory region further comprises an enhancer region operably linked to the promoter region. In yet another embodiment, the enhancer region is selected from the group consisting of the fat specific aP2 enhancer and the fat specific UCP1 enhancer. In a more preferred embodiment, the adipose tissue-specific transcriptional regulatory region is selected from the group consisting of:

i) polynucleotides comprising the fat-specific aP2 enhancer and the murine aP2 basic promoter and

ii) a polynucleotide comprising the fat specific UCP1 enhancer and the rat UCP1 basal promoter.

In another embodiment, the expression cassette further comprises a post-transcriptional regulatory region. In yet another embodiment, the post-transcriptional regulatory region is a WPRE.

In another embodiment, the polynucleotide of interest encodes a protein selected from the group consisting of: secreted proteins acting on the whole body and proteins acting on the adipocytes or their vicinity. In a more preferred embodiment, the polynucleotide of interest encodes a protein selected from the group consisting of hexokinase, glucokinase, alkaline phosphatase, and vascular endothelial growth factor.

Any cell can be transduced using the in vitro methods of the invention. In a particular embodiment, AAV is used to transduce adipose tissue cells. In a more preferred embodiment, the adipose tissue cells are brown adipocytes or white adipocytes.

When the in vitro method for transducing cells according to the present invention is performed to transduce white adipocytes, the transcriptional regulatory region within AAV preferably comprises a mini/aP2 regulatory region. In another embodiment, when the in vitro method for transducing cells according to the present invention is performed to transduce brown adipocytes, the transcriptional regulatory region within AAV preferably comprises an expression cassette comprising a mini/UCP1 regulatory region.

In another aspect of the invention, to improve transgene expression obtained from the mini/aP2 and mini/UCP1 promoters, CAG promoters are used in combination with tissue-specific miRNA target sequences in an attempt to obtain high expression levels in adipose tissue and de-targeted transgene expression by off-target organs. This results in a further enhancement of the potential of AAV vectors to genetically modify adipose tissue when administered locally or systemically.

In additional embodiments, the invention relates to methods for isolating cells transduced in vivo by using the AAV vectors of the invention and culturing them in vitro. In another embodiment, the invention relates to said isolated transduced cells as well as to such cells and pharmaceutical compositions comprising them.

5. Transduced adipocytes and adipocyte cell compositions, ex vivo methods of treatment

In a fourth aspect, the invention relates to adipocytes obtained by the in vitro methods of the invention. In another embodiment, the invention relates to a cell composition comprising adipocytes obtained according to the methods of the invention. Furthermore, the present invention also relates to adipocytes or adipocyte cell compositions comprising the genome of an AAV according to the present invention. Preferably, at least 50% of the cell composition comprises adipocytes according to the invention. More preferably, at least 60%, 70%, 80%, 90%, 95% and 100% of the cell composition comprises adipocytes according to the invention.

As described above, the AAV of the present invention can be used to transduce a cell in vitro to introduce a polynucleotide of interest into the cell. The transduced cells can then be implanted into a human or animal body to achieve a desired therapeutic effect.

Thus, in another embodiment, the invention relates to an adipocyte or cell composition comprising an adipocyte obtained according to the method of the invention for use in medicine.

In another embodiment, the invention relates to an adipocyte or cell composition comprising an adipocyte obtained according to the method of the invention for use in the treatment of a disease requiring the expression of a polynucleotide of interest.

In another embodiment, the present invention relates to a method for treating or preventing a disease comprising administering the adipocytes or the cell composition obtained according to the method of the present invention to a subject in need thereof. Examples of diseases that can be addressed in this way have been defined above in the context of the AAV of the invention.

6. Polynucleotides, vectors and plasmids

In a fifth aspect, the invention relates to polynucleotides useful for producing an AAV according to the invention. Thus, in another embodiment, the invention relates to a polynucleotide ("polynucleotide of the invention") comprising an expression cassette flanked by adeno-associated viral ITRs, wherein the expression cassette comprises an adipose tissue-specific regulatory region operably linked to the polynucleotide of interest.

In a preferred embodiment, the adipose tissue-specific regulatory region comprises a promoter region selected from the group consisting of the murine aP2 basic promoter and the rat UCP1 basic promoter.

In another embodiment, the adipose tissue-specific regulatory region further comprises an enhancer region operably linked to the promoter region. In a more preferred embodiment, the enhancer region is selected from the group consisting of the fat specific aP2 enhancer and the fat specific UCP1 enhancer.

In another embodiment, the regulatory region is selected from the group consisting of:

i) polynucleotides comprising the specific aP2 enhancer of fat and the murine aP2 basic promoter and

ii) a polynucleotide comprising the fat specific UCP1 enhancer and the rat UCP1 basal promoter.

In another embodiment, the expression cassette of the polynucleotide of the invention further comprises a post-transcriptional regulatory element. In yet another embodiment, the post-transcriptional regulatory region is a WPRE.

In another embodiment, the polynucleotide of interest comprised in the polynucleotide of the invention encodes a protein selected from the group consisting of hexokinase, glucokinase, alkaline phosphatase, and vascular endothelial growth factor.

The polynucleotides of the invention may be incorporated into vectors such as, for example, plasmids. Thus, in a further embodiment, the invention relates to a vector or plasmid comprising a polynucleotide of the invention. According to the present invention, the terms "vector" and "plasmid" are interchangeable.

In particular embodiments, the polynucleotides of the invention are incorporated into adeno-associated viral vectors or plasmids. Preferably, all other structural and non-structural coding sequences required for the production of adeno-associated virus are not present in the viral vector, as they can be provided in trans by another vector, such as a plasmid, or by stably incorporating the sequences into a packaging cell line.

The polynucleotides of the invention may be obtained using molecular biology techniques known in the art. See Brown (1995), Watson (1992), Alberts (2008), Innis (1990), Erlich (1989), Sambrook (1989), Bishop (1987), Reznikoff (1987), Davis (1986), and Schleef (2001) supra. In another embodiment, the invention relates to an AAV vector, wherein the genome comprises a polynucleotide of the invention.

7. Methods for obtaining AAV

In a sixth aspect, the invention relates to a method for obtaining an AAV of the invention. The AAV can be obtained by introducing the polynucleotide of the present invention into a cell that constitutively expresses rep and cap. Thus, in another embodiment, the present invention relates to a method for obtaining an adeno-associated viral vector, comprising the steps of:

i) providing a cell comprising a polynucleotide of the invention, an AAV cap protein, an AAV rep protein, or a viral or cellular protein upon which AAV relies on replication flanked by AAV ITRs,

ii) maintaining the cell under conditions suitable for AAV assembly, and

iii) purifying the adeno-associated viral vector produced by the cell.

In a preferred embodiment, the adipose tissue-specific regulatory regions that form part of the polynucleotides of the invention comprise a promoter region selected from the group of the murine aP2 basic promoter and the rat UCP1 basic promoter.

In another embodiment, the adipose tissue-specific regulatory region further comprises an enhancer region operably linked to the promoter region. In a more preferred embodiment, the enhancer region is selected from the group consisting of the fat specific aP2 enhancer and the fat specific UCP1 enhancer.

In another embodiment, the regulatory region is selected from the group consisting of:

i) polynucleotides comprising the specific aP2 enhancer of fat and the murine aP2 basic promoter and

ii) a polynucleotide comprising the fat specific UCP1 enhancer and the rat UCP1 basal promoter.

In another embodiment, the expression cassette of the polynucleotide of the invention further comprises a post-transcriptional regulatory element. In yet another embodiment, the post-transcriptional regulatory region is a WPRE.

In another embodiment, the polynucleotide of interest comprised in the polynucleotide of the invention encodes a protein selected from the group consisting of hexokinase, glucokinase, alkaline phosphatase, and vascular endothelial growth factor.

The production of recombinant aav (raav) for vectorized transgenes has been described previously. See Ayuso E et al, curr. gene ther.2010; 10:423-436, Okada T et al, hum. Gene ther. 2009; 20: 1013-; 20: 922-; 20:807-817. These experimental reports can be used or modified to generate the AAV of the invention. In one embodiment, the production cell line is transiently transfected with a polynucleotide of the invention (comprising an expression cassette flanked by ITRs) and with a construct that encodes rep and cap proteins and provides helper functions. In another embodiment, the production cell line stably provides helper functions and is transiently transfected with a polynucleotide of the invention (comprising an expression cassette flanked by ITRs) and with structures encoding rep and cap proteins. In another embodiment, the cell line stably provides rep and cap proteins as well as helper functions and is transiently transfected with a polynucleotide of the invention. In another embodiment, the cell line stably provides rep and cap proteins and is transiently transfected with a polynucleotide of the invention and a polynucleotide encoding a helper function. In yet another embodiment, the cell line stably provides the polynucleotides, rep and cap proteins of the invention, as well as helper functions. Methods of making and using these and other AAV production systems have been described in the art. See Muzyczka N et al, US 5,139,941, Zhou X et al, US 5,741,683, Samulski R et al, US6,057,152, Samulski R et al, US6,204,059, Samulski R et al, US6,268,213, Rabinowitz J et al, US6,491,907, Zolotukhin S et al, US6,660,514, Shenk T et al, US6,951,753, Snyder R et al, US7,094,604, Rabinowitz J et al, US7,172,893, Monahan P et al, US7,201,898, Samulski R et al, US7,229,823 and Ferrari F et al, US7,439,065.

In another embodiment, transgene delivery capacity of AAV can be increased by providing AAV ITRs of two genomes that can anneal to form a head-to-tail tandem. Typically, when AAV enters a host cell, the single-stranded DNA containing the transgene is converted to double-stranded DNA by the host cell DNA polymerase complex, after which the ITRs help form concatamers in the nucleus. Alternatively, the AAV may be designed as a self-complementary (sc) AAV, which allows the viral vector to bypass the step of second strand synthesis upon entry into the target cell, providing a scAAV viral vector with faster, potentially higher (e.g., up to 100 folds) transgene expression. For example, AAV can be designed to have a genome comprising two linked single-stranded DNAs encoding the transgene unit and its complement, respectively, which can bind upon delivery to a target cell to yield a double-stranded DNA encoding the transgene unit of interest. Self-complementary AAV has been described in the art. See Carter B, US6,596,535, Carter B, US7,125,717, and Takano H et al, US7,456,683.

The role of Cap proteins on host tropism, cell, tissue, or organ specificity, receptor use, infection efficiency, and immunogenicity of AAV viruses has been reported. Thus, AAV caps for rAAV can be selected in view of factors such as the race of the subject (e.g., human or non-human), the immune status of the subject, the suitability of the subject for long-term or short-term treatment, or a particular therapeutic application (e.g., treatment of a particular disease or disorder, or delivery to a particular cell, tissue, or organ). In another embodiment, the rAAV Cap is a Cap based on two or three or more AAV serotypes. In particular embodiments, the AAV cap gene is derived from serotype AAV1, AAV2, AAV4, AAV5, AAV6, AAV7, AAV8, or AAV 9. In a preferred embodiment, the AAV cap genes are derived from serotypes AAV6, AAV7, AAV8, and AAV 9.

In some embodiments, an AAV Cap for use in the methods of the invention can be generated by mutagenesis (i.e., by insertion, deletion, or substitution) of one of the aforementioned AAV caps or nucleic acids encoding same. In some embodiments, the AAV Cap is at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% similar to one or more of the AAV caps described above.

In some embodiments, the AAV Cap is chimeric, comprising domains from at least two of the foregoing AAV caps. In some embodiments, the AAV Cap is a chimera of VP1, VP2, and VP3 monomers from two or three different AAV or recombinant AAV. In some embodiments, the rAAV composition comprises more than one of the foregoing caps.

In some embodiments, the AAV Cap for use in the rAAV compositions is designed to comprise a heterologous sequence or other modification. For example, peptide or protein sequences that confer selective localization or immune evasion may be designed into Cap proteins. Alternatively or additionally, Cap may be chemically modified such that the surface of the rAAV is pegylated (i.e., pegylated), which may facilitate immune evasion. Cap proteins can also be mutagenized (e.g., to remove their native receptor binding, or to mask immunogenic epitopes).

In particular embodiments, the AAV rep genes are derived from serotypes AAV1, AAV2, AAV4, AAV5, AAV6, AAV7, AAV8, and AAV 9. In preferred embodiments, the AAV rep and cap genes are derived from serotypes AAV6, AAV7, AAV8, and AAV 9.

The genes AAV rep, AAV cap and the genes providing helper functions can be introduced into a cell by binding the genes to a vector, such as a plasmid, and introducing the vector into the cell. The genes may be combined into the same plasmid or into different plasmids. In a preferred embodiment, AAV rep and cap genes are combined into one plasmid and genes providing helper functions are combined into another plasmid. Examples of plasmids containing AAV rep and cap genes suitable for use in the methods of the invention include pHLP19 and pRep6cap vectors. See, Colisi P, US6,001,650 and Russell D et al, US6,156, 30. In a preferred embodiment, the genes providing helper functions are derived from adenovirus.

The polynucleotides of the invention, as well as polynucleotides comprising AAV rep and cap genes or genes providing helper functions, may be introduced into cells by using any suitable method known in the art. See Ausubel et al, eds., "short protocols in Molecular Biology", 4th Ed. (John Wiley and Sons, Inc., New York, NY, US,1997), Brown (1995), Watson (1992), Alberts (2008), Innis (1990), Erlich (1989), Sambrook (1989), Bishop (1987), Reznikoff (1987), Davis (1986) and Schleef (2001) supra. Examples of transfection methods include, but are not limited to, transfection with calcium phosphate, DEAE-dextran, polybrene co-precipitation, electroporation, microinjection, liposome-mediated fusion, lipofection, retroviral infection, and biolistic (biolistic) transfection. In a particular embodiment, transfection is performed by co-precipitation with calcium phosphate. Where the cell lacks the expression of any AAV rep and cap genes, as well as genes providing adenoviral helper functions, the genes may be introduced into the cell simultaneously with the polynucleotide of the first aspect of the invention. Alternatively, the gene may be introduced into the cell before or after introduction of the polynucleotide of the first aspect of the invention. In a particular embodiment, cells are transfected simultaneously with three plasmids:

1) plasmids comprising the polynucleotides of the invention

2) Plasmid comprising AAV rep and cap genes

3) Plasmid comprising genes providing helper functions

Methods of culturing packaging cells and conditions that facilitate release of AAV vector particles, such as exemplary conditions for producing cell lysates, can be performed as described in the examples herein. The producer cells are grown for a suitable period of time to facilitate release of the viral vector into the medium. Typically, cells may grow for about 24 hours, about 36 hours, about 48 hours, about 72 hours, about 4 days, about 5 days, about 6 days, about 7 days, about 8 days, about 9 days, up to about 10 days. After about 10 days (or more, depending on the culture conditions and the particular producer cell used), the production level usually drops significantly. Typically, the time of incubation is measured from the point at which the virus is produced. For example, in the case of AAV, viral production is typically initiated when helper virus functions are provided in an appropriate producer cell as described herein. Typically, cells are harvested from about 48 to about 100, preferably from about 48 to about 96, preferably from about 72 to 96, preferably from about 68 to about 72 hours after infection with the helper virus (or after initiation of virus production).

The AAV of the present invention can be produced by: i) cells transfected with a polynucleotide of the invention and ii) culture medium for said cells after a period of time, preferably 72 hours, after transfection. Any AAV used for purification from the cells or the culture medium can be used to obtain the AAV of the invention. In a particular embodiment, the AAV of the invention is purified following an optimization method based on a polyethylene glycol precipitation step and two consecutive cesium chloride (CsCl) gradients. See Ayuso, 2010, supra. Purified AAV of the invention can be dialyzed against PBS, filtered, and stored at-80 ℃. The titer of the viral genome can be determined by quantitative PCR following the procedure described for AAV2 reference standard materials using linearized plasmid DNA as a standard curve. See Lock M et al, hum. gene ther.2010; 21:1273-1285.

In some embodiments, the method further comprises a purification step, such as treating the cell lysate with a nuclease, purifying the cell lysate on a CsCl gradient, or purifying the cell lysate by heparin sulfate chromatography. See halobert C et al, Methods mol.biol.2004; 246:201-212.

Suitable for the production of AAV, various naturally occurring and recombinant AAVs, their encoding nucleic acids, AAV Cap and Rep proteins and their sequences, and methods for isolating or producing, propagating and purifying such AAV, and in particular their capsids, are known in the art. See Gao,2004, Russell D et al, US6,156,303, Hildinger M et al, US7,056,502, Gao G et al, US7,198,951, Zolotukhin S, US7,220,577, Gao G et al, US7,235,393, Gao G et al, US7,282,199, Wilson J et al, US7,319,002, Gao G et al, US7,790,449, Gao G et al, US 20030138772, Gao G et al, US 20080075740, Hildinger M et al, WO 2001/083692, WilsonJ et al, WO 2003/014367, Gao G et al, WO 2003/042397, Gao G et al, WO 2003/052052, Wilson et al, WO 2005/033321, vandeberghe L et al, WO 2006/110689, vandeberghe L et al, WO 2007/127264 and vandeberghe L et al, WO 2008/027084, supra.

8. Pharmaceutical composition

The AAV of the invention may be administered to the human or animal body by conventional methods, which require formulation of the vector in a pharmaceutical composition. Thus, in a seventh aspect, the present invention relates to a pharmaceutical composition comprising an AAV (hereinafter "pharmaceutical composition of the invention"), wherein the AAV comprises a recombinant viral genome, wherein the recombinant viral genome comprises an expression cassette comprising an adipose tissue-specific transcriptional regulatory region operably linked to a polynucleotide of interest. Alternatively, the pharmaceutical composition of the invention may comprise a polynucleotide or polypeptide of the invention.

The pharmaceutical composition may include a therapeutically effective amount of an AAV of the invention and a pharmaceutically acceptable carrier (carrier).

The compositions of the invention may be formulated for delivery to animals (e.g., livestock (cattle, swine, other)) for veterinary purposes, as well as to other non-human mammalian subjects, as well as human subjects. AAV can be formulated with physiologically acceptable vectors for gene transfer and gene therapy applications. The dose of the formulation can be measured or calculated as viral particle or genomic copy ("GC")/viral genome ("vg").

Any method known in the art can be used to determine the Genomic Copy (GC) number of the viral composition of the invention. One method for performing AAV GC number titration is as follows: the purified AAV vector sample is first treated with dnase to remove non-encapsidated AAV genomic DNA or contaminating plasmid DNA from the production process. The dnase-resistant particles are then subjected to a heat treatment to release the genome from the capsid. The number of released genomes was then determined by real-time PCR using primer/probe sets targeting specific regions of the viral genome.

In addition, the viral compositions can be formulated in dosage units to comprise about 1.0 × 10⁹GC to about 1.0X 10¹⁵GC (to treat subjects of average body weight 70 kg), and preferably 1.0X 10¹²GC to 1.0X 10¹⁴Viral vectors are used in human patients in amounts ranging from GC. Preferably, the dose of virus in the formulation is 1.0X 10⁹GC、5.0×10⁹GC、1.0×10¹⁰GC、5.0×10¹⁰GC、1.0×10¹¹GC、5.0×10¹¹GC、1.0×10¹²GC、5.0×10¹²GC、1.0×10¹³GC、5.0×10¹³GC、1.0×10¹⁴GC、5.0×10¹⁴GC. Or 1.0X 10¹⁵GC。

The viral vectors may be formulated in a conventional manner using one or more physiologically acceptable carriers or excipients. AAV may be configured for parenteral administration by injection (e.g., by bolus injection or continuous infusion). Formulations for injection may be presented in unit dose form (e.g., in ampoules or in multi-dose containers) with an added preservative. The viral compositions may take such forms as suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents. Liquid dosage forms of AAV formulations can be prepared by conventional methods with pharmaceutically acceptable additives such as suspending agents (e.g., sorbitol syrup, cellulose derivatives, or hydrogenated edible fats), emulsifying agents (e.g., lecithin or acacia), non-aqueous vehicles (e.g., almond oil, oily esters, ethanol, or fractionated vegetable oils), and preservatives (e.g., methyl or propyl-p-hydroxy-hydroxybenzoates or sorbic acid). The dosage form may also contain a buffer salt. Alternatively, the composition may be in powder form for combination with a suitable vehicle (e.g., sterile, pyrogen-free water) prior to use.

Adjuvants are also included for use in combination or admixture with the AAV of the invention. Contemplated adjuvants include, but are not limited to, inorganic salt adjuvants or inorganic salt gel adjuvants, particulate adjuvants, microparticulate adjuvants, mucosal adjuvants, and immunostimulating adjuvants.

The adjuvant may be administered to the subject as a mixture with the AAV of the invention, or in combination with the AAV.

The pharmaceutical compositions of the present invention may be administered locally or systemically. In a preferred embodiment, the pharmaceutical composition is administered in the vicinity of the tissue or organ whose cells are to be transduced. In a particular embodiment, the pharmaceutical composition of the invention is administered locally into White Adipose Tissue (WAT) or Brown Adipose Tissue (BAT) by WAT internal or BAT internal injection. In another preferred embodiment, the pharmaceutical composition of the invention is administered systemically.

The pharmaceutical composition may be formulated according to conventional methods into a pharmaceutical composition suitable for intravenous injection, subcutaneous, or intramuscular administration to a human. Injectables can be prepared in conventional forms, either as liquid solutions or suspensions, solid forms suitable for solution in liquid or suspension prior to injection, or as emulsions. If desired, the composition may also include a local anesthetic, such as lidocaine, to relieve pain at the injection site. When the composition is administered by osmosis, it may be possible to dispense with an osmotic vial containing a drug-quality water or saline solution. When the composition is administered by injection, a water bottle or sterile saline solution for injection may be provided so that the ingredients may be mixed prior to administration.

The term "therapeutically effective amount" refers to the amount of a polynucleotide, vector, polypeptide, or pharmaceutical composition of the invention calculated to produce the desired effect, and is generally determined by the identity of the polynucleotide, vector, polypeptide, and pharmaceutical composition of the invention, as well as the therapeutic effect to be obtained, among other reasons. The amount of a polynucleotide, vector, polypeptide or pharmaceutical composition of the invention effective in the treatment of a disease is determined by standard clinical techniques described herein or otherwise known in the art. In addition, in vitro assays may optionally be used to help determine the optimal dosage range. The precise dose to be employed in the formulation will depend on the route of administration, and the severity of the condition, and should be decided at the discretion of the physician and will depend on the condition of each patient. Effective doses can be inferred from a pair of dose response curves from in vitro test systems or models in animals. For systemic administration, a therapeutically effective dose may be initially estimated by in vitro testing. For example, a dose may be formulated in animal models to achieve a circulating concentration range that includes IC50 that has been determined in cell culture. The information can be used to accurately determine useful doses in humans. The first dose can also be estimated from in vivo data (e.g., animal models) using techniques known in the art. One of ordinary skill in the art can readily optimize administration to humans based on data in animals.

Such systemic administration includes, but is not limited to, any route of administration which means not directly into the adipose tissue. More particularly, systemic injections, such as intramuscular (im), intravascular (ie), intraarterial (ia), intravenous (iv), intraperitoneal (ip), subcutaneous, or transdermal injections, comprising the polynucleotides, vectors, polypeptides, and pharmaceutical compositions of the present invention are administered systemically. Peripheral administration also includes oral administration of the polynucleotides, vectors, polypeptides and pharmaceutical compositions of the invention, delivery using implants, or instillation via the respiratory system (e.g., intranasally) using sprays, aerosols or any other suitable formulation. Preferably, systemic administration is by im, ip, ia or iv injection. Most preferably, the polynucleotides, vectors, polypeptides and pharmaceutical compositions of the present invention are administered by iv injection. See During M, WO 1996/040954 and Monahan P et al, WO 2001/091803.

The pharmaceutical compositions of the present invention may be administered in a single dose, or in certain embodiments of the invention, multiple doses (e.g., two, three, four, or more administrations) may be employed to achieve a therapeutic effect. Preferably, the AAV comprised in the pharmaceutical composition of the invention is from a different serotype when multiple doses are required.

All of the above mentioned disclosures are herein incorporated by reference in their entirety.

Although the foregoing invention has been described in some detail for purposes of clarity and understanding, it will be appreciated by one skilled in the art from a reading of this disclosure that various changes in form and detail can be made without departing from the true scope of the invention and the appended claims.

General procedure

1. Subject characteristics

Male ICR mice 8-12 weeks old, C57Bl/6J mice 9-13 weeks old, and B6.V-Lep 8 weeks old were used^obOlaHsd (ob/ob) and BKS.Cg- + Lepr^db/+Lepr^dbOlaHsd (db/db) mice. Standard food for mice (TekladdGlobal)

Harlan labs, inc, Madison, WI, US) were fed ad libitum and maintained under a light-dark cycle (at 8:00a.m. light) for 12 h. For tissue sampling, mice were anesthetized by inhalation with isoflurane (

Abbott laboratories, Abbott Park, IL, US) anesthetized and the head was dissected away. Tissues of interest were excised and stored at-80 ℃ or with formaldehyde until analysis.

2. Recombinant AAV vectors

The vectors were generated by three transfections of HEK293 cells according to standard methods. See Ayuso, 2010, supra. In 10 roller bottles (850 cm)²Plane; corning^TMSigma-Aldrich Co., Saint Louis, MO, US) 10% FBS to 80% cell coverage and co-transfected by calcium phosphate method with plasmids carrying the expression cassette flanked by AAV2 ITRs, helper plasmids carrying the AAV2rep gene and the Cap gene of AAV serotype 1,2, 4, 5, 6, 7, 8 or 9, and plasmids carrying helper-functional adenoviruses using transgenes that are a) eGFP driven by a1) hybrid cytomegalovirus enhancer/chicken enhancer/constitutive promoter (CAG) and WPRE regulatory element a2) mouse mini/aP2 regulatory region or a3) mouse mini/UCP1 regulatory region, b) murine hexokinase II (mHKII) cDNA driven by b) CMV ubiquitous promoter (promoter) and WPRE, b2) mouse mini/aP2 regulatory region or mouse mini/8295) murine alkaline phosphatase derived from mouse alkaline phosphatase 1/murine alkaline phosphatase (VEGF 1) derived from mouse mini/493) murine alkaline phosphatase derived from mouse alkaline phosphatase 1/murine₁₆₄And e) RFP driven by the CMV ubiquitous promoter. See Ross, 1990, Graves, 1992 and Cassard-Doulci, supraer, 1998. Using a non-coding plasmid carrying the CMV promoter (pAAV-MCS, Stratagene)^TMAgilent Technologies, Inc., Santa Clara, CA, US), the mini/aP2 regulatory region or the mini/UCP1 regulatory region, and the multiple cloning site produce empty particles. AAV was purified using an optimized method based on a polyethylene glycol precipitation step and two consecutive cesium chloride (CsCl) gradients. This second generation CsCl-based approach significantly reduced empty AAV capsids as well as DNA and protein impurities. See Ayuso, 2010, supra. The purified AAV vector can be dialyzed against PBS, filtered, and stored at-80 ℃. The titer of the viral genome was determined by quantitative PCR following the method described with reference to standard materials for AAV2 using linearized plasmid DNA as a standard curve. See Lock M et al, hum. gene ther.2010; 21:1273-1285. The vector is constructed according to molecular biology techniques known in the art. See Brown (1995), Watson (1992), Alberts (2008), Innis (1990), Erlich (1989), Sambrook (1989), Bishop (1987), Reznikoff (1987), Davis (1986), and Schleef (2001) supra.

3. eWAT internal administration of AAV vectors in vivo

Mice were anesthetized with intraperitoneal injections of ketamine (100mg/kg) and xylazine (10 mg/kg). A laparotomy was performed to expose white adipose tissue of epididymis. AAV vectors were resuspended in saline solution with or without 2% pluronic F88(basfcorp, Florham Park, NJ, US) and injected directly into the epididymal fat pad. Each epididymal fat pad was injected twice with 50 μ L AAV solution (one injection near the testes and the other in the middle of the fat pad). The abdomen was rinsed with sterile saline solution and closed with a two-layer method.

4. In vivo iBAT internal and iWAT internal administration of AAV vectors.

Mice were anesthetized with intraperitoneal injections of ketamine (100mg/kg) and xylazine (10 mg/kg). Incisions 1.5-2cm long in the longitudinal direction were made in the interscapular or inguinal region to expose the iBAT or iWAT, respectively. The vectors were dispersed throughout the library by using Hamilton syringes to subject each iBAT or iWAT to 4 injections of 10. mu.l of AAV solution. The skin is closed using a one-layer approach.

Systemic administration of AAV vectors

An appropriate amount of AAV solution was diluted in 200 μ Ι _ of saline solution and manually injected into the caudal side vein at the time of delivery without applying pressure. Prior to injection, animals were placed under 250W infrared heating lamps (Philips NV, Amsterdam, NL) for a few minutes to dilate the vessels and facilitate visualization and easier access to the tail vein. Animals were fixed for injection using a plastic restrictor (Harvard Apparatus, Holliston, MA, US). Anesthesia is not used due to the use of a suitable restriction device. Animals were injected with a 30 needle diameter needle.

6. Immunohistochemistry

Tissue was fixed in formaldehyde for 12 to 24 hours, embedded in paraffin, and sectioned for detection of GFP, RFP, and α -SMA the sections were incubated overnight at 4 ℃ with goat anti-GFP antibody (Abcam plc, Cambridge, MA, US) diluted 1:300, rabbit anti-RFP antibody (Abcam plc, Cambridge, MA, US) diluted 1/400, or mouse anti- α -SMA antibody (Sigma-aldrich co., sata Cruz, MO, US) diluted 1/300 either biotinylated donkey anti-goat antibody (Santa Cruz Biotechnology, inc., Santa Cruz, CA, US) diluted 1:300 or biotinylated goat anti-rabbit antibody (piere Antibodies, Thermo hergical scientific., Rockford, IL, US) diluted 1/300 or biotinylated anti-rabbit antibody (piere Antibodies, Thermo herceptic Scientific 488, Rockford, IL, US) diluted 1/300 (biotinylated anti-goat anti-rabbit antibody, streptage) diluted 1:300 as streptavidin antibody (streptane) for detection of GFP, RFP and α -SMA antibody (streptac) diluted 1: 300-horse antibody)

Life Technologies Corp., Carslbad, CA, US) was used as a fluorescent dye and Hoescht bisbenzimide (Sigma-Aldrich Co., Saint Louis, MO, US) was used for nuclear counterstain. Alternatively, ABC peroxidase kit (Pierce Biotechnology, inc., Rockford, IL, US) was used at 1:50 dilution and sections were counterstained in Mayer's hematoxylin.

Analysis of β -galactosidase expression in eWAT samples

To detect all β -galactosidase present in eWAT, tissue samples were fixed in 4% paraformaldehyde for 1h in PBS solutionWashed twice and then at 5mM K₃Fe(CN)₅、5mM K₄Fe(CN)₆And 1mM MgCl₂In PBS (5-bromo-4-chloro-3- β -D-galactoside) at 37 ℃ in the dark for 6-8 h.

GFP content

To determine GFP content, tissues were incubated in 1mL of lysis buffer (PBS, 50mM/L Tris, 1% NonidetP40, 0.25% sodium deoxycholate, 150mM/L NaCl, 1mM/L EDTA, pH 7.4, sterile filtered) with

Type tissue homogenizers were mechanically disrupted and incubated at room temperature for 10 minutes. After incubation, the samples were centrifuged at 14000rpm for 10 minutes. The supernatant was transferred to a new tube and the GFP content in 100 μ L of this solution was measured with a flash spectrometer Flx800(Bio-Tek Instruments, Inc, Winooski, VT, US) having an excitation wavelength of 488nm and an emission wavelength of 512 nm. The total GFP content values were corrected by the protein containing samples.

9. Isolation of adipocytes from epididymal fat pad

AAV-transduced adipocytes were isolated using the modified Rodbell method. See Rodbell M, j.biol.chem.1964; 239:375-380. Mice anesthetized with isoflurane were sacrificed by removal of the head and epididymis WAT was minced and digested in Krebs-Ringer bicarbonate HEPES buffer (KRBH) containing 4% BSA (without fatty acids), 0.5mM/L glucose and 0.5mg/mL collagenase type II (C6885; Sigma-Aldrich Co., Saint Louis, MO, US) at 37 ℃ for 35-45 minutes. Adipocytes were separated by gentle centrifugation and washed three times with fresh collagenase-free KRBH without glucose. Adipocytes were resuspended in fresh KRBH without glucose and cell number was estimated as previously described. See DiGirolamo M et al, am.j. physiol 1971; 221:850-858.

RNA analysis 10

Total RNA was isolated by using QIAzol lysis reagent (Qiagen NV, Venlo, NL) or tripure isolation reagent (Roche Diagnostics Corp., Indianapolis, IN, US), and RNeasy lipid tissue Mini kit (Li)pid Tissue minikiikit) was obtained from isolated adipocytes and fat depots or liver. To remove residual viral genome, total RNA was treated with DNAseI (Qiagen NV, Venlo, NL). For RT-PCR, the Superscript VILOcDNA Synthesis reagent set (Invitrogen) was used^TMLife Technologies corp., Carslbad, CA, US) reverse transcribing 1 μ g of RNA samples. After the use of EXPRESS SYBRGreen qPCR supermix (Invitrogen)^TMOf Life technologies Corp., Carslbad, CA, US)

Real-time quantitative PCR was performed in (Cepheid, Sunnyvale, USA). The sequences of the sense and antisense oligonucleotide primers were:

the data were normalized to 36B4 values and analyzed as previously described. See Pfaffl M, Nucleic acids sres.2001; 29(9) e 45.

11. Ex vivo glucose uptake in isolated adipocytes

For isolated adipocytes from mice, 2- [1-³H]deoxy-D-glucose (2-DG; Amersham Pharmacia Biotech Inc., Piscataway, NJ, US). See Traxiger R et al, J.biol.chem.1989; 264:8156-8163. Briefly, isolated adipocytes were obtained by collagenase digestion of epididymal WAT from mice fed as described previously. With KRBH + 4% BSA (without fatty acids), 10mM/L deoxy-glucose, 0.4. mu. Ci 2- [1-³H]deoxygenated-D-glucose and various insulin concentrations were incubated with 250. mu.L of the adipocyte suspension for 5 minutes. Finally, adipocytes and culture medium were separated by silicone oil (Sigma-Aldrich co., Saint Louis, MO, US) in polypropylene tubes, and radioactivity in the adipocyte samples was assessed by liquid scintillation counting. The result is expressed as pmol of 2-, [ 2 ], [³H]-DG per 10⁶Cells per minute.

12. In vivo glucose uptake

Assay body as described previouslyAn intrinsic basal glucose utilization index. See Franckhauser S et al, Diabetes 2002; 51:624-630. Briefly, the non-metabolizable glucose analog of 148GBq (4. mu. Ci), deoxy-D- [1,2-³H]Glucose (2-DG; PerkinElmer, Inc., Waltham, MA, US) was mixed in BSA-citrate buffer. A scintillation injection (flash injection) of a radioisotope-labeled mixture was administered into the jugular vein of anesthetized (ketamine + xylazine) mice at time zero. Specific blood 2-DG clearance was determined as previously described using 25 μ L blood samples (tail vein) obtained 1, 15 and 30 minutes post injection. See Somogyi M, j.biol.chem.1945; 160:69-73. Tissue samples were removed 30 minutes after injection. The glucose utilization index is determined by measuring the accumulation of the radiolabeled compound. See Ferre P et al, biochem.J. 1985; 228:103-110. The amount of 2-DG-6 phosphate per mg of protein was divided by the integral of the measured concentration ratio of 2-DG to unlabeled glucose. Since the values are not corrected by the "discrimination constant" of 2-DG in the glucose metabolic pathway, the results are expressed as an index of glucose utilization in picomoles per minute per milligram of protein.

13. Measurement of blood hSeAP levels

Use of

Phospha-Light^TMSystem (Applied Biosystems)^TMLife technologies corp., Carslbad, CA, US), circulating hSeAP levels were determined from 5 μ L of serum.

14. Statistical analysis

All values are expressed as mean ± SEM. The differences between the groups were compared by Student's t-test (Student's t-test). The difference was considered significant at p < 0.05.

Example 1

In vivo transduction of white adipocytes by local administration of AAV

To assess the in vivo transduction efficiency of White Adipose Tissue (WAT) using AAV vectors, 4X 10 was used¹¹Viral genome (vg)/murine AAV serotypes 1,2, 4, 5, 6, 7, 8 and 9 (ubiquitous)Under the control of the promoter CAG, the promoter encodes a marker protein GFP (AAV-CAG-GFP), with or without the nonionic surfactant Pluronic F88, and was injected bilaterally into the white adipose tissue of the epididymis (eWAT) of mice. See Croyle M et al, mol. ther. 2001; 22: 28, Gebhart C, et al, J.ControlRelease 2001; 73:401-416, Mizukami H, et al, hum. Gene ther.2006; 17:921-928, Sommer J et al, mol. ther. 2003; 7:122-128. Administration of AAV1, AAV2, AAV4 and AAV5 without pluronic F88 resulted in a very low percentage of white adipocytes transduced two weeks after injection as assessed by immunostaining against GFP in eWAT. Furthermore, no improvement in fat transduction efficiency mediated by any of the serotypes tested was achieved by the addition of pluronic F88. See fig. 1A. Thus, the use of the nonionic surfactant was discarded for subsequent experiments. Regardless of the addition of pluronic F88, AAV1 was more efficient in eWAT in vivo transduction than AAV2, AAV4 and AAV 5. See Mizukami, 2006, supra. In contrast to the group of small numbers of dispersed adipocytes and few adipocytes transduced by AAV1, animals injected with AAV6 and AAV7 exhibited multiple larger GFP⁺Group of white adipocytes. Furthermore, animals treated with AAV8 and AAV9 showed much greater transduction of eWAT, and the vast majority of adipocytes were transduced per eWAT region. See fig. 1B. Quantification of GFP content in eWAT two weeks after administration by fluorescence analysis further confirmed that AAV of serotypes 6, 7, 8 and 9 was more efficient in eWAT in vivo transduction than AAV 1. See fig. 1C. It is noteworthy that epididymal fat pads injected with AAV8 and AAV9 exhibited the highest GFP content and there were no significant statistical differences between them. See fig. 1C. Giving 2X 10 inside a one-sided eWAT¹¹Two weeks later with the LacZ substrate 5-bromo-4-chloro-3-indolyl- β -D-galactoside (X-gal) staining for vg/murine, AAV8 encoding the LacZ gene under control of the ubiquitous CMV promoter (AA8-CMV-LacZ) showed extensive distribution throughout the eWAT transduced adipocytes, see FIG. 1 D.AAV8 and AAV9-CAG-GFP vector administered locally to the Inguinal WAT (iWAT) mediated massive transduction of white and light brown adipocytes in this pool (depot). see FIGS. 1G and H, taken together, these results indicate that AAV8 and AAV9 are the most inherited WAT in vivoA suitable carrier.

Furthermore, the internal administration of eWAT of AAV vectors results in transduction that is virtually limited to eWAT. Two weeks after injection, animals treated with AAV1, AAV6, AAV7, AAV8, or AAV9-CAG-GFP did not exhibit transduction of mesenteric, retroperitoneal, and inguinal tracts, whereas a small amount of GFP did not appear⁺Brown adipocytes are present in iBAT in mice injected internally with AAV9 eWAT. See fig. 8A. However, transgene expression in BAT was very little detected compared to eWAT. See fig. 8B. With regard to transduction of non-adipose tissue, the eWAT internal administration of AAV7, AAV8, and AAV9-CAG-GFP also resulted in significant gene transfer to the liver and heart and to a lesser number of exocrine cells of the pancreas. See fig. 8C.

As proof of concept, to assess whether AAV-transduced adipocytes could be a viable model for studying fat function in vivo, 4X 10¹¹vg/mouse, ubiquitous promoter CMV controlled, AAV9 vector encoding the hexokinase II (mHKII) of the murine enzyme (AAV9-CMV-mHKII) or an equivalent dose of AAV9-CMV-null vector was bilaterally injected into the eWAT of healthy mice. Two weeks after injection, isolated adipocytes from animals treated with AAV9-CMV-mHKII showed a 3-fold increase in mHKII expression compared to adipocytes from mice injected with AAV 9-CMV-null. See fig. 1E. To analyze AAV-mediated overexpression of mHKII in adipocytes, basal and insulin-stimulated 2- [1-³H]deoxy-D-glucose. Basal 2- [1-³H]The uptake of deoxy-D-glucose was slightly increased compared to AAV9-CMV-null transduced adipocytes. In contrast, insulin stimulation resulted in 2- [1-³H]The increase in deoxy-D-glucose is greater. See fig. 1F.

Example 2

In vivo AAV-mediated specific genetic engineering of white adipocytes

Evaluation of short versions of murine adipocyte protein 2(mini/aP2) promoter consisting of only adipocyte-specific enhancer with aP2 primeThe mover is used in combination. See Ross, 1990 and Graves, 1992, supra. The purpose of this assay was to limit AAV-mediated transgene expression to adipocytes. One-sided eWAT internal administration 10¹²vg/mouse, AAV8 and AAV9 encoding GFP, under the control of the mini/aP2 regulatory region, mediated limited transduction of white adipocytes, and two weeks after injection had no detectable GFP expression in liver and heart. See fig. 2A and 9.

To assess the time course of transgene expression mediated by the mini/aP2 regulatory region in mice, 4 × 10¹²AAV9 vector (AAV9-mini/aP2-SeAP) or saline solution encoding secreted alkaline phosphatase (hSeAP) cDNA derived from human placenta, at vg/murine doses, under control of the mini/aP2 regulatory region, was injected bilaterally into eWAT and circulating hSeAP levels were measured at various time points following AAV administration. Until two weeks after AAV delivery, high levels of hSeAP were detected and increased gradually for up to 40 days. Thereafter, circulating hSeAP levels were maintained for a follow-up period of at least one year following injection. hSeAP expression levels in liver and eWAT quantified by qPCR confirmed that eWAT is the tissue responsible for the major production of hSeAP. See fig. 2B-2C.

To assess whether AAV-mediated specific genetic engineering of white adipocytes could constitute a new tool for studying adipocyte function, differentiation and metabolism in mice, 1.4X 10¹²vw was administered per mouse, under control of the mini/aP2 regulatory region, with either the AAV9 vector encoding mHKII (AAV9-mini/aP2-mHKII) or an equivalent dose of AAV9-mini/aP2-null vector. Two weeks after injection, the in vivo basal 2- [1-³H]deoxy-D-glucose uptake. Animals receiving AAV9-mini/aP2-mHKI vector showed increased basal 2- [1-³H]deoxy-D-glucose. Under basal conditions, no 2- [1-³H]Differences in deoxy-D-glucose uptake. See fig. 2D.

Example 3

Genetic engineering of brown adipocytes in vivo by local delivery of AAV vectors

Considering that AAV8 and AAV9 are the most efficient genetic engineering vectors mediating white adipocytes, transduction of brown adipocytes by the same serotype was evaluated. 2 x 10 to⁹Two weeks after vg/mouse administration of AAV8 and AAV9-CAG-GFP vectors to Interscapular Brown Adipose Tissue (iBAT), multiple GFP s were detected⁺Brown adipocytes. See fig. 3A. Assessment of GFP expression levels by qPCR revealed that at 2X 10⁹Transduction efficiency by AAV8 was higher at vg/murine dose compared to AAV 9. See fig. 3B. Once transduction of brown adipocytes was demonstrated using AAV8 and AAV9 vectors, we characterized the efficiency of Brown Adipose Tissue (BAT) in vivo transduction using AAV of serotypes 1,2, 4, 5, 6, 7, 8, and 9. For this purpose, 1.2X 10¹⁰Vg/murine dose of AAV or 10 of serotypes 4 and 8¹¹AAV (AAV-CMV-RFP), under the control of the ubiquitous promoter CMV, encoding a marker protein RFP, was injected into mice at vg/murine doses of serotypes 1,2, 4, 5, 6, 7, 8, and 9. Quantification of RFP expression levels by qPCR after two weeks of internal administration of iBAT showed higher transduction efficiency of iBAT by AAV7, AAV8 and AAV9 compared to AAV1, 2, 4, 5 and 6. See fig. 3C. Consistently, extensive RFP was detected in iBAT of animals receiving AAV9 vector⁺Brown adipocyte distribution. See fig. 3D.

Furthermore, internal administration of AAV iBAT leads to a limited transduction of this pool, with undetectable transgene expression in the epididymal, mesenteric, retroperitoneal and inguinal pools. Regarding transduction of non-adipose tissue, animals treated internally with AAV7, AAV8, and AAV9 vectors showed transduction of heart and liver, whereas GFP expression could not be detected in pancreas, intestine, spleen, lung, kidney, skeletal muscle, testis, epididymis, and brain. See fig. 10.

Example 4

AAV-mediated specific genetic engineering of brown adipocytes in vivo

The expression of the gene of interest in brown adipose tissue was specifically regulated using a mini UCP1(mini/UCP1) regulatory region consisting of an enhancer giving specific expression to brown adipocytes and a basic promoter of rat UCP1 gene. See Boyer B et alCell biol.1991; 11:4147-4156, Kozak U et al, mol.cell biol.1994; 59-67, Cassard-Doulcier, 1998, supra, and Larose, 1996. Internally administered iBAT 2X 10¹¹Two weeks after vg/mouse AAV8 or AAV9-mini/UCP1-GFP vector, high-efficiency transduction of brown adipocytes was obtained. See fig. 4A. Similarly, iBAT is delivered internally 2 × 10¹¹vg/mouse AAV8 and AAV9-mini/aP2-GFP also transduced brown adipocytes. See fig. 11A. In addition, the mini/UCP1 regulatory region achieved highly adipocyte-specific GFP expression, completely abolished AAV-mediated transgene expression in the heart, and mediated only a small amount of liver transduction. See fig. 11B.

To test that AAV-mediated iBAT transduction could be a novel model to study brown adipocyte function, 7X 10 cells were used¹⁰Vg/mouse AAV8-mini/UCP1-mHKII vector gives iBAT. Animals receiving AAV8-mini/UCP1-mHKII vector exhibit increased basal 2- [1-³H]deoxy-D-glucose and no 2- [1-³H]Differences in deoxy-D-glucose uptake. See fig. 4B. Then, 2X 10¹¹Vg/mouse AAV9-mini/UCP1-VEGF₁₆₄The vector or AAV9-mini/UCP1-null vector delivers the iBAT internally. Two weeks after injection, receive AAV9-mini/UCP1-VEGF₁₆₄Animals with vectors exhibit VEGF₁₆₄And increased total VEGF levels in iBAT compared to animals treated with AAV9-mini/UCP1-null vector. Furthermore, in the overexpression of VEGF₁₆₄Was obtained over-expression of PECAM 1(a commonly used endothelial cell marker) as demonstrated by immunostaining for α -SMA in iBAT, using AAV9-mini/UCP1-VEGF₁₆₄The vector treated animals exhibited an increased number of blood vessels compared to animals receiving the AAV9-mini/UCP1-null vector. See fig. 4C-4F.

Example 5

In vivo genetic engineering of white and brown adipocytes by systemic administration of AAV8 and AAV9

Will be 5X 10¹²Vg/murine dose of AAV8 or AAV9-CAG-GFP vector administered via tail veinLean mice. Transduction of the fat pool was assessed two weeks after injection. Immunostaining for GFP against the eWAT fraction showed AAV8 and AAV9 mediated transduction of white adipocytes. Furthermore, measurement of GFP expression levels and GFP content demonstrated similar transduction efficiencies for AAV8 and AAV 9. In addition, systemic delivery was 5 × 10¹²vg/murine AAV8 or AAV9 vector efficiently mediated transduction of iBAT brown adipocytes. Measurement of GFP expression levels by qPCR and GFP content by fluorescence analysis indicated that AAV8 tended to exhibit superior iBAT transduction efficiency compared to AAV 9. In addition, measurement of GFP expression levels by qPCR demonstrated gene transfer to the inguinal, retroperitoneal and mesenteric pools. However, significant differences in transduction efficiency were observed among the pools. See fig. 5A-5H. Importantly, intravenous administration of AAV8 or AAV9 vectors to diabetic-obese ob/ob mice or db/db mice also resulted in genetic engineering of WAT and BAT, and efficiencies similar to those obtained in lean mice. See fig. 13. Systemic administration of AAV8 or AAV9-CAG-GFP vector transduces various non-adipose tissues. See fig. 12.

Example 6

In vivo specific genetic engineering of white and brown adipocytes using AAV-mini/aP2 and AAV-mini/UCP1 vectors

Systemic delivery of 2X 10, although providing lower levels of transgene expression¹²AAV8 or AAV9-mini/aP2-GFP in vg mice resulted in transduction of white and brown adipocytes. See fig. 7A. In contrast, systemic administration was 2X 10¹²AAV8 or AAV9-mini/UCP1-GFP vectors in vg mice mediated the transduction of significant brown adipocytes. See fig. 6A. In addition, intravenous delivered AAV-mini/aP2-GFP and AAV-mini/UCP1-GFP vectors achieved high adipocyte-specific GFP expression, no detectable transgene expression in the heart and only a few dispersed GFP in the liver⁺Small expression of hepatocytes. See fig. 7B-7C.

To further demonstrate the genetic engineering of adipocytes by systemic administration of AAV, 2X 10 was used¹²vg AAV9-mini/UCP1-VEGF₁₆₄Or AAV9-mini/UCP1-null delivered by the caudal vein. Two months after injection, receive AAV9-mini/UCP1-VEGF₁₆₄Animal display of vectorsIncreased VEGF compared to animals treated with AAV9-mini/UCP1-null vector₁₆₄Expression of (2). See fig. 6B-6C. In addition, 8 × 10¹²The vg doses of AAV9-mini/UCP1-VEGF164 or AAV9-mini/UCP1-null vectors were also delivered via the caudal vein. One month after injection, receive 8X 10¹²vg AAV9-mini/UCP1-VEGF₁₆₄Animals with vectors exhibit increased VEGF₁₆₄And expression of PECAM1 and increased vascular density. See fig. 6D-6G.

Example 7

In vivo specific genetic engineering of Brown adipocytes Using AAV-mini/aP2-GK

2 x 10 to¹¹The mice were given topical iBAT at vg/mouse doses, controlled by the mini/aP2 regulatory region, of AAV9 vector encoding mouse glucokinase (AAV9-mini/aP2-rGK) or at equivalent doses of AAV9-mini/aP2-null vector. Two weeks/one month post-injection, 2- [1-³H]deoxygenation-D-glucose uptake to assess whether animals receiving AAV9-mini/aP2-rGK vector exhibit increased specificity for basal 2- [1-³H]deoxy-D-glucose uptake.

Example 8

Targeted efficient adipocyte transduction and transgene expression from liver and heart with mirT sequences following systemic administration of AAV vectors

Systemic administration of 10¹²AAV9 vectors encoding GFP marker proteins cloned in the 3' UTR of expression cassettes at vg/murine doses under control of either ubiquitous CAG promoter (AAV9-CAG-GFP) or CAG promoter plus four tandem target sites for liver-specific miR122a (AAV9-CAG-GFP-miRT122), heart-specific miR1(AAV9-CAG-GFP-miRT1) or both (AAV 9-CAG-GFP-double miRT). After two weeks of injection, higher levels of GFP expression were observed in white and brown adipocytes from mice receiving AAV9-CAG-GFP, AAV9-CAG-GFP-mirT122, AAV9-CAG-GFP-mirT1, or AAV 9-CAG-GFP-double mirT vectors. In contrast, GFP production in the liver or heart was almost completely abolished in mice treated with AAV9-CAG-GFP-mirT122 or AAV9-CAG-GFP-mirT1 vectors, respectively. It is obvious thatGFP production was greatly inhibited in the liver and heart from mice treated with AAV 9-CAG-GFP-double miRT. See fig. 14.

Claims (26)

1. An adeno-associated viral vector comprising a recombinant viral genome which is AAV6, AAV7, AAV8 or AAV9, wherein the recombinant viral genome comprises an expression cassette comprising an adipose tissue-specific transcriptional regulatory region operably linked to a polynucleotide of interest.

2. The adeno-associated viral vector according to claim 1 wherein the adipose tissue-specific transcriptional regulatory region comprises a promoter region which is the aP2 basal promoter or the UCP1 basal promoter.

3. The adeno-associated viral vector according to claim 2 wherein the adipose tissue-specific transcriptional regulatory region further comprises an enhancer region operably linked to the promoter region.

4. The adeno-associated viral vector according to claim 3 wherein the enhancer region is the fat specific aP2 enhancer or the fat specific UCP1 enhancer.

5. The adeno-associated viral vector according to claim 4 wherein the adipose tissue-specific transcriptional regulatory region is:

(i) a polynucleotide comprising the fat specific aP2 enhancer and the murine aP2 basal promoter; or

(ii) A polynucleotide comprising the fat-specific UCP1 enhancer and the rat UCP1 basic promoter.

6. The adeno-associated viral vector according to any one of claims 1 to 5 wherein the expression cassette further comprises a post-transcriptional regulatory region.

7. The adeno-associated viral vector according to claim 6 wherein the post-transcriptional regulatory region is a woodchuck hepatitis virus post-transcriptional regulatory element.

8. The adeno-associated viral vector according to any one of claims 1 to 7 wherein the polynucleotide of interest encodes a secreted protein that acts systemically or a protein that acts on or near adipocytes.

9. The adeno-associated viral vector according to any one of claims 1 to 8 wherein the polynucleotide of interest encodes the following proteins: hexokinase, glucokinase, alkaline phosphatase, or vascular endothelial growth factor.

10. The adeno-associated viral vector according to any one of claims 1 to 9 wherein the adeno-associated virus further comprises an ITR which is an AAV2 ITR.

11. The adeno-associated viral vector according to any one of claims 1 to 10 further comprising at least one miRNA target sequence.

12. The adeno-associated viral vector according to claim 11 wherein the at least one miRNA target sequence is mirT122 a.

13. The adeno-associated viral vector according to claim 11 wherein the at least one miRNA target sequence is mirT 1.

14. The adeno-associated viral vector according to claim 11 comprising at least one copy of mirT1 and one copy of mirT122 a.

15. A pharmaceutical composition comprising the adeno-associated viral vector according to any one of claims 1 to 14.

16. Use of the adeno-associated viral vector according to any one of claims 1 to 14 or the pharmaceutical composition according to claim 15 in the manufacture of a medicament for the treatment or prevention of a disease requiring expression of the polynucleotide of interest in the adipose tissue.

17. The use of claim 16, wherein the adipose tissue comprises white adipose tissue.

18. The use of claim 16, wherein the adipose tissue comprises brown adipose tissue.

19. The use according to claim 16, wherein the adeno-associated viral vector or the pharmaceutical composition is administered systemically or locally.

20. An in vitro method of transducing a cell, the method comprising contacting the cell with the adeno-associated viral vector according to any one of claims 1 to 14.

21. The in vitro method of claim 20, wherein said cells are adipocytes.

22. The in vitro method of claim 20, wherein said adipocytes are white adipocytes or brown adipocytes.

23. An adipocyte cell that has been obtained by the method of any one of claims 20 to 22.

24. A method for obtaining an adeno-associated viral vector according to any one of claims 1 to 14, comprising the steps of:

(i) providing a cell comprising a polynucleotide, an AAV cap protein, an AAV rep protein, and a viral protein upon which AAV relies for replication, said polynucleotide comprising an expression cassette flanked by adeno-associated viral ITRs, wherein said expression cassette comprises an adipose tissue-specific regulatory region operably linked to a polynucleotide of interest;

(ii) maintaining the cell under conditions suitable for AAV assembly, and

(iii) purifying the adeno-associated viral vector produced by the cell, wherein the rep or cap protein is derived from AAV serotype AAV6, AAV7, AAV8 or AAV 9.

25. The method according to claim 24, wherein the viral protein upon which AAV is dependent for replication is derived from adenovirus.

26. The method of claim 24 or 25, wherein step (iii) is further performed by a polyethylene glycol precipitation step or cesium chloride gradient fractionation.

Images