CN105916990B - Adeno-associated virus vector for transduction of adipose tissue - Google Patents

Abstract

The present invention relates to adeno-associated viral vectors for transduction of adipose tissue. The present invention also relates to polynucleotides, plasmids, vectors and methods for producing such adeno-associated viral vectors. The present invention also relates to methods for the treatment of diseases requiring modulation of gene expression levels.

Description

Adeno-associated viral vectors for transduction of adipose tissue

technical field

The present invention relates to adeno-associated virus (AAV) vectors for transduction of adipose tissue. This vector can transduce white or brown adipose tissue in a tissue-specific manner.

Background technique

Adipose tissue, in addition to its known role as a fat depot and regulator of energy homeostasis, has recently been recognized as a major metabolic and endocrine organ. Impaired white adipose tissue (WAT) function, as well as reduced brown adipose tissue (BAT) activity or BAT mass, have been proposed to be major factors in the development of obesity. In this regard, adipocyte and WAT dysfunction in humans has been described. In addition, an inverse correlation between BAT activity and body mass index (BMI) was also reported. See Yee J et al, Lipids Health Dis. 2012, 11:19-30, Ichimura A et al, Nature 2012;483:350-354, Mazzatti D et al, Arch.Physiol.Biochem.2012;118(3):112-120, Cypess A et al, N. Engl. J. Med. 2009; 360: 1509-1517 and van Marken Lichtenbelt W et al, N. Engl. J. Med. 2009; 360: 1500-1508.

The incidence of obesity has increased significantly over the past few decades to reach epidemic proportions. It is estimated that more than 500 million people are obese. Obesity is a major public health problem today. See IASO, "Global Prevalence of Adult Obesity, Report IOTF 2008" (IASO, London, GB, 2009). Obesity itself increases the risk of death and is strongly associated with insulin resistance and type 2 diabetes in the long term. See Peeters A et al, Ann. Intern. Med. 2003; 138:24-32 and Moller D et al, N. Engl. J. Med. 1991; 325:938-948. In addition, adipocyte dysfunction and obesity are also significant risk factors for certain types of cancer and many other serious diseases, such as heart disease, immune dysfunction, hypertension, arthritis, and neurodegenerative diseases. See Roberts D et al, Annu. Rev. Med. 2010; 61:301-316, Spiegelman B et al, J. Biol. Chem. 1993; 268(10): 6823-6826 and Whitmer R et al, Curr. Alzheimer Res. 2007 ; 4(2):117-122.

Diet and exercise are the main treatments for obesity, but an increasing number of patients also require pharmacological interventions to lose and maintain weight. However, drug treatment does not trigger involuntary or significant weight loss, and in addition, anti-obesity drugs often exhibit severe side effects due to their systemic effects. Therefore, there is an urgent need for new and safe ways to prevent and combat the current obesity epidemic. In this regard, elucidating the pathological events underlying obesity is critical for the development of new anti-obesity therapies. In vivo gene transfer of candidate genes to white and brown adipose tissue may offer great potential to understand the molecular mechanisms underlying the pathogenesis and onset of obesity. Furthermore, gene therapy approaches targeting adipocytes could open up new opportunities for future treatment of obesity and its associated disorders while minimizing systemic responses. However, efficient and specific genes for transfer to white and brown adipose tissue have so far remained elusive.

Recently, AAV of serotype 1 (AAV1) was shown to show WAT in moderately infected mice when it was combined with a nonionic surfactant or triptolide. See Mizukami H et al, Hum. Gene Ther. 2006;17:921-928 and Zhang F et al, Gene Ther. 2011;18:128-134. Other AAV serotypes, such as AAV6, AAV7, AAV8 or AAV9, have been reported to be highly infectious, but their adipotransduction efficiency is unclear. See Gao G et al, Proc. Natl. Acad. Sci. USA 2002; 99: 11854-11859, Nakai H et al, J. Virol. 2005; 79: 214-224, Pacak C et al, Circ. Res. 2006; 99: e3-e9, Broekman M et al. Neuroscience 2006; 138:501-510, Wang Z et al. Diabetes 2006; 55:875-884, Taymans J et al. Hum. Gene Ther. 2007; 18:195-206, Bish L et al. , Hum. Gene Ther. 2008; 19: 1359-1368 and Lebherz C et al, J. Gene Med. 2008; 10: 375-382. Accordingly, there is a need in the art to develop vectors that specifically transduce adipose tissue, and, in addition, specific types of adipocytes.

SUMMARY OF THE INVENTION

The present invention relates to adeno-associated viral vectors (AAV) that transfer polynucleotides of interest to specific types of adipocytes and express them. The use of adipose tissue-specific regulatory elements of the present invention limits the expression of polynucleotides of interest in white or brown adipose tissue. Furthermore, the vectors of the present invention have proven useful for the treatment of adipose tissue-related diseases such as, for example, type 2 diabetes. Inventive aspects of the invention are disclosed in the claims.

Microorganism preservation

Plasmids pAAV-mini/aP2-null and pAAV-mini/UCP1-null were deposited at DSMZ (Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH) on June 8, 2012 under accession numbers DSM 26057 and DSM 26058, respectively, Inhoffenstraβe 7 B, D- 38124 Braunschweig, Federal Republic of Germany.

Description of drawings

Figure 1. Transduction of white adipocytes by internal administration of eWAT of AAV. AB. Sections of eWAT treated with AAV-CAG-GFP of serotypes 1, 2, 4 and 5 (A) with or without Pluronics F88 and with serotype 6 , 7, 8 and 9 (B) Immunostaining for green fluorescent protein (GFP, green) in fractions of AAV-CAG-GFP treated eWAT. Blue, nucleus. Arrows indicate transduced adipocytes. Initial magnifications 100× (B, left panel) and 200× (A; B, right panel). C. GFP content in eWAT treated with AAV-CAG-GFP of serotypes 1, 6, 7, 8, or 9 (n=5 per group). Values shown are mean ± SEM. RLU, relative light unit. D. Full X-gal staining of eWAT receiving AAV8-CMV-LacZ. X-gal staining was distributed throughout the transduced eWAT. In contrast, no X-gal staining was detected in eWAT from animals treated with saline solution. E. Relative mHKII expression levels in isolated cells obtained from eWAT of animals treated with AAV9-CMV-mHKII or AAVO-CMV-null vector. F. Basal and insulin-stimulated ² [1-3H]deoxy-D-glucose uptake by isolated adipocytes from mice injected with AAV9-CMV-null and AAV-CMV-mHKII. Adipocytes were obtained from at least 5 mice/group. G. Immunostaining for GFP (brown) in inguinal white adipose tissue (iWAT) fractions two weeks after intra-iWAT administration of 2 x 10 ¹¹ vg of AAV8 or AAV9-CAG-GFP vectors. Initial magnification × 100. H: GFP expression levels in iWAT two weeks after injection of ² x 1011 vg of AAV8 or AAV9-CAG-GFP (n=6). Values shown are mean ± SEM. *p<0.05, **p<0.01 and ***p<0.001; relative to AAV9-CMV-null #p<0.05 at the same insulin concentration. All analyses were performed two weeks after eWAT intra-administration of ^2x1011 vg/eWAT.

Figure 2. Specific transduction of white adipocytes following eWAT internal administration of AAV via the mini/aP2 regulatory region. A. Immunostaining for GFP (brown) in eWAT receiving 10 ¹² vg/eWAT of AAV8 and AAV9-mini/aP2-GFP vectors. Analysis was performed two weeks after injection. Initial magnification × 400. B. Circulating hSeAP levels. A dose of 4 x ¹⁰¹² vg/mouse of AAV9-mini/aP2-hSeAP vector was bilaterally injected into eWAT and measurements of circulating hSeAP levels were performed at several time points after injection. RLU, relative light unit. Values shown are mean ± SEM. n=3 (saline) and n=4 (AAV9-mini/aP2-SeAP). C. Relative hSeAP expression levels in liver and eWAT after one year intra-eWAT administration of AAV9-mini/aP2-hSeAP of 4×10 ¹² vg/mouse. D. Assessment of in vivo 2-[1-2-[1- by eWAT, iBAT and heart after two weeks of intra-eWAT administration of AAV9-mini/aP2-null and AAV9-mini/aP2-mHKII vectors (1.4×10 ¹² vg/mouse) ³ H]deoxy-D-glucose uptake. Values shown are mean ± SEM. n=7 mice per group. *p<0.05.

Figure 3. Transduction of brown adipocytes given internally by iBAT of AAV. A. Immunostaining for GFP (brown) in sections of iBAT treated with 2 x ¹⁰⁹ vg/mouse of AAV8 or AAV9-CAG-GFP. Initial magnifications ×200 and ×400 (panel). B. Relative GFP expression levels in iBAT receiving 2 x ¹⁰⁹ vg/mouse of AAV8 or AAV9-CAG-GFP. Values shown are mean ± SEM. n=5 mice per group. *p<0.05. C. Relative in iBAT receiving 2 x 10 ¹⁰ vg/mouse of AAV4 or AAV8-CMV-RFP or 2 x 10 ¹⁰ vg/mouse of AAV1, AAV2, AAV5, AAV6, AAV7, AAV8, or AAV9-CMV-RFP Red fluorescent protein (RFP) expression levels. The transduction pattern is similar to eWAT. See Figure 1. AAV6, AAV7, AAV8 and AAV9 are the most efficient serotypes for transduction of iBAT. D. Immunostaining for RFP (brown) in sections of iBAT treated with 10 ¹¹ vg/mouse of AAV9-CMV-RFP. Initial magnifications ×200 and ×400 (panel). Analysis was performed two weeks after AAV administration.

Figure 4. Specific transduction of brown adipocytes following iBAT internal administration of AAV via the mini/UCP1 regulatory region. A. Transduction of brown adipocytes was assessed by immunostaining for GFP (brown) two weeks after injection of 2×10 ¹¹ vg/mouse of AAV8 or AAV9-mini/UCP1-GFP vector. Initial magnifications ×200 and ×400 (panel). B. In vivo 2-[ ^1-3H ] uptake by iBAT, eWAT and heart two weeks after administration of AAV8-mini/UCP1-null and AAV8-mini/UCP1-mHKII vectors (7×10 ¹⁰ vg/mouse) Deoxy-D-glucose. n=6 (AAV8-mini/UCP1-mHKII) and n=10 (AAV8-mini/UCP1-null) mice per group. CE. Relative _mVEGF164 (C), total mVEGF (D) and mPECAM1 in iBAT two weeks after delivery of 2 x 10 ¹¹ vg/mouse of AAV9-mini/UCP1- _mVEGF164 or AAV9-mini/UCP1-null vector (E) Expression levels. n=5 mice per group. F. Immunostaining in iBAT for α-SMA (brown) two weeks after injection of 2×10 ¹¹ vg/mouse of AAV9-mini/UCP1-mVEGF ₁₆₄ or AAV9-mini/UCP1-null vector. Initial magnification × 400. Values shown are mean + SEM. *p<0.05. Red arrows indicate capillary structures.

Figure 5. Transduction of white and brown adipocytes by systemic delivery of AAV vectors to lean mice. A. Immunostaining for GFP (green) in the eWAT section. Blue, nucleus. Initial magnification ×100 (left image) and ×200 (right image). B. Relative GFP expression levels in eWAT. C. GFP content in eWAT. D. Immunostaining for GFP (brown) in the iBAT section. Initial magnifications ×200 and ×400 (panel). E. Relative GFP expression levels in IBAT. F. GFP content in iBAT. GH. After intravenous (iv) administration of vector to ICR mice (G) and C57B16 mice (H) (ICR: n=3 for AAV8 and n=5 for AAV9; C57B16: n=4), inguinal (iWAT), peritoneal Relative GFP expression levels in posterior (rWAT), mesentery (mWAT), eWAT and iBAT. All analyses were performed two weeks after tail vein administration of 5 x ¹⁰¹² vg/mouse of AAV8 or AAV9-CAG-GFP vectors. AU, arbitrary unit. RLU, relative light unit.

Figure 6. Specific transduction of brown adipocytes following systemic administration of AAV in the regulatory region of mini/UCP1. A. Immunostaining for GFP (brown) in iBAT receiving AAV8 or AAV9-mini/UCP1-GFP vectors. Initial magnifications ×200 and ×400 (panel). BC. Relative mVEGF ₁₆₄ (B) and total mVEGF (C) in iBAT treated with AAV9-mini/UCP1-mVEGF ₁₆₄ or AAV9-mini/UCP1-null from 2×10 ¹² vg mice two months after injection The expression level. DE. VEGF164 (B) and PECAM1 (C) expression levels in iBAT one month after intravenous administration of 8 x 10 ¹² vg of AAV9-mini/UCP1-VEGF ₁₆₄ or AAV9-mini/UCP1-null (n=5) . FG. Immunostaining for CD105 (brown) (D) and α-SMA (brown) (E) in the same panel as BC. Red arrows indicate blood vessels. Initial magnifications ×400 and ×1000 (panel). Values shown are mean + SEM. n=5 mice per group, *p<0.05.

Figure 7. Transduction of adipocytes expressing via mini/aP2 regulatory region and fat-restricted transgenes following systemic administration of AAV. A. Transduction of brown adipocytes was assessed by immunostaining for GFP (brown) in iBAT fractions from animals receiving AAV8 or AAV9-mini/aP2-GFP vectors. Initial magnifications ×200 and ×400 (panel). BC. Transduction of non-adipose tissue was assessed by immunostaining for GFP (brown) two weeks after injection. GFP expression was minimal in the liver of animals treated with AAV8 or AAV9-mini/aP2-GFP (B) and AAV8 or AAV9-mini/UCP1-GFP (C) and absent in the heart. Initial magnifications x 100 and x 400 (panel). All analyses were performed two weeks after systemic injection of 2 x ¹⁰¹² vg/mouse.

Figure 8. Off-target transgene expression following eWAT internal administration of AAV. A. Immunostaining for GFP (brown) in iBAT from animals receiving AAV9-CAG-GFP. Initial magnifications ×200 and ×400 (panel). B. Relative GFP expression levels in iBAT and eWAT from animals treated with AAV9-CAG-GFP. Values shown are mean ± SEM. n=5 mice per group. *p<0.05. C. Transduction of non-animal fat organs was assessed by immunostaining for GFP (green). GFP expression was evident in hearts and livers from animals injected with AAV7, AAV8, or AAV9. Initial magnification × 100. Analysis was performed two weeks after intra-eWAT administration of the AAV-CAG-GFP vector ( ⁴ x 1011 vg mice).

Figure 9. AAV-mediated transgene expression restricted by adipose tissue through the mini/aP2 regulatory region. Two weeks after local eWAT administration of 10 ¹² vg of AAV8 and AAV9-mini/aP2-GFP vectors, no GFP expression was detected in liver and heart by immunostaining for GFP. Initial magnification × 100.

Figure 10. Transduction of non-animal adipose organs by internal administration of iBAT of AAV vectors. Transduction of non-adipose organs was assessed by immunostaining for GFP (brown) two weeks after injection. Expression of GFP was evident in the heart and liver from animals injected internally with 2 x ¹⁰⁹ vg/mouse of AAV8 and AAV9-CAG-GFP vector iBAT. Initial magnification × 200.

Figure 11. Transduction of brown adipocytes by transgene expression via mini/aP2 regulatory region and fat restriction following internal administration of iBAT of AAV. A. Transduction of brown adipocytes was assessed by immunostaining (brown) for GFP two weeks after intra-iBAT delivery of AAV9-mini/aP2-GFP vector at ² x 1011 vg/mouse. Initial magnifications ×200 and ×400 (panel). B. Transduction of non-adipose organs was assessed by immunostaining for GFP (brown) two weeks after local injection of AAV8 or AAV9-mini/UCP1-GFP vector ( ² x 1011 vg/mouse) into iBAT. There is less GFP expression in the liver. Initial magnifications x 100 and x 400 (panel).

Figure 12. Extensive transgene expression following tail vein delivery of AAV. Immunostaining for GFP (green) showed transduction of liver, heart, skeletal muscle, testis and kidney two weeks after 5 x ¹⁰¹² vg/mouse injection of AAV9-CAG-GFP vector via tail vein. Blue, nucleus. Initial magnification × 200.

Figure 13. Transduction of WAT and BAT following systemic administration of AAV vectors to obese-diabetic mice. AB. Epididymal white adipose tissue (eWAT), inguinal white adipose tissue (iWAT) after intravenous administration of 3×10 ¹² vg of AAV8 or AAV9-CAG-GFP vector to ob/ob (A) and db/db mice (B) ) and immunostaining for GFP (brown) in interscapular brown adipose tissue (iBAT) fractions. Initial magnification × 200. (ob/ob: n=4; db/db: n=4). CD. GFP expression in inguinal (iWAT), retroperitoneal (rWAT), mesenteric (mWAT), eWAT and iBAT pools from the same group of ob/ob (C) and db/db mice (D). AU, arbitrary unit. All analyses were performed two weeks after vector delivery. Values shown are mean ± SEM. vs. AAV9*p<0.05.

Figure 14. Efficient adipocyte transduction and de-targeting of transgene expression in liver and heart with mirT sequences. Epididymal white adipose tissue ( ^eWAT ), inguinal white adipose tissue (eWAT), groin GFP immunostaining in white adipose tissue (iWAT), interscapular brown adipose tissue (iBAT), liver and heart. Initial magnifications x 100 (liver and heart), x 200 (eWAT and iWAT) and x 400 (iBAT and panels).

Detailed ways

The present invention discloses adeno-associated virus vectors based on AAV6, AAV7, AAV8 and AAV9 serotypes that can efficiently mediate gene transfer to WAT or BAT when administered locally. See Figures IB and 1C and Figures 3A-3D. Systemic administration of these vectors also resulted in efficient gene delivery into both WAT and BAT. See Figures 5A and 5D. Although gene delivery mediated by AAV8 and AAV9 vectors is efficient, it is not limited to adipose tissue. The present invention discloses that the combination of AAV8 and AAV9 vectors and adipose tissue-specific promoter regions enables specific expression of polynucleotides of interest in adipose tissue. In particular, local administration of AAV8 or AAV9 comprises an expression cassette in which a heterologous gene (eg, GFP) under the control of the mini/aP2 regulatory region results in its expression in WAT but not in liver or expression in the heart. See Figure 2A and Figure 9. In addition, local administration of AAV8 or AAV9 contained an expression cassette in which a heterologous gene (eg, GFP) under the control of the mini/UCP1 regulatory region resulted in its expression in BAT but not in the heart and only to a lesser extent in the liver. See Figures 4A and 11B. Thus, local administration by the combination of the vector and promoter of the present invention provides a safe mechanism for in vivo adipocyte-based transduction for the treatment of various diseases.

Furthermore, systemic administration of the combinations of the present invention constitutes an alternative route for transduction of adipocytes. In this regard, the present invention discloses that systemic administration of AAV8 or AAV9-mini/UCP1 in combination with AAV9 or AAV9-mini/aP2 is highly efficient for transduction of BAT and WAT, respectively. See Figures 6A and 7A. Regardless of which two regulatory regions were used, systemic administration of the combinations of the invention resulted in highly restricted expression of the polynucleotide of interest in adipose tissue, with no expression in the heart and only less expression in the liver. See Figures 7B and 7C.

1. Definitions of common terms and expressions

As used interchangeably herein, the terms "adeno-associated virus", "AAV virus", "AAV virion", "AAV virion" and "AAV particle" refer to proteins composed of at least one AAV capsid protein (preferably A virus particle consisting entirely of the capsid protein of a specific AAV serotype) and an encapsidated polynucleotide AAV genome. If the particle comprises a heterologous polynucleotide flanked by AAV terminal inverted repeats (ie, a polynucleotide that is not a wild-type AAV genome, eg, for delivery of a transgene to mammalian cells), it is commonly referred to as an "AAV vector particle" or "AAV vector". AAV refers to a virus belonging to the Parvoviridae family of the genus Dependovirus. The AAV genome is approximately 4.7 kilobases long and consists of single-stranded deoxyribonucleic acid (ssDNA) that can be positive or negative. The genome contains inverted terminal repeats (ITRs) at both ends of the DNA strand, and two open reading frames (ORFs): rep and cap. The rep framework is formed by four overlapping genes encoding Rep proteins required for the AAV life cycle. The cap framework contains overlapping nucleotide sequences of capsid proteins: VP1, VP2, and VP3, which interact together to form an icosahedral symmetric capsid. See Carter B, Adeno-associated virus and adeno-associated virus vectors for genedelivery, Lassic D et al., Eds., "Gene Therapy: Therapeutic Mechanisms and Strategies" (Marcel Dekker, Inc., New York, NY, US, 2000) and Gao G et al, J. Virol. 2004;78(12):6381-6388.

The term "Adeno-Associated Virus ITR" or "AAV ITR" as used herein refers to inverted terminal repeats present at both ends of the DNA strand of the genome of an Adeno-Associated Virus. ITR sequences are required for efficient proliferation of the AAV genome. Another property of these sequences is their ability to form hairpins. This property facilitates its self-priming, which allows the synthesis of a second DNA strand independent of priming enzymes. Also shown is the high efficiency of ITR for integration and rescue of wild-type AAV DNA into the host cell genome (i.e., chromosome 19 in humans), and for AAV DNA bound to the fully assembled, DNase-resistant AAV particles produced Encapsidation is required.

The term "AAV2" as used herein refers to the serotype of adeno-associated virus having a genomic sequence as defined in GenBank Accession No. NC001401.

The term "AAV vector" as used herein further refers to a vector comprising one or more polynucleotides (or transgenes) of interest flanked by AAV terminal repeats (ITRs). Such AAV vectors can replicate and package into infectious viral particles when present in host cells that have been transfected with vectors that encode and express the rep and cap gene products (ie, AAV Rep and Cap proteins), and Wherein, the host cell has been transfected with a vector encoding and expressing a protein from the adenovirus open reading frame E4orf6. When an AAV vector is incorporated into a larger polynucleotide (eg, a chromosome or another vector, such as a plasmid used for cloning or transfection), the AAV vector is often referred to as a "pro-vector" . This protein-vector can be "rescue" by replication and encapsidation in the presence of AAV packaging functions and the necessary helper functions provided by E4orf6.

The term "adipose tissue" as used herein refers to tissue composed of mature adipocytes (ie, fat cells) and a combination of small blood vessels, neural tissue, lymph nodes, and stromal vascular components (SVF). SVF is composed of endothelial cells, fibroblasts, adipocyte precursor cells (i.e. preadipocytes) and immune cells such as macrophages and T cells. In mammals, two different types of adipose tissue are commonly distinguished: white adipose tissue (WAT) and brown adipose tissue (BAT). The main functions of adipose tissue are to store energy in the form of fat, to generate heat through non-shudder thermogenesis, and to secrete adipokines.

The term "adipose tissue cell" or "adipocyte" as used herein refers to a cell type that comprises adipose tissue and is specialized to store energy as fat, or generate heat by non-shudder thermogenesis, and secrete adipokines. Adipose tissue cells include white adipocytes and brown adipocytes.

The term "adipose tissue-specific transcriptional regulatory region" as used herein refers to a nucleic acid sequence that acts as a promoter (ie, regulates the expression of a selected nucleic acid sequence operably linked to the promoter) and which affects the selected nucleic acid sequence in Expression in specific tissue cells, such as adipocytes. Adipose tissue-specific transcriptional regulatory regions can be constitutive or inducible.

The term "alkaline phosphatase" or "AP" as used herein refers to enzymes that catalyze the hydrolysis of phosphate groups from many types of molecules, including nucleotides, proteins and alkaloids (EC 3.1.3.1).

The term "angiogenesis" as used herein refers to the process of forming new blood vessels from other pre-existing blood vessels, and includes vasculogenesis and arteriogenesis.

The term "arteriogenesis" as used herein refers to the formation, growth or development of blood vessels with layers of smooth muscle media.

The term "brown adipose tissue cell" or "brown adipocyte" as used herein refers to the type of fat cell that is polygonal and characterized by the accumulation of lipids into multiple smaller "multi-lumen" droplets, and their Numerous large mitochondria with lamellar ridges packed within the cytoplasm. Unlike white adipocytes, these cells have considerable cytoplasm. The nucleus is round, and although its location is off-center, it is not at the periphery of the cell. The numerous mitochondria of brown adipocytes and the rich vascularity of brown fat depots are the main reasons for the brown color of BAT. Brown adipocytes are located in the typical BAT pool and are responsible for heat production through non-shudder thermogenesis. See Enerback S, N. Engl. J. Med. 2009;360:2021-2023.

The term "CAG regulatory region" as used herein refers to the combination formed by the early enhancer element of cytomegalovirus and the chicken beta-actin promoter. See Alexopoulou A et al, BMC Cell Biology 2008;9(2):1-11.

The term "cap gene" or "AAV cap gene" as used herein refers to the gene encoding the Cap protein. The term "Cap protein" as used herein refers to a polypeptide having the functional activity of at least one native AAV Cap protein (eg, VP1, VP2, VP3). Examples of functional activities of Cap proteins (eg, VP1, VP2, VP3) include the ability to induce capsid formation, promote the accumulation of single-stranded DNA, promote AAV DNA packaging into the capsid (ie, encapsidation), bind to cellular receptors body and facilitate the entry of virions into the host.

The term "capsid" as used herein refers to the structure in which the viral genome is packaged. The capsid is composed of various oligomeric structural subunits formed by proteins. For example, AAV has an icosahedral capsid formed by the interaction of three capsid proteins: VP1, VP2, VP3.

The term "cellular component" as used herein refers to a composite of material comprising the adipocytes of the present invention and at least one other component. The ingredients may be formulated as a single formulation or may be presented as separate formulations of the individual components, which may be combined into a combined formulation for combined use. The compositions may be kit-of-parts in which each component is formulated and packaged separately.

The term "constitutive promoter" as used herein refers to a promoter whose activity is maintained at relatively constant levels in all cells of an organism, or during most developmental stages, and is less dependent on cellular environmental conditions or irrelevant.

The term "enhancer" as used herein refers to a DNA sequence element into which a transcription factor binds to increase transcription of a gene.

The term "expression cassette" as used herein refers to a nucleic acid construct, recombinantly or synthetically produced with a series of specialized nucleic acid elements, which allows transcription of a particular nucleic acid in a target cell.

The term "gene that provides a helper function" as used herein refers to a gene encoding a polypeptide that performs the function on which AAV depends (ie, "helper function") for replication. Auxiliary functions include those necessary for AAV replication, including, but not limited to, those involved in activation of AAV gene transcription, stage-specific AAV mRNA splicing, AAV DNA replication, synthesis of cap expression products, and AAV capsid assembly. Virus-based accessory functions can be derived from any known helper virus, such as adenovirus, herpes virus (rather than herpes simplex virus type 1), and vaccinia virus. Helper functions include, but are not limited to, adenovirus E1, E2a, VA and E4 or herpesvirus UL5, UL8, UL52 and UL29 and herpesvirus polymerase.

The term "hexokinase" or "HK" as used herein refers to an enzyme that catalyzes the phosphorylation of hexose sugars to form hexose phosphates. In most organisms, glucose is the major substrate for HK, and glucose-6-phosphate is the most important product.

The term "high blood pressure" or "arterial hypertension" as used herein refers to a medical condition in which the blood pressure of the arteries is elevated. Blood pressure includes two measurements, systole and diastole, which depend on whether the heart muscle contracts (systole) or relaxes (diastole) between beats. Normal blood pressure at rest is in the range of 100-140 mmHg systolic (highest reading) and 60-90 mmHg diastolic (lowest reading). Hypertension is said to be present if it is consistently at or above 140/90mmHg. Hypertension is classified as primary (spontaneous) hypertension and secondary hypertension; approximately 90-95% of cases are classified as "essential hypertension", which means there is no apparent underlying medical cause of hypertension. The remaining 5-10% of cases (ie, secondary hypertension) are caused by other conditions affecting the kidneys, arteries, heart, or endocrine system. Insulin resistance, which is common in obesity, is also thought to contribute to high blood pressure. Hypertension is a major risk factor for stroke, myocardial infarction (ie, heart attack), heart failure, arterial aneurysm (eg, aortic aneurysm), peripheral arterial disease and a cause of chronic kidney disease. Even moderate increases in arterial blood pressure are associated with reduced life expectancy.

The term "hyperglycemia" as used herein refers to a state in which abnormally high blood sugar levels occur compared to fasting baseline levels. In particular, hyperglycemia is understood as the glucose level in venous plasma 2 hours after fasting blood glucose level is consistently higher than 126 mg/dL, postprandial glucose level is higher than 140 mg/dL, or 2 hours after administration of glucose at a dose of 1.75 g/kg body weight Occurs above 200 mg/dL.

The term "insulin resistance" as used herein refers to a disorder in which cells respond incorrectly to insulin. As a result, the body produces more insulin in response to high blood glucose levels. Patients with insulin resistance often exhibit high glucose levels and high circulating insulin levels. Insulin resistance is frequently associated with obesity, hypertension and hyperlipidemia. In addition, insulin resistance frequently occurs in patients with type 2 diabetes.

The term "topical administration" as used herein refers to the administration of a polynucleotide, vector, polypeptide, or pharmaceutical composition of the invention to a subject at or near a specific site.

The term "obesity" as used in the present invention refers to the ratio provided by WHO, based on body mass index (BMI), which is the ratio between an individual's weight (in kg) and their height in meters squared composition) definition. According to this standard, a BMI of less than ^18.5kg /m2 is considered underweight or thin, a BMI of ^18.5-24.9kg /m2 is considered normal weight, a BMI of 25.0-29.9kg/ ^m2 is considered to be class 1 overweight, and a BMI of 30.0- A BMI of 39.0 kg/m ² is considered to be grade 2 overweight and a BMI of greater than or equal to 40.0 kg/m ² is considered morbid obesity. Alternatively, other methods exist for defining the degree of obesity in a subject, such as waist diameter (in cm) measured at the midpoint between the lower rib edge and the upper edge of the pelvis, thickness of skin folds, biological Impedance, which is based on the principle that lean mass transmits electrical current better than fat mass.

The term "operably linked" as used herein refers to the functional relationship and location of a promoter sequence relative to a polynucleotide of interest (eg, a promoter or enhancer is operably linked to a coding sequence if it affects the transcription of the sequence). Typically, an operably linked promoter is contiguous with the sequence of interest. However, the enhancer need not be adjacent to the sequence of interest to control its expression.

The terms "pharmaceutically acceptable carrier", "pharmaceutically acceptable diluent", "pharmaceutically acceptable excipient", or "pharmaceutically acceptable excipient" are used interchangeably herein. "Vehicle" means a non-toxic solid, semi-solid, or liquid filler, diluent, encapsulating material, or formulation adjuvant of all conventional types. A pharmaceutically acceptable carrier is substantially non-toxic to recipients at the dosages and concentrations employed and is compatible with the other ingredients of the formulation. The amount and nature of the pharmaceutically acceptable carrier will depend on the desired form of administration. Pharmaceutically acceptable carriers are known and can be prepared by methods known in the art. See Faulíi Trillo C, "Tratado de Farmacia Galénica" (Ed. Luzán 5, S.A., Madrid, ES, 1993) and Gennaro A, Ed., "Remington: The Science and Practice of Pharmacy" 20 ed. (Lippincott Williams & Wilkins, Philadelphia, PA , US, 2003).

The term "promoter" as used herein refers to a nucleic acid segment located upstream of a polynucleotide sequence that functions to control the transcription of one or more polynucleotides, and through the presence of binding sites for and are recognized by structures: DNA-dependent RNA polymerase binding sites, transcription initiation sites, and any other DNA sequences, including (but not limited to) transcription factor binding sites, repressor and activator protein binding sites, and any Other sequences of nucleotides known in the art that act directly or indirectly to regulate the amount of transcription from a promoter. A "tissue-specific" promoter refers to a promoter that is active only in a particular type of differentiated cell or tissue.

The term "polynucleotide" as used herein refers to a nucleic acid molecule, DNA or RNA, containing deoxyribonucleotides or ribonucleotides. Nucleic acids can be double-stranded, single-stranded, or contain portions of both double-stranded or single-stranded sequences. The term "polynucleotide" includes, but is not limited to, nucleic acid sequences that have the ability to encode polypeptides and nucleic acid sequences that are complementary to part or all of an endogenous polynucleotide in a cell or a subject treated therein, thereby following its transcription, resulting in RNA molecules (eg, microRNA, shRNA, siRNA) capable of hybridizing and inhibiting the expression of endogenous polynucleotides.

The term "post-transcriptional regulatory region" as used herein refers to any polynucleotide that facilitates the expression, stabilization, or localization of sequences contained in an expression cassette or resulting gene product.

The terms "prevent," "preventing," and "prevention" as used herein refer to inhibiting the onset or reducing the incidence of disease in a subject. Prevention can be complete (eg, complete absence of pathological cells in the subject) or partial. Prevention also refers to reducing susceptibility to clinical conditions.

The term "recombinant viral genome" as used herein refers to an AAV genome in which at least one exogenous expression cassette polynucleotide is inserted into a naturally occurring AAV genome.

The term "rep gene" or "AAV rep gene" as used herein refers to the gene encoding the Rep protein. The term "Rep protein" as used herein refers to a polypeptide having the functional activity of at least one native AAV Rep protein (eg Rep 40, 52, 68, 78). A "functional activity" of a Rep protein (eg, Rep 40, 52, 68, 78) is any activity associated with the physiological function of the protein, including promoting DNA replication through recognition, ligation, and nicking (nicking) DNA replication AAV origin and DNA helicase activity. Additional functions include regulation of transcription from AAV (or other heterologous) promoters and site-specific integration of AAV DNA into the host chromosome.

The term "subject" as used herein refers to an individual, plant, or animal, such as humans, non-human primates (eg, chimpanzees and other ape and monkey species), livestock (eg, birds, fish, cattle , sheep, pigs, goats, and horses), or experimental animals (eg, rodents such as mice, rats, and guinea pigs). The term does not denote a specific age or gender. The term "subject" includes embryos and fetuses.

As used herein, the terms "administered systemically" and "administered systemically" refer to the non-local administration of a polynucleotide, vector, polypeptide, or pharmaceutical composition of the invention to a subject. Systemic administration of a polynucleotide, vector, polypeptide, or pharmaceutical composition of the invention can reach multiple organs or tissues throughout the body of a subject, or can reach a specific organ or tissue in a subject. For example, intravenous administration of a pharmaceutical composition of the present invention can result in transduction of more than one tissue or organ in a subject.

The term "transcriptional regulatory region" as used herein refers to a nucleic acid segment capable of regulating the expression of one or more genes. The regulatory regions of the polynucleotides of the present invention include promoters and enhancers.

The term "transduce" or "transduction" as used herein refers to the process by which a foreign nucleotide sequence is introduced into a cell by a viral vector.

The term "transfection" as used herein refers to the introduction of DNA into recipient eukaryotic cells.

The term "treat" or "treatment" as used herein refers to the administration of a compound or composition of the present invention to control the progression of a disease after the appearance of clinical signs. Controlling disease progression is understood to mean a favorable or desired clinical outcome including, but not limited to: reduction of symptoms, reduction of disease duration, stabilization of pathological state (in particular, avoidance of further exacerbations), delay of disease progression, Improvement in pathological status and remission (both partial and total). Control of disease progression also includes prolonging survival as compared to expected survival if no treatment is applied.

The term "type 2 diabetes" as used herein refers to a disease characterized by an inappropriate increase in blood sugar levels. Chronic hyperglycemia in diabetes is associated with long-term damage, dysfunction, and failure of different organs, while leading to various complications such as retinopathy, nephropathy, and peripheral neuropathy. Type 2 diabetes is caused by insulin resistance in peripheral tissues (primarily skeletal muscle, adipose tissue and liver) and an inappropriate compensatory insulin secretion response due to a combination of reduced beta-cell mass and function. In addition to increased glucose concentrations, the lack of insulin action often results in increased cholesterol or triglyceride levels.

The term "angiogenesis" as used herein refers to the formation, growth, development or proliferation of blood vessels derived from undifferentiated or differentiated cells.

Life Technologies Corp.，Carslbad，CA，US)、pcDNA3、pcDNA3.1/hyg pHCMV/Zeo、pCR3.1、pEFl/His、pIND/GS、pRc/HCMV2、pSV40/Zeo2、pTRACER-HCMV、pUB6/V5-His、pVAXl、pZeoSV2、pCI、pSVL和pKSV-10、pBPV-1、pML2d和pTDTl。The term "vector" as used herein refers to a structure capable of delivering, and optionally expressing, one or more polynucleotides of interest to a host cell. Examples of vectors include, but are not limited to, viral vectors, naked DNA or RNA expression vectors, plasmids, cosmid or phage vectors, DNA or RNA expression vectors associated with cationic condensing agents, encapsulation in lipids DNA or RNA expression vectors in vivo and certain eukaryotic cells, such as producer cells. The vector can be stable and self-replicating. There are no restrictions on the type of carrier that can be used. The vector may be a cloning vector, suitable for propagating and obtaining polynucleotides, genetic constructs or expression vectors that bind to various heterologous organisms. Suitable vectors include prokaryotic expression vectors (eg, pUC18, pUC19, Bluescript and their derivatives), mp18, mp19, pBR322, pMB9, CoIE1, pCR1, RP4, phage and shuttle vectors (eg, pSA3 and pAT28), and virus-based Eukaryotic expression vectors of vectors (eg, adenovirus, adeno-associated virus, and retroviruses and lentiviruses), as well as non-viral vectors, such as pSilencer 4.1-CMV (

Life Technologies Corp., Carslbad, CA, US), pcDNA3, pcDNA3.1/hyg pHCMV/Zeo, pCR3.1, pEFl/His, pIND/GS, pRc/HCMV2, pSV40/Zeo2, pTRACER-HCMV, pUB6/V5 -His, pVAX1, pZeoSV2, pCI, pSVL and pKSV-10, pBPV-1, pML2d and pTDT1.

The term "VEGF" as used herein refers to vascular endothelial growth factor. "VEGF" includes, but is not limited to, VEGF variants A, B, C, D, E and F. See Hamawy A et al, Curr. Opin. Cardiol. 1999; 14:515-522, Neufeld G et al, Prog. Growth Factor Res. 1994; 5:89-97, Olofsson B et al, Proc.Natl.Acad.Sci.USA 1996; 93: 2576-2581, Chilov D et al., J. Biol. Chem. 1997; 272: 25176-25183 and Olofsson B et al., Curr. Opin. Biotechnol. 1999; 10: 528-535. VEGF variants include, but are not limited to, isoforms _VEGF164 , _VEGF121 , _VEGF145 , _VEGF167 , _VEGF165 , _VEGF189 , and _VEGF206 . See Tischer E et al, J. Biol. Chem. 1991; 266: 11947-11954 and Poltorak Z et al, J. Biol. Chem. 1997; 272: 7151-7158. The term "VEGF" also includes vascular permeability factor or vascular opsonin (vasculotropin) (VPF). See Keck P et al. Science 1989;246:1309-1312 and Senger D et al. Science 1983;219:983-985. VPF is currently known in the art as VEGF A. Other members of the VEGF family can also be used, including placental growth factors PIGF I and II. Sequences of suitable VEGFs are readily available (eg, National Center for Biotechnology Information, http://www.ncbi.nlm.nih.gov/June 2012). For example, genes from members of the human VEGF family Loci include: VEGF-A-P15692 and NP003367; VEGF-B-NP003368, P49765, AAL79001, AAL79000, AAC50721, AAB06274 and AAH08818; VEGF-C-NP005420, P49767, S69207, AAB36425 and CAA6390; NP004460, AAH27948, O43915, CAA03942, and BAA24264; VEGF-E-AAQ88857; VEGF-F-2VPFF; Synthetic structure of B-1FZVB; and PIGF-2-AAB25832 and AAB30462. Preferably, the VEGF is of human origin. However, VEGF from other species, such as mice, can also be used according to the present invention.

The term "white adipose tissue phase cells" or "white adipocytes" as used herein refers to adipocytes that are polyhedral to spherical and contain large, "unicompartmental" lipid droplets surrounded by a thin layer of cytoplasm type. The nuclei of the cells are flat and peripherally located. The diameter of white adipocytes ranged between 30 and 70 μm depending on the depot site. Stored fat is in a semi-liquid state and consists mainly of triglycerides and cholesterol esters. White adipocytes secrete a variety of peptides and proteins collectively referred to as adipokines, such as resistin, adiponectin, and leptin.

The term "woodchuck hepatitis virus post-transcriptional regulatory element" or "WPRE" as used herein refers to a DNA sequence that, when transcribed, produces tertiary structure capable of enhancing gene expression. See Lee Y et al, Exp. Physiol. 2005; 90(1):33-37 and Donello J et al, J. Virol. 1998; 72(6):5085-5092.

The term "microRNA" or "miRNA" as used herein is a small (~22-nt), evolutionarily conserved regulatory RNA involved in RNA-mediated gene silencing at the post-transcriptional level. See Bartel DP. Cell 2004;116:281-297. By base pairing with complementary regions, most often in the 3' untranslated region (3' UTR) of cellular messenger RNA (mRNA), miRNAs can act to inhibit mRNA translation or, in the case of high sequence homology, cause mRNA Catalytic depolymerization. Due to the highly differentiated tissue expression of many miRNAs, cellular miRNAs can be employed to mediate tissue-specific localization of gene therapy vectors. Transgene expression in undesired tissues can be efficiently inhibited by engineered tandem copies of target elements fully complementary to tissue-specific miRNAs (miRTs) within viral vectors.

2. Adeno-associated virus vector providing adipose tissue-specific expression

In a first aspect, the present invention relates to an adeno-associated virus (AAV) vector comprising a recombinant viral genome, wherein the recombinant viral genome comprises an expression cassette comprising adipose tissue operably linked to a polynucleotide of interest specific transcriptional regulatory regions.

AAVs according to the present invention include any of the 42 serotypes of known AAVs. Generally, serotypes of AAV have genomic sequences with significant homology at the amino acid and nucleic acid levels, provide an equivalent set of genetic functions, produce virions that are physically and functionally substantially identical, and replicate and replicate through virtually the same mechanism. assembly. In particular, the AAV of the invention may belong to AAV of serotype 1 (AAV1), AAV2, AAV3 (including types 3A and 3B), AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, avian AAV, bovine Class AAV, canine AAV, equine AAV, ovine AAV and any other AAV. Examples of genomic sequences of different AAV serotypes can be found in the literature or in public databases such as GenBank. See GenBank Accession Nos. AF028704.1 (AAV6), NC006260 (AAV7), NC006261 (AAV8) and AX753250.1 (AAV9). In a preferred embodiment, the adeno-associated viral vector of the invention is a serotype selected from the group consisting of AAV6, AAV7, AAV8 and AAV9 serotypes.

The genome of an AAV according to the invention generally comprises cis-acting 5' and 3' terminal inverted repeats and an expression cassette. See Tijsser P, Ed., "Handbook of Parvoviruses" (CRC Press, Boca Raton, FL, US, 1990, pp. 155-168). The ITR sequence is about 145 bp long. While some minor modification of these sequences is permissible, it is preferred to use substantially the entire sequence encoding the ITR for the molecule. Methods for modifying these ITR sequences are known in the art. See Brown T, "Gene Cloning" (Chapman & Hall, London, GB, 1995), Watson R et al, "Recombinant DNA", 2nd Ed. (Scientific American Books, New York, NY, US, 1992), Alberts B et al, " Molecular Biology of the Cell" (Garland Publishing Inc., New York, NY, US, 2008), Innis M et al., Eds., "PCR Protocols. A Guide to Methods and Applications") Academic Press Inc., San Diego, CA, US, 1990), Erlich H, Ed., "PCR Technology. Principles and Applications for DNA Amplification" (Stockton Press, New York, NY, US, 1989), Sambrook J et al., "Molecular Cloning. A Laboratory Manual" (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, US, 1989), Bishop T, et al., "Nucleic Acid and Protein Sequence. A Practical Approach" (IRL Press, Oxford, GB, 1987), Reznikoff W, Ed., "Maximizing Gene Expression" (Butterworths Publishers, Stoneham, MA, US, 1987), Davis L et al., "Basic Methods in Molecular Biology" (Elsevier Science Publishing Co., New York, NY, US, 1986) and Schleef M, Ed., "Plasmid for Therapy and Vaccination" (Wiley-VCH Verlag GmbH, Weinheim, DE, 2001). In a preferred embodiment, the AAV recombinant genome comprises 5' and 3' AAV ITRs. In another embodiment, the 5' and 3' AAV ITRs are derived from AAV2. In a more preferred embodiment, the AAV recombinant genome lacks the rep open reading frame and the cap open reading frame. In one embodiment, AAV2 ITRs are selected to generate pseudotyped AAVs (ie AAVs with capsids and ITRs derived from different serotypes).

The polynucleotides of the present invention may comprise ITRs derived from any AAV serotype. In a preferred embodiment, the ITR is derived from the AAV2 serotype.

The AAVs of the present invention comprise capsids from any serotype. In a specific embodiment, the capsid is derived from an AAV in the group consisting of: AAV1, AAV2, AAV4, AAV5, AAV6, AAV7, AAV8, and AAV9. In a preferred embodiment, the AAV of the invention comprises a capsid derived from AAV8 or AAV9 serotype. In another preferred embodiment, the VP1 sequence of the AAV capsid has SEQ ID NO. 18 of the Sequence Listing. See GenBank Accession No. AY530579.

In some embodiments, AAV Caps for use in the methods of the present invention may be generated by mutation (ie, by insertion, deletion, or substitution) of one of the above-described AAV Caps or their encoding nucleic acids. In some embodiments, the AAV Cap is at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% similar to one or more of the AAV Caps described above.

In some embodiments, the AAV Cap is chimeric, comprising domains from two, three, four, or more of the aforementioned AAV Caps. In some embodiments, the AAV Cap is a chimera of VP1, VP2, and VP3 monomers derived from two or three different AAVs or recombinant AAVs. In some embodiments, the rAAV composition comprises more than one of the aforementioned Caps.

In some embodiments, AAV Caps used in rAAV compositions are designed to contain heterologous sequences or other modifications. For example, peptide or protein sequences that confer selective localization or immune evasion can be introduced into the Cap protein. Alternatively or additionally, Cap can be chemically modified such that the surface of the rAAV is PEGylated SEQ ID NO. (ie, polyethylene glycol modified), which can facilitate immune evasion. Cap proteins can also be mutagenized (eg, to remove their native receptor binding, or to mask immunogenic epitopes).

In another specific embodiment, the AAV vector is a pseudotyped AAV vector (ie, the vector comprises sequences or components derived from at least two different AAV serotypes). In a specific embodiment, a pseudotyped AAV vector comprises an AAV genome derived from one AAV serotype (eg, AAV2), and a capsid derived at least in part from a different AAV serotype. Specific examples of such pseudotyped AAV vectors include, but are not limited to, vectors comprising a genome derived from any AAV serotype (eg, from AAV1 to AAV11) in a capsid derived from AAV6, AAV7, AAV8, or AAV9.

In one embodiment, the AAV vector comprises a promoter into which at least one target sequence of at least one miRNA is added, the miRNA may be selected from the following list: miR122 (miRBase database accession number MI0000442), miR152 (MI0000462), miR199 (MI0000242)、miR215(MI0000291)、miR192(MI0000234)、miR148a(MI0000253)、miR194(MI0000488)、miR1(MI0000651)、miRT133(MI0000450)、miR206(MI0000490)、miR208(MI0000251)、miR124(MI0000443)、miR125 (MI0000469), miR216 (MI0000292), miR130 (MI0000448). Reference sequences have been obtained from miRBase (version according to 31/07/2013, http://www.mirbase.org/).

In one embodiment the AAV vector contains a promoter into which is added at least one miRNA target sequence that can be selected from the following list:

List 1

miRT122a(5'CAAACACCATTGTCACACTCCA3'),

miRT152(5'AGTCACGTACTGTCTTGAACC3'),

miR199a-5p (5'GGGTCACAAGTCTGATGGACAAG3'),

miR99a-3p (5'TGTCATCAGACGTGTAACCAAT3'),

miRT215(5'TACTGGATACTTAACTGTCTG3'),

miRT192(5'GGCTGTCAATTCATAGGTCAG3'),

miRT194(5'ACATTGTCGTTGAGGTACACCT3'),

miRT1(5'TTACATACTTCTTTACATTCCA3'),

mirT148(5'AGTCACGTGATGTCTTGAAACA3'),

mirT133a (5'AAACCAGGGGAAGTTGGTCGAC3'),

miRT206(5'ACCTTACATTCCTTCACACACC3'),

miRT124(5'ATTCCGTGCGCCACTTACGG3'),

miRT125(5'AGGGACTCTGGGAAATTGGACACT3'),

miRT216(5'ATTAGAGTCGACCGTTGACACT3'),

miRT130 (5'GTCACGTTACAATTTTCCCGTA3').

In one embodiment the AAV vector contains a promoter into which at least one miRNA target sequence having 85% homology to a miRNA target sequence selected from List 1 mentioned above is added.

In one embodiment the AAV vector contains a promoter into which is added at least one miRNA target sequence that is functionally equivalent to a miRNA target sequence selected from List 1 mentioned above. In this context, the term functional equivalent refers to any nucleotide sequence capable of binding to the same miRNA that binds to the original sequence. For example, a functional equivalent of mirT122a is any sequence that hybridizes to the same miRNA that hybridizes to mirT122a.

A functionally equivalent nucleotide sequence retains the relevant biological activity of the reference mirT sequence. This means that the functional equivalent of mirT has the ability to inhibit transgene expression in undesired tissues in the same manner as the reference mirT sequence.

In another specific embodiment, the miRNA target sequence can be selected from mirT122a (5'CAAACACCATTGTCACACTCCA3'), with reference to SEQ ID NO: 19 of the Sequence Listing or mirT1 (5'TTACATACTTCTTTACATTCCA3'), with reference to the SEQ ID NO: 20 of the Sequence Listing .

Transcriptional regulatory regions may comprise promoters, and optionally enhancer regions. Preferably, the promoter is specific for adipose tissue. Enhancers need not be specific for adipose tissue. Alternatively, the transcriptional regulatory region may comprise an adipose tissue-specific promoter and an adipose tissue-specific enhancer.

In one embodiment, the tissue-specific promoter is an adipocyte-specific promoter, such as adipocyte protein 2 (aP2, also known as fatty acid binding protein 4 (FABP4)), PPARy promoter, adiponectin promoter, Phosphoenolpyruvate carboxykinase (PEPCK) promoter, derived from the human aromatase cytochrome p450 (p450arom), or the Foxa-2 promoter. See Graves R et al, Genes Dev. 1991; 5:428-437, Ross S et al, Proc. Natl. Acad. Sci. USA 1990; 87: 9590-9594, Simpson E et al, US 5,446,143, Mahendroo M et al, J. Biol Chem. 1993; 268: 19463-19470, Simpson E et al. Clin. Chem. 1993; 39: 317-324 and Sasaki H et al. Cell 1994; 76: 103-115. In a preferred embodiment, the enhancer region is selected from the group consisting of the fat-specific aP2 enhancer and the fat-specific UCP1 enhancer.

In a preferred embodiment, the adipose tissue-specific regulatory region of the AAV according to the present invention comprises an adipose-specific aP2 enhancer and an aP2 basal promoter (basal ap2 promoter). See Rival Y et al., J. Pharmacol. Exp. Ther. 2004:311(2):467-475. This region comprising the fat-specific aP2 enhancer and the aP2 basic promoter is also referred to as the "mini/aP2 regulatory region" and is formed by the basic promoter of the aP2 gene and the fat-specific enhancer of the aP2 gene. Preferably, the aP2 promoter is murine. See Graves R et al, Mol. Cell Biol. 1992; 12(3): 1202-1208 and Ross S et al, Proc. Natl. Acad. Sci. USA 1990; 87:9590-9594. In a specific embodiment, the mini/aP2 regulatory region has the sequence of SEQ ID NO:2 of the Sequence Listing.

In another preferred embodiment, the adipose tissue-specific regulatory region of the AAV according to the present invention comprises an adipose-specific UCP1 enhancer and a UCP1 basal promoter (basal UCP1 promoter). See del Mar González-Barroso M et al, J. Biol. Chem. 2000; 275(41):31722-31732 and Rim J et al, J. Biol. Chem. 2002; 277(37):34589-34600. This region comprising the fat-specific UCP1 enhancer and the UCP1 base promoter is also referred to as the "mini/UCP regulatory region" and refers to the combination of the base promoter of the UCP1 gene and the fat-specific enhancer of the UCP1 gene. The rat UCP1 promoter is preferably used. See Larose M, et al, J. Biol. Chem. 1996; 271(49): 31533-31542 and Cassard-Doulcier A et al, Biochem. J. 1998; 333: 243-246. In a specific embodiment, the mini/UCP1 regulatory region has the sequence of SEQ ID NO:3 of the Sequence Listing.

In another embodiment, the expression cassettes that form part of the AAVs of the invention further comprise expression control sequences including, but not limited to, appropriate transcription sequences (ie initiation, termination, promoters and enhancers), efficient RNA processing Signals (e.g., splicing and polyadenylation (polyA) signals), sequences that stabilize cytoplasmic mRNA, sequences that enhance translation efficiency (ie, Kozak consensus sequences), sequences that enhance protein stability, and, when desired, encoded products the secretory sequence. A wide variety of expression control sequences, including native, constitutive, inducible, or tissue-specific promoters, are known in the art and can be utilized in accordance with the present invention.

In another embodiment, the expression cassette forming part of the AAV of the invention further comprises a post-transcriptional regulatory region. In preferred embodiments, the post-transcriptional regulatory region is the woodchuck hepatitis virus post-transcriptional region (WPRE) or functional variants and fragments thereof, and PPT-CTS or functional variants and fragments thereof. See Zufferey R et al, J. Virol. 1999;73:2886-2892 and Kappes J et al, WO 2001/044481. In a specific embodiment, the post-transcriptional regulatory region is WPRE.

An expression cassette forming part of an AAV according to the invention comprises a "polynucleotide of interest". In a preferred embodiment, the polynucleotide of interest encodes a protein that acts throughout the body. In another embodiment, the polynucleotide of interest encodes a protein that acts on adipocytes or regions near them. In a preferred embodiment, the protein acting on the adipocyte or its vicinity is a hexokinase (HK), including any four mammalian species that differ in subcellular location and kinetics relative to different substrates HK isozyme (EC 2.7.1.1). For example, HK includes HK1 (GenBank Accession No. NP000179, NP277031, NP277032, NP277033, NP277035), HK2 (GenBank Accession No. NP000180), HK3 (GenBank Accession No. NP002106) and HK4 or glucokinase (GenBank Accession No. NP000153, NP277042, NP277043) ). In another preferred embodiment, HK is glucokinase, which is used interchangeably herein with hexokinase 4 or HK 4 and refers to a Km with glucose 100 times higher than HK1, HK2, or HK3 isoforms of hexokinase.

In embodiments, the protein acting on the adipocyte or its vicinity is alkaline phosphatase (AP), including but not limited to intestinal or IAP (GenBank Accession No. NP001622), placental or PLAP (GenBank Accession No. NP001623) ) and the non-tissue specific isozyme or ALPL (GenBank accession numbers NP000469, NP001120973.2 and NP001170991.1). In another embodiment, the protein acting on the adipocyte or its vicinity is VEGF, including but not limited to VEGF variants A, B, C, D, E and F.

In another embodiment, the polynucleotide of interest encodes a polypeptide that is normally produced and secreted by adipocytes. In another embodiment, the polypeptide produced and secreted by an adipocyte is a lipase (eg, in particular, a lipase of a serine protease homolog), adiponectin, leptin, resistin, or of an ob gene protein product.

Other also useful polynucleotides of interest include those encoding hormones and growth and differentiation factors, including, but not limited to, insulin, glucagon, growth hormone (GH), parathyroid hormone (PTH), growth hormone releasing factor (GRF), Follicle Stimulating Hormone (FSH), Luteinizing Hormone (LH), Human Chorionic Gonadotropin (hCG), Angiopoietin, Angiostatin, Granulocyte Colony Stimulating Factor (GCSF), Erythropoietin ( EPO), connective tissue growth factor (CTGF), basic fibroblast growth factor (bFGF), acidic fibroblast growth factor (aFGF), epidermal growth factor (EGF), platelet-derived growth factor (PDGF), insulin growth factor I and II (IGF-I and TGF-II), any of the transforming growth factor superfamily, including any of TGFa, activin, inhibin, or bone morphogenetic protein (BMP) BMPs 1-15 , any of the heregluin/neuregulin/ARIA/Neu differentiation factor (NDF) family of growth factors, nerve growth factor (NGF), brain-derived neurotrophic factor (BDNF) , neurotrophin NT-3 and NT-4/5, ciliary neurotrophic factor (CNTF), glial cell-derived neurotrophic factor (GDNF), nerve growth factor (neurturin), aggregated protein (agrin), arm plate Any of the semaphorins/collapsin family, neurite guidance factor (netrin)-1 and neurite guidance factor-3, hepatocyte growth factor (HGF), ephrin, noggin , sonic hedgehog and tyrosine hydroxylase.

Other useful polynucleotides of interest include those encoding proteins that modulate the immune system, including, but not limited to, cytokines and lymphokines such as thrombopoietin (TPO), interleukin (IL), IL-1 to IL-25 (eg IL-2, IL-4, IL-12 and IL-18), monocyte chemoattractant protein, leukemia inhibitory factor, granulocyte-macrophage colony stimulating factor, Fas ligand, tumor necrosis factor Alpha and beta, interferon alpha, beta and gamma, stem cell factor, flk-2/flt3 ligand. Gene products produced by the immune system are also useful in the present invention. These include, but are not limited to, immunoglobulins IgG, IgM, IgA, IgD and IgE, chimeric immunoglobulins, humanized antibodies, single chain antibodies, T cell receptors, chimeric T cell receptors, single chain T cells Receptors, Class I and II MHC and HLA molecules, and engineered immunoglobulins and MHC and HLA molecules. Useful gene products also include complement regulatory proteins, such as complement regulatory proteins, membrane cofactor protein (MCP), decay accelerating factor (MCP), CR1, CF2, and CD59.

Other useful polynucleotides of interest include those encoding receptors for any of hormones, growth factors, cytokines, lymphokines, regulatory proteins, and immune system proteins. The present invention encompasses receptors for cholesterol regulation or lipid regulation, including low density lipoprotein (LDL) receptors, high density lipoprotein (HDL) receptors, very low density lipoprotein (VLDL) receptors and scavenger receptors body. Inventive numbers also encompass gene products, such as members of the general family of steroid hormone receptors that include glucocorticoid and estrogen receptors, vitamin receptors, and other nuclear receptors. In addition, useful gene products include transcription factors such as jun, fos, max, mad, serum effector factor (SRF), AP1, AP2, myb, MyoD and myogenin, ETS-box containing protein ), TFE3, E2F, ATF1, ATF2, ATF3, ATF4, ZF5, NFAT, CREB, HNF-4, C/EBP, SP1, CCAAT-box binding protein, interferon regulatory factor (IRF-1) ), Wilms tumor proteins, ETS binding proteins, STAT, GATA box binding proteins (eg GATA-3) and the forkhead family of winged helix proteins.

Other useful polynucleotides of interest include those encoding enzymes such as carbamoyl synthase I, ornithine transcarbamylase, argininosuccinate synthase, argininosuccinate lyase, arginine Enzymes, fumaric acetoacetate hydrolase, phenylalanine hydroxylase, alpha-1 antitrypsin, glucose-6-phosphatase, porphobilinogen deaminase, cystathione beta-synthase, Branched-chain ketoacid decarboxylase, albumin, isovaleryl-CoA dehydrogenase, propionyl-CoA carboxylase, methylmalonyl-CoA mutase, glutaryl-CoA dehydrogenase, insulin, β-glucosidase, pyruvate carboxylate, liver phosphorylase, phosphorylase kinase, glycine decarboxylase, H protein, T protein, cystic fibrosis transmembrane regulator (CFTR) sequence and Dystrophin (dystrophin) gene product (eg, dystrophin mini or dystrophin mini). Also useful gene products include enzymes for replacement therapy, such as, for example, mannose-6-phosphate-containing enzymes (eg, encoding beta-glucuronidase (GUSB) for the treatment of lysosomal storage diseases) suitable genes).

Packaging size constraints for AAV vectors are limited to the size of the maternal wild-type AAV genome, which is in the range of sizes based on AAV serotypes (ie, 4087 to 4767). See Wu Z et al., Mol. Ther. 2010;7(1):80-86. For example, wild-type AAV02 has a genome size of 4679 and wild-type AAV-6 has a genome size of 4683. In some embodiments, the cloning capacity of the recombinant RNA vector may be limited and the desired coding sequence may involve a complete replacement of the 4.8 kilobase genome of the virus. Therefore large genes may not be suitable for standard recombinant AAV vectors in some cases. The skilled artisan will appreciate that options for overcoming the limited coding capacity are available in the art. For example, AAV ITRs of two genomes can be annealed to form head-to-tail concatamers, nearly doubling the capacity of the vector. The insertion of the splice site allows the removal of the ITR from the transcript. Other options for overcoming limited cloning capacity will be apparent to the skilled person.

3. Therapeutic methods based on the tropism of AAV6, AAV7, AAV8 and AAV9 for adipose tissue

In a second aspect, the present invention discloses adeno-associated viral vectors of AAV6, AAV7, AAV8 and AAV9 serotypes capable of efficiently transducing adipose tissue cells. This feature enables the development of methods for treating diseases that require or can benefit from the expression of polynucleotides of interest in adipocytes. In particular, this discovery facilitates delivery of a polypeptide of interest to a subject in need thereof by administering an AAV vector of the present invention to a patient, thereby generating adipocytes capable of expressing a polynucleotide of interest and encoding the polypeptide in vivo. If the encoded polypeptide is a secreted polypeptide, it can be secreted by adipocytes, allowing for systemic delivery of the polypeptide in this manner.

Accordingly, in another embodiment, the present invention provides an adeno-associated virus vector comprising a recombinant viral genome for the treatment or prevention of a disease requiring expression of a polynucleotide of interest, wherein the recombinant viral genome comprises An expression cassette comprising a transcriptional regulatory region operably linked to the polynucleotide of interest, wherein the AAV serotype is selected from the group consisting of AAV6, AAV7, AAV8 and AAV9.

In another embodiment, the present invention provides an adeno-associated virus vector comprising a recombinant viral genome comprising an expression cassette for the treatment or prevention of a disease requiring expression of the polynucleotide of interest , the expression cassette comprises an adipose tissue-specific transcriptional regulatory region operably linked to the polynucleotide of interest.

In another embodiment, the present invention provides a method for the treatment or prevention of a disease requiring expression of a polynucleotide of interest in a subject, comprising administering to the subject an adeno-associated viral vector, which The adeno-associated virus vector comprises a recombinant viral genome, wherein the recombinant viral genome comprises an expression cassette comprising a transcriptional regulatory region operably linked to a polynucleotide of interest, wherein the AAV serotype is selected from AAV6, AAV7 , AAV8 and AAV9.

In another embodiment, the present invention provides a method for the treatment or prevention of a disease requiring expression of a polynucleotide of interest in a subject, comprising administering to the subject an adeno-associated viral vector, the The adeno-associated viral vector comprises a recombinant viral genome, wherein the recombinant viral genome comprises an expression cassette comprising an adipose tissue-specific transcriptional regulatory region operably linked to a polynucleotide of interest.

AAVs for use in the therapeutic methods of the present invention comprise expression cassettes containing the polynucleotide of interest and transcriptional regulatory regions. Transcriptional regulatory regions may comprise promoters, and optionally enhancer regions.

In one embodiment, the transcriptional regulatory region allows for constitutive expression of the polynucleotide of interest. Examples of constitutive promoters include, but are not limited to, retroviral Rous sarcoma virus (RSV) LTR promoter (optionally with RSV enhancer), cytomegalovirus (CMV) promoter (optionally with CMV enhancer) ), SV40 promoter, dihydrofolate reductase promoter, β-actin promoter, glycerophosphokinase (PGK) promoter and EFla promoter. See Boshart M et al. Cell 1985;41:521-530.

In another embodiment, the transcriptional regulatory region comprises a beta-actin promoter. The beta-actin promoter can be derived from any mammal, including humans and rodents, or avian, including chickens. Preferably chicken beta-actin is used.

In yet another embodiment, the transcriptional regulatory region further comprises an enhancer region. Preferably, the enhancer region is a CMV enhancer region.

In a specific embodiment, the regulatory region is a CAG regulatory region. In a preferred embodiment, the CAG regulatory region has the sequence of SEQ ID NO: 1 of the Sequence Listing.

In another embodiment, the transcriptional regulatory region is an adipose tissue-specific transcriptional regulatory region.

If the promoter is specific for adipose tissue, the enhancer need not also be specific for adipose tissue. Alternatively, the transcriptional regulatory region may comprise an adipose tissue-specific promoter and an adipose tissue-specific enhancer.

In one embodiment, the tissue-specific promoter is an adipocyte-specific promoter, such as, eg, adipocyte protein 2 (aP2, also known as fatty acid binding protein 4 (FABP4)), PPARy promoter, adiponectin promoter promoter, the phosphoenolpyruvate carboxykinase (PEPCK) promoter, which is derived from the human aromatase cytochrome p450 (p450arom) and Foxa-2 promoters. See Graves (1991), Ross (1990), Simpson (US 5,446,143), Mahendroo (1993), Simpson (1993) and Sasaki (1994), supra.

In one embodiment, the enhancer region is selected from the group consisting of a fat-specific aP2 enhancer and a fat-specific UCP1 enhancer.

In a preferred embodiment, the adipose tissue-specific regulatory region of the AAV according to the present invention comprises an adipose-specific aP2 enhancer and a basal murine aP2 promoter (basal murine aP2 promoter). In a specific embodiment, the mini/aP2 regulatory region has the sequence of SEQ ID NO:2 of the Sequence Listing.

In another preferred embodiment, the adipose tissue-specific regulatory region of the AAV according to the present invention comprises an adipose-specific UCP1 enhancer and a rat UCP1 basal promoter (basal rat UCP1 promoter). In a specific embodiment, the mini/UCP1 regulatory region has the sequence of SEQ ID NO:3 of the Sequence Listing.

In another embodiment, the expression cassette further comprises a post-transcriptional regulatory region. In preferred embodiments, the post-transcriptional regulatory regions are WPRE or functional variants and fragments thereof, and PPT-CTS or functional variants and fragments thereof.

Other suitable polynucleotides of interest can be used with the AAV vectors of the invention and for the treatment or prevention of disease. See Table 1.

Table 1

polynucleotide of interest

The term "disease requiring expression of a polynucleotide of interest" as used herein refers to any disease in which expression of a polynucleotide of interest is desired. A polynucleotide of interest as described herein can be a gene encoding a polypeptide of interest, or alternatively, a nucleic acid sequence that, when transcribed, produces a molecule capable of modulating the expression of an endogenous polynucleotide in a cell. Thus, a disease requiring expression of a polynucleotide of interest may be a disease in which it is desired to increase or decrease the expression level of a gene.

In addition, the polynucleotide of interest can encode a protein that is secreted and acts throughout the body, or a protein that acts on adipocytes or their vicinity. In a specific embodiment, the disease requiring expression of the polynucleotide of interest is a disease requiring expression of the polynucleotide of interest in adipose tissue, more preferably in white adipose tissue or brown adipose tissue.

Examples of diseases requiring expression of the polynucleotide of interest include, but are not limited to, obesity, hyperglycemia, insulin resistance, type 2 diabetes, hypertension, cancer, heart disease, immune diseases, arthritis, central nervous system diseases and aging-related diseases.

The AAVs of the invention have proven useful for gene therapy of adipose tissue-related diseases, such as the delivery of hexokinase mediated by the AAVs of the invention in both WAT and BAT to increase basal glucose uptake. See Figures 2D and 4B. Thus in particular embodiments, the disease requiring modulation of expression of the polynucleotide of interest is a disease selected from the group consisting of obesity, hyperglycemia, insulin resistance, type 2 diabetes and hypertension.

Exemplary genes and associated disease states include, but are not limited to, insulin for treatment of diabetes, CFTR for treatment of cystic fibrosis, factor IX for treatment of hemophilia B, treatment for Factor VIII, glucose-6-phosphatase in hemophilia A (hemophilia A), associated with hepatoglycososis type 1A; phosphoenolpyruvate-carboxylase, associated with Pepck deficiency; galactose-1-phosphate Uridyltransferase, associated with galactosemia; phenylalanine hydroxylase, associated with phenylketonuria; branched-chain alpha-keto acid dehydrogenase, associated with maple syrup urine disease; hydrolysis of fumarylacetoacetate Enzymes, associated with type 1 tyrosinemia; methylmalonyl-CoA mutase, associated with methylmalonic acidemia; medium-chain acyl-CoA dehydrogenase, associated with medium-chain acyl-CoA deficiency ornithine carbamyltransferase, associated with ornithine carbamyltransferase deficiency; argininosuccinate synthase, associated with citrullinemia; low-density lipoprotein receptor protein, associated with the family associated with hypercholesterolemia; UDP-glucouronosyltransferase, associated with Crigler-Najjar disease; adenylate deaminase, associated with severe combined immunodeficiency Disease-related; hypoxanthine guanine phosphorylated nucleoside transferase, associated with gout (Gout) and Lesch-Nyan syndrome; biotinidase, associated with biotinidase deficiency; β-glucocerebrosidase, associated with high β-glucuronidase associated with Sly syndrome; peroxisomal membrane protein 70 kDa associated with Zellweger syndrome; porphyrinogen deaminase associated with acute intermittent porphyrin alpha-1 antitrypsin, used to treat alpha-1 antitrypsin deficiency (emphysema); erythropoietin, used to treat anemia due to thalassemia or renal failure; vascular endothelial growth factor, angiogenesis Thrombomodulin-1 and fibroblast growth factor for the treatment of ischemic diseases; thrombomodulin and tissue factor pathway inhibitors for the treatment of occlusions as seen in, eg, atherosclerosis, thrombosis, or embolism Vascular; aromatic amino acid decarboxylase (AADC) and tyrosine decarboxylase (TH), used in the treatment of Parkinson's disease; beta-adrenergic receptors, antisense or mutant forms of phosphoproteins, sarcoplasmic (endoplasmic) ) Reticulo-ATPase-2 (SERCA2) and cardiac adenylate cyclase, used to treat congestive heart failure; tumor suppressor genes, such as p53, used to treat various cancers; cytokines, such as various leukocytes One of interleukins used in the treatment of inflammatory and immune dysfunction and cancer; dystrophin or minidystrophin and utrophin or miniutrophin used in treatment muscular dystrophy; adenosine deaminase (ADA), with for the treatment of adenosine deaminase (ADA) deficiency; huntingtin protein (HTT) for the treatment of Huntington's disease; low-density lipoprotein receptor (LDLR) or apolipoprotein B (APOB) for the treatment of familial high blood pressure Cholesterolemia; phenylalanine hydroxylase (PAH), used to treat phenylketonuria; polycystic kidney disease 1 (PKD1) and polycystic kidney disease 2 (PKD2), used to treat polycystic nephropathy; TNFR:Fc, used to treat arthritis; AAT, used to treat hereditary emphysema; sarcoglycan, used to treat muscular dystrophy; GAD65 or GAD67, used to treat Parkinson's disease, AAC, For the treatment of Canava's disease, CLN2, for the treatment of Batten's disease, NGF, for the treatment of Alzheimer's disease; VEGF antagonist, for the treatment of macular degeneration; IGF/HGF, for the treatment of congestive heart failure, NGF, for the treatment of central nervous system disorders; and neutralizing antibodies against HIV, for the treatment of HIV, HIV infection, or AIDS.

Examples of polynucleotides of interest that can be delivered by the AAVs of the present invention include, but are not limited to, hexokinase, glucokinase, UCP2, UCP3, PPAR-alpha, leptin, leptin receptor OB-Rb, and GLP- 1. In particular embodiments, the gene of interest is selected from the group consisting of hexokinase (HK), glucokinase (GK), alkaline phosphatase (AP) and vascular endothelial growth factor (VEGF). In another embodiment, an AAV of the invention comprising a polynucleotide expressing hexokinase or glucokinase is administered to a subject in need thereof for the treatment or prevention of type 2 diabetes. In another embodiment, an AAV of the invention comprising a vascular endothelial growth factor-expressing polynucleotide is administered to a subject in need thereof for the treatment or prevention of obesity.

Exemplary, but non-limiting examples of diseases that can be treated with the methods of the present invention include obesity, hyperglycemia, insulin resistance, type 2 diabetes, hypertension, and high arterial pressure. Preferably, type 2 diabetes can be treated by expressing leptin in the region near fat cells or throughout the body so that it reaches the hypothalamus.

Furthermore, the AAVs of the present invention have been shown to be useful for genetic engineering of BAT, as internal iBAT administration of VEGF164 via AAV 9-mini/UCP1 resulted in increased levels of total VEGF expression and increased number of blood vessels in iBAT. See Figures 4C-4F. Thus, in certain embodiments, the present invention relates to AAVs or pharmaceutical compositions of the present invention for use in the treatment or prevention of diseases requiring VEGF expression, eg, the management of which may benefit from induction of angiogenesis, arteriogenesis, or angiogenesis of that disease. Examples of diseases requiring expression of VEGF include, but are not limited to, acute surgical and traumatic wounds, burns, scalds, venous ulcers, arterial ulcers, pressure sore (aka decubitusulcer), diabetic Ulcers, post-radiation wounds, skin grafts, ulcers of mixed etiology, and other chronic or necrotizing wounds.

Furthermore, internal eWAT administration of the hSeAP gene (ie, secreted alkaline phosphatase derived from human placenta) with the AAV9-mini/aP2 viral vector resulted in a sustained increase in circulating levels of hSeAP. Accordingly, in a specific embodiment, the present invention relates to AAVs or pharmaceutical compositions of the present invention for use in the treatment or prevention of diseases requiring expression of AP, LPS (ie lipopolysaccharide) mediated or exacerbated diseases. Examples of diseases requiring expression of AP include, but are not limited to, inflammatory bowel disease, sepsis or septic shock, systemic inflammatory response syndrome (SIRS), meningococcalemia, traumatic hemorrhagic shock, hum injury , cardiovascular surgery or cardiopulmonary bypass, liver surgery or transplantation, liver disease, pancreatitis, necrotizing enterocolitis, periodontal disease, pneumonia, cystic fibrosis, asthma, coronary heart disease, congestive heart failure, kidney disease, Hemolytic uremic disease, renal dialysis, cancer, Alzheimer's disease and autoimmune diseases such as rheumatoid arthritis and systemic lupus erythematosus.

4. Methods for transducing cells in vitro

In a third aspect, the present invention relates to a method for transducing cells in vitro by using the AAV vector of the present invention. Accordingly, the present invention also relates to a method for transducing cells in vitro, comprising contacting said cells with an AAV comprising a recombinant viral genome comprising an expression cassette comprising a polynucleotide of interest Acid operably linked adipose tissue-specific transcriptional regulatory region.

In a preferred embodiment, the adeno-associated viral vector used in the method of transducing cells in vitro has a serotype selected from the group consisting of AAV6, AAV7, AAV8 and AAV9 serotypes. In another embodiment, the adeno-associated virus ITR is AAV2 ITR.

In another embodiment, the adeno-associated viral vector comprises an adipose tissue-specific transcriptional regulatory region. In yet another embodiment, the adipose tissue-specific transcriptional regulatory region comprises a promoter region selected from the group consisting of a murine aP2 basal promoter and a rat UCP1 basal promoter. In yet another embodiment, the adipose tissue-specific transcriptional regulatory region further comprises an enhancer region operably linked to the promoter region. In yet another embodiment, the enhancer region is selected from the group consisting of a fat-specific aP2 enhancer and a fat-specific UCP1 enhancer. In a more preferred embodiment, the adipose tissue-specific transcriptional regulatory region is selected from the group consisting of:

i) a polynucleotide comprising a fat-specific aP2 enhancer and a murine aP2 basic promoter and

ii) A polynucleotide comprising a fat-specific UCP1 enhancer and a rat UCP1 basal promoter.

In another embodiment, the expression cassette further comprises a post-transcriptional regulatory region. In yet another embodiment, the post-transcriptional regulatory region is WPRE.

In another embodiment, the polynucleotide of interest encodes a protein selected from the group consisting of a secreted protein that acts throughout the body and a protein that acts on the adipocyte or its vicinity. In a more preferred embodiment, the polynucleotide of interest encodes a protein selected from the group consisting of hexokinase, glucokinase, alkaline phosphatase and vascular endothelial growth factor.

In another embodiment, the present invention relates to a method for in vitro transduction of cells with AAV comprising a recombinant viral genome comprising an expression cassette that is operable with a polynucleotide of interest A tightly linked transcriptional regulatory region, wherein the AAV serotype is selected from the group consisting of AAV6, AAV7, AAV8, and AAV9.

In one embodiment, the adeno-associated virus ITR is AAV2 ITR.

In another embodiment, the adeno-associated viral vector comprises a recombinant genome containing transcriptional regulatory regions. In one embodiment, the transcriptional regulatory region is a constitutive promoter. In a preferred embodiment, the constitutive transcriptional regulatory region comprises an actin promoter. In yet another embodiment, the constitutive transcriptional regulatory region further comprises an enhancer region operably linked to the promoter region. In a more preferred embodiment, the enhancer region is a cytomegalovirus enhancer.

In one embodiment, the transcriptional regulatory region is an adipose tissue-specific transcriptional regulatory region. In yet another embodiment, the adipose tissue-specific transcriptional regulatory region comprises a promoter region selected from the group consisting of a murine aP2 basal promoter and a rat UCP1 basal promoter. In yet another embodiment, the adipose tissue-specific transcriptional regulatory region further comprises an enhancer region operably linked to the promoter region. In yet another embodiment, the enhancer region is selected from the group consisting of a fat-specific aP2 enhancer and a fat-specific UCP1 enhancer. In a more preferred embodiment, the adipose tissue-specific transcriptional regulatory region is selected from the group consisting of:

i) a polynucleotide comprising a fat-specific aP2 enhancer and a murine aP2 basic promoter and

ii) A polynucleotide comprising a fat-specific UCP1 enhancer and a rat UCP1 basal promoter.

In another embodiment, the expression cassette further comprises a post-transcriptional regulatory region. In yet another embodiment, the post-transcriptional regulatory region is WPRE.

In another embodiment, the polynucleotide of interest encodes a protein selected from the group consisting of a secreted protein that acts throughout the body and a protein that acts on the adipocyte or its vicinity. In a more preferred embodiment, the polynucleotide of interest encodes a protein selected from the group consisting of hexokinase, glucokinase, alkaline phosphatase, and vascular endothelial growth factor.

Any cell can be transduced using the in vitro methods of the present invention. In a specific embodiment, AAV is used to transduce adipose tissue cells. In a more preferred embodiment, the adipose tissue cells are brown adipocytes or white adipocytes.

When performing the in vitro method for transducing cells according to the present invention to transduce white adipocytes, the transcriptional regulatory region within the AAV preferably comprises the mini/aP2 regulatory region. In another embodiment, when performing the in vitro method for transducing cells according to the present invention to transduce brown adipocytes, the transcriptional regulatory region within the AAV preferably comprises an expression cassette comprising the mini/UCP1 regulatory region .

In another aspect of the invention, to improve transgene expression obtained from the mini/aP2 and mini/UCP1 promoters, the CAG promoter was used in combination with tissue-specific miRNA target sequences to obtain high expression levels in adipose tissue and Off-target transgene expression in off-target organs. This leads to further enhancement of the potential of AAV vectors to genetically modify adipose tissue when administered locally or systemically.

In a further embodiment, the present invention relates to methods for isolating cells transduced in vivo by using the AAV vectors of the present invention and culturing them in vitro. In another embodiment, the present invention relates to the isolated transduced cells as well as the cells and pharmaceutical compositions comprising them.

5. Transduced adipocytes and adipocyte cell compositions, ex vivo methods of treatment

In a fourth aspect, the present invention relates to adipocytes obtained by the in vitro method of the present invention. In another embodiment, the present invention relates to a cellular composition comprising adipocytes obtained according to the method of the present invention. Furthermore, the present invention also relates to adipocytes or adipocyte cell compositions comprising the genome of the AAV according to the present invention. Preferably, at least 50% of the cellular composition comprises adipocytes according to the present invention. More preferably, at least 60%, 70%, 80%, 90%, 95% and 100% of the cellular composition comprise adipocytes according to the present invention.

As described above, the AAVs of the present invention can be used to transduce cells in vitro to introduce a polynucleotide of interest into the cells. The transduced cells can then be implanted in humans or animals to achieve the desired therapeutic effect.

Thus, in another embodiment, the present invention relates to adipocytes or cell compositions comprising adipocytes obtained according to the method of the present invention for use in medicine.

In another embodiment, the present invention relates to adipocytes or cellular compositions comprising adipocytes obtained according to the methods of the present invention for use in the treatment of diseases requiring expression of a polynucleotide of interest.

In another embodiment, the present invention relates to a method for treating or preventing a disease, comprising administering to a subject in need thereof an adipocyte or cellular composition obtained according to the method of the present invention. Examples of diseases that can be addressed by this approach have been defined above in the context of the AAV of the present invention.

6. Polynucleotides, Vectors and Plasmids

In a fifth aspect, the present invention relates to polynucleotides useful for producing AAVs according to the present invention. Accordingly, in another embodiment, the present invention relates to a polynucleotide ("polynucleotide of the present invention") comprising an expression cassette flanked by an adeno-associated virus ITR, wherein the expression cassette comprises an An adipose tissue-specific regulatory region to which a polynucleotide is operably linked.

In a preferred embodiment, the adipose tissue-specific regulatory region comprises a promoter region selected from the group consisting of a murine aP2 basal promoter and a rat UCP1 basal promoter.

In another embodiment, the adipose tissue-specific regulatory region further comprises an enhancer region operably linked to the promoter region. In a more preferred embodiment, the enhancer region is selected from the group consisting of a fat-specific aP2 enhancer and a fat-specific UCP1 enhancer.

In another embodiment, the regulatory region is selected from the group consisting of:

i) a polynucleotide comprising a fat specific aP2 enhancer and a murine aP2 basic promoter and

ii) A polynucleotide comprising a fat-specific UCP1 enhancer and a rat UCP1 basal promoter.

In another embodiment, the expression cassette of the polynucleotide of the invention further comprises post-transcriptional regulatory elements. In yet another embodiment, the post-transcriptional regulatory region is a WPRE.

In another embodiment, the polynucleotide of interest comprised in the polynucleotides of the present invention encodes a protein selected from the group consisting of hexokinase, glucokinase, alkaline phosphatase, and vascular endothelial growth factor.

The polynucleotides of the present invention can be conjugated to a vector such as, for example, a plasmid. Accordingly, in further embodiments, the present invention relates to vectors or plasmids comprising the polynucleotides of the present invention. According to the present invention, the terms "vector" and "plasmid" are interchangeable.

In specific embodiments, the polynucleotides of the invention are conjugated to adeno-associated viral vectors or plasmids. Preferably, all other structural and non-structural coding sequences required for adeno-associated virus production are not present in the viral vector, as they can be passed through another vector, such as a plasmid, or by stably binding the sequences to a packaging cell line, Provided in trans.

The polynucleotides of the present invention can be obtained using molecular biology techniques known in the art. See Brown (1995), Watson (1992), Alberts (2008), Innis (1990), Erlich (1989), Sambrook (1989), Bishop (1987), Reznikoff (1987), Davis (1986) and Schleef, supra (2001). In another embodiment, the present invention relates to an AAV vector, wherein the genome comprises a polynucleotide of the present invention.

7. Methods for obtaining AAV

In a sixth aspect, the present invention relates to a method for obtaining the AAV of the present invention. The AAV can be obtained by introducing a polynucleotide of the invention into cells constitutively expressing rep and cap. Therefore, in another embodiment, the present invention relates to a method for obtaining an adeno-associated viral vector, comprising the steps of:

i) providing a cell comprising a polynucleotide of the invention flanked by an AAV ITR, an AAV cap protein, an AAV rep protein or a viral or cellular protein on which AAV depends for replication,

ii) maintaining the cell under conditions suitable for AAV assembly, and

iii) purifying the adeno-associated virus vector produced by the cell.

In a preferred embodiment, the adipose tissue-specific regulatory region forming part of the polynucleotide of the present invention comprises a promoter region selected from the group consisting of a murine aP2 basal promoter and a rat UCP1 basal promoter.

In another embodiment, the adipose tissue-specific regulatory region further comprises an enhancer region operably linked to the promoter region. In a more preferred embodiment, the enhancer region is selected from the group consisting of a fat-specific aP2 enhancer and a fat-specific UCP1 enhancer.

In another embodiment, the regulatory region is selected from the group consisting of:

i) a polynucleotide comprising a fat specific aP2 enhancer and a murine aP2 basic promoter and

ii) A polynucleotide comprising a fat-specific UCP1 enhancer and a rat UCP1 basal promoter.

In another embodiment, the expression cassette of the polynucleotide of the invention further comprises post-transcriptional regulatory elements. In yet another embodiment, the post-transcriptional regulatory region is WPRE.

In another embodiment, the polynucleotide of interest comprised in the polynucleotides of the present invention encodes a protein selected from the group consisting of hexokinase, glucokinase, alkaline phosphatase, and vascular endothelial growth factor.

The production of recombinant AAV (rAAV) for vectorized transgenes has been described above. See Ayuso E et al, Curr. Gene Ther. 2010; 10:423-436, Okada T et al, Hum. Gene Ther. 2009; 20: 1013-1021, Zhang H et al, Hum. Gene Ther. 2009; 20:922- 929 and Virag T et al. Hum. Gene Ther. 2009;20:807-817. These experimental reports can be used or modified to generate the AAVs of the present invention. In one embodiment, a producer cell line is transiently transfected with a polynucleotide of the invention (comprising an expression cassette flanked by ITRs) and with constructs encoding rep and cap proteins and providing helper functions. In another embodiment, a producer cell line stably provides helper functions and is transiently transfected with a polynucleotide of the invention (comprising an expression cassette flanked by an ITR) and with constructs encoding rep and cap proteins. In another embodiment, the cell line stably provides rep and cap proteins and helper functions and is transiently transfected with a polynucleotide of the invention. In another embodiment, the cell line stably provides rep and cap proteins and is transiently transfected with a polynucleotide of the invention and a polynucleotide encoding a helper function. In yet another embodiment, the cell line stably provides the polynucleotides of the invention, rep and cap proteins, and helper functions. Methods of making and using these and other AAV production systems have been described in the art. See Muzyczka N et al, US 5,139,941, Zhou X et al, US 5,741,683, Samulski R et al, US 6,057,152, Samulski R et al, US 6,204,059, Samulski R et al, US 6,268,213, Rabinowitz J et al. , Shenk T et al, US 6,951,753, Snyder R et al, US 7,094,604, Rabinowitz J et al, US 7,172,893, Monahan P et al, US 7,201,898, Samulski R et al, US 7,229,823 and Ferrari F et al, US 7,439,065.

In another embodiment, the transgene delivery capacity of AAV can be increased by providing two AAV ITRs that can anneal to form a head-to-tail tandem of genomes. Typically, when AAV enters a host cell, the single-stranded DNA containing the transgene is converted to double-stranded DNA by the host cell DNA polymerase complex, after which ITR helps form tandem in the nucleus. Alternatively, AAVs can be designed as self-complementary (sc) AAVs that allow viral vectors to bypass the step of second-strand synthesis upon entry into target cells, providing faster, potentially higher (e.g., up to 100 times) folded) scAAV viral vector for transgene expression. For example, an AAV can be designed to have a genome comprising two linked single-stranded DNA encoding a transgene unit and its complement, respectively, which can bind upon delivery to target cells, yielding a transgenic unit encoding the transgenic unit of interest of double-stranded DNA. Self-complementary AAVs have been described in the art. See Carter B, US 6,596,535, Carter B, US 7,125,717 and Takano H et al. US 7,456,683.

Cap proteins have been reported to have effects on host tropism, cell, tissue, or organ specificity, receptor usage, infection efficiency, and immunogenicity of AAV viruses. Thus, an AAV Cap for rAAV can be selected taking into account factors such as the race of the subject (eg, human or non-human), the immune status of the subject, the subject's suitability for long-term or short-term treatment, or A specific therapeutic application (eg, treatment of a specific disease or disorder, or delivery to a specific cell, tissue, or organ). In another embodiment, the rAAV Cap is based on Caps from two or three or more AAV serotypes. In specific embodiments, the AAV cap gene is derived from serotypes AAV1, AAV2, AAV4, AAV5, AAV6, AAV7, AAV8, or AAV9. In a preferred embodiment, the AAV cap gene is derived from serotypes AAV6, AAV7, AAV8 and AAV9.

In some embodiments, AAV Caps for use in the methods of the invention can be generated by mutagenesis (ie, by insertion, deletion, or substitution) of one of the aforementioned AAV Caps or their encoding nucleic acids. In some embodiments, the AAV Cap is at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% similar to one or more of the aforementioned AAV Caps.

In some embodiments, the AAV Cap is chimeric, comprising domains from at least two of the aforementioned AAV Caps. In some embodiments, the AAV Cap is a chimera of VP1, VP2, and VP3 monomers from two or three different AAVs or recombinant AAVs. In some embodiments, the rAAV composition comprises more than one of the aforementioned Caps.

In some embodiments, AAV Caps for use in rAAV compositions are designed to contain heterologous sequences or other modifications. For example, peptide or protein sequences that confer selective localization or immune evasion can be engineered into Cap proteins. Alternatively or additionally, Cap can be chemically modified such that the surface of the rAAV is pegylated (ie, polyethylene glycol modification), which can facilitate immune evasion. Cap proteins can also be mutagenized (eg, to remove their native receptor binding, or to mask immunogenic epitopes).

In specific embodiments, the AAV rep gene is derived from serotypes AAV1, AAV2, AAV4, AAV5, AAV6, AAV7, AAV8 and AAV9. In a preferred embodiment, the AAV rep and cap genes are derived from serotypes AAV6, AAV7, AAV8 and AAV9.

The genes AAV rep, AAV cap, and genes that provide helper functions can be introduced into cells by incorporating the genes into a vector, such as a plasmid, and introducing the vector into the cell. The genes can be bound to the same plasmid or to different plasmids. In a preferred embodiment, the AAV rep and cap genes are incorporated into one plasmid and the genes providing helper functions are incorporated into the other plasmid. Examples of plasmids comprising AAV rep and cap genes suitable for use in the methods of the present invention include pHLP19 and pRep6cap vectors. See Colisi P, US 6,001,650 and Russell D et al. US 6,156,30. In a preferred embodiment, the gene providing the helper function is derived from an adenovirus.

The polynucleotides of the present invention, as well as polynucleotides comprising AAV rep and cap genes or genes providing helper functions, can be introduced into cells using any suitable method known in the art. See Ausubel et al., Eds., "Short Protocols in Molecular Biology", 4th Ed. (John Wiley and Sons, Inc., New York, NY, US, 1997), supra Brown (1995), Watson (1992), Alberts (2008), Innis (1990), Erlich (1989), Sambrook (1989), Bishop (1987), Reznikoff (1987), Davis (1986) and Schleef (2001). Examples of transfection methods include, but are not limited to, co-precipitation with calcium phosphate, DEAE-dextran, polybrene, electroporation, microinjection, liposome-mediated fusion, lipofection, retroviral infection, and Biolistic transfection. In a specific embodiment, transfection is performed by co-precipitation with calcium phosphate. When the cell lacks expression of any AAV rep and cap genes and genes that provide adenovirus helper functions, the genes can be introduced into the cell simultaneously with the polynucleotide of the first aspect of the invention. Alternatively, the gene may be introduced into the cell before or after introduction of the polynucleotide of the first aspect of the invention. In a specific embodiment, cells are transfected simultaneously with the following three plasmids:

1) Plasmids comprising the polynucleotides of the present invention

2) Plasmids containing AAV rep and cap genes

3) Plasmids containing genes that provide helper functions

Exemplary conditions for culturing packaging cells and promoting AAV vector particle release, such as producing cell lysates, can be performed as described in the Examples herein. The producer cells are grown for a suitable period of time to facilitate release of the viral vector into the medium. Typically, cells can grow for about 24 hours, about 36 hours, about 48 hours, about 72 hours, about 4 days, about 5 days, about 6 days, about 7 days, about 8 days, about 9 days, up to about 10 days . After about 10 days (or sooner, depending on the culture conditions and the particular producer cells used), production levels typically drop significantly. Typically, the time of incubation is measured from the point of virus production. For example, in the case of AAV, virus production typically begins when helper virus function is provided in an appropriate producer cell as described herein. Typically, cells are harvested about 48 to about 100, preferably about 48 to about 96, preferably about 72 to 96, preferably about 68 to about 72 hours after helper virus infection (or after virus production begins).

The AAVs of the invention can be obtained from both: i) cells transfected with the polynucleotides of the invention and ii) the culture medium of said cells some time after transfection, preferably 72 hours later. Any AAV used to purify the cells or the culture medium to obtain the AAV of the present invention can be used. In a specific embodiment, the AAV of the invention is purified following an optimized method based on a polyethylene glycol precipitation step and two consecutive cesium chloride (CsCl) gradients. See Ayuso, 2010, supra. The purified AAV of the present invention can be dialyzed against PBS, filtered and stored at -80°C. The titer of the viral genome can be determined by quantitative PCR following the procedure described for the AAV2 reference standard material using linearized plasmid DNA as the standard curve. See Lock M et al., Hum. Gene Ther. 2010;21:1273-1285.

In some embodiments, the method further comprises a purification step, such as treating the cell lysate with a nuclease, purifying the cell lysate on a CsCl gradient, or purifying the cell lysate by heparin sulfate chromatography. See Halbert C et al, Methods Mol. Biol. 2004;246:201-212.

Suitable for the production of AAV, various naturally occurring and recombinant AAVs, their encoding nucleic acids, AAV Cap and Rep proteins and their sequences, and for the isolation or production, propagation and purification of such AAVs, and in particular their Methods of capsid are known in the art. See above, Gao, 2004, Russell D et al, US 6,156,303, Hildinger M et al, US 7,056,502, Gao G et al, US 7,198,951, Zolotukhin S, US 7,220,577, Gao G et al, US 7,235,393, Gao G et al, US 7,282,199, Wilson J et al, US 7,319,002, Gao G et al, US 7,790,449, Gao G et al, US 20030138772, Gao G et al, US 20080075740, Hildinger M et al, WO 2001/083692, Wilson J et al, WO 2003/014367, Gao G et al, WO 2003/ 042397, Gao G et al, WO 2003/052052, Wilson J et al, WO 2005/033321, Vandenberghe L et al, WO 2006/110689, Vandenberghe L et al, WO 2007/127264 and Vandenberghe L et al, WO 2008/027084.

8. Pharmaceutical compositions

The AAVs of the present invention can be administered to the human or animal body by conventional methods, which require formulation of the carrier in a pharmaceutical composition. Accordingly, in a seventh aspect, the present invention relates to a pharmaceutical composition comprising an AAV (hereinafter referred to as "the pharmaceutical composition of the present invention"), wherein the AAV comprises a recombinant viral genome, wherein the recombinant viral genome comprises an expression cassette , the expression cassette comprises an adipose tissue-specific transcriptional regulatory region operably linked to the polynucleotide of interest. Alternatively, the pharmaceutical compositions of the present invention may comprise the polynucleotides or polypeptides of the present invention.

The pharmaceutical composition may include a therapeutically effective amount of an AAV of the present invention and a pharmaceutically acceptable carrier.

The compositions of the present invention can be formulated for delivery to animals (eg, livestock (bovine, porcine, others)) for veterinary purposes, as well as to other non-human mammalian subjects, as well as human subjects. AAVs can be formulated with physiologically acceptable carriers for gene transfer and gene therapy applications. The dosage of a formulation can be measured or calculated as viral particle or genome copies ("GC")/viral genome ("vg").

Any method known in the art can be used to determine the genome copy (GC) number of the viral compositions of the invention. One method for performing AAV GC number titrations is as follows: Purified AAV vector samples are first treated with deoxyribonuclease to remove unencapsidated AAV genomic DNA or contaminating plasmid DNA from the production process. The DNase-resistant particles are then subjected to heat treatment to release the genome from the capsid. The amount of released genome was then determined by real-time PCR using primer/probe sets targeting specific regions of the viral genome.

Additionally, the viral composition can be formulated in a dosage unit to contain from about 1.0 x 10 ⁹ GC to about 1.0 x 10 ¹⁵ GC (to treat a subject with an average body weight of 70 kg), and preferably from 1.0 x 10 ¹² GC to 1.0 x 10 ¹⁴ Viral vectors are used in human patients in amounts in the GC range. Preferably, the dose of virus in the formulation is 1.0×10 ⁹ GC, 5.0×10 ⁹ GC, 1.0×10 ¹⁰ GC, 5.0×10 ¹⁰ GC, 1.0×10 ¹¹ GC, 5.0×10 ¹¹ GC, 1.0×10 ¹² GC , 5.0×10 ¹² GC, 1.0×10 ¹³ GC, 5.0×10 ¹³ GC, 1.0×10 ¹⁴ GC, 5.0×10 ¹⁴ GC, or 1.0×10 ¹⁵ GC.

Viral vectors can be formulated in a conventional manner using one or more physiologically acceptable carriers or excipients. AAVs can be configured for parenteral administration by injection (eg, by bolus injection or continuous infusion). Formulations for injection may be presented in unit dose (eg, in ampoules or in multi-dose containers) with an added preservative. The viral compositions can take such forms as suspensions, solutions or emulsions in oily or aqueous vehicles, and can contain formulatory agents such as suspending, stabilizing and/or dispersing agents. Liquid dosage forms of AAV formulations can be prepared by conventional methods with pharmaceutically acceptable additives such as suspending agents (eg, sorbitol syrup, cellulose derivatives, or hydrogenated edible fats), emulsifying agents (eg, lecithin or acacia) , a non-aqueous vehicle (eg, almond oil, oily esters, ethanol or fractionated vegetable oils) and a preservative (eg, methyl or propyl-paraben or sorbic acid). The dosage form may also contain buffer salts. Alternatively, the compositions may be in powder form for constitution with a suitable vehicle, eg, sterile pyrogen-free water, before use.

Also included are adjuvants used in combination or in admixture with the AAVs of the present invention. Contemplated adjuvants include, but are not limited to, inorganic salt adjuvants or inorganic salt gel adjuvants, granular adjuvants, particulate adjuvants, mucosal adjuvants, and immunostimulating adjuvants.

The adjuvant can be administered to a subject as a mixture with the AAV of the invention, or in combination with the AAV.

The pharmaceutical compositions of the present invention can be administered locally or systemically. In a preferred embodiment, the pharmaceutical composition is administered near the tissue or organ whose cells are to be transduced. In specific embodiments, the pharmaceutical compositions of the present invention are administered locally into white adipose tissue (WAT) or brown adipose tissue (BAT) by intra-WAT or intra-BAT injection. In another preferred embodiment, the pharmaceutical composition of the present invention is administered systemically.

The pharmaceutical composition can be formulated according to conventional methods as a pharmaceutical composition suitable for intravenous injection, subcutaneous, or intramuscular administration to humans. Injectables can be prepared in conventional forms, either as liquid solutions or suspensions, solid forms suitable for solution or suspension in liquid prior to injection, or as emulsions. The composition may also include, if necessary, a local anesthetic, such as lidocaine, for pain relief at the injection site. When the composition is administered by osmosis, it can dispense with an osmotic bottle containing a drug-quality water or saline solution. When the composition is administered by injection, a water bottle for injection or sterile saline solution can be provided so that the ingredients can be mixed prior to administration.

The term "therapeutically effective amount" refers to the amount of a polynucleotide, vector, polypeptide, or pharmaceutical composition of the invention calculated to produce the desired effect, and generally, among other reasons, from the polynucleotide, vector, polypeptide of the invention and the own characteristics of the pharmaceutical composition and the therapeutic effect to be obtained. The amount of a polynucleotide, vector, polypeptide or pharmaceutical composition of the invention effective in the treatment of a disease is determined by standard clinical techniques described herein or otherwise known in the art. In addition, in vitro assays can optionally be used to help determine optimal dosage ranges. The precise dose to be employed in the formulation will depend on the route of administration, and the seriousness of the condition, and should be determined with the judgment of the physician and will depend on each patient's circumstances. Effective doses can be extrapolated from a pair of dose-response curves derived from in vitro test systems or models in animals. For systemic administration, the therapeutically effective dose can be estimated initially from in vitro tests. For example, dosages can be formulated in animal models to achieve a range of circulating concentrations that include IC50s that have been determined in cell culture. Such information can be used to accurately determine useful doses in humans. The first dose can also be estimated from in vivo data (eg, animal models) using techniques known in the art. One of ordinary skill in the art can readily optimize administration to humans based on data in animals.

Such systemic administration includes, but is not limited to, any route of administration that is not intended to be injected directly into adipose tissue. More particularly, systemic administration includes systemic injection of the polynucleotides, vectors, polypeptides and pharmaceutical compositions of the invention, such as intramuscular (im), intravascular (ie), intraarterial (ia), intravenous (iv), Intraperitoneal (ip), subcutaneous or transdermal injection. Peripheral administration also includes oral administration of the polynucleotides, carriers, polypeptides and pharmaceutical compositions of the invention, delivered using implants, or via the respiratory system (eg, intranasally) using sprays, aerosols, or any other suitable formulation given by instillation. Preferably, systemic administration is by im, ip, ia or iv injection. Most preferably, the polynucleotides, vectors, polypeptides and pharmaceutical compositions of the present invention are administered by iv injection. See During M, WO 1996/040954 and Monahan P et al, WO 2001/091803.

The pharmaceutical compositions of the present invention may be administered in a single dose, or in certain embodiments of the present invention, multiple doses (eg, two, three, four, or more administrations) may be employed to achieve a therapeutic effect. Preferably, when multiple doses are required, the AAVs contained in the pharmaceutical compositions of the present invention are from different serotypes.

All publications mentioned above are incorporated herein by reference in their entirety.

Although the foregoing invention has been described in some detail for purposes of clarity and understanding, it will be understood by those skilled in the art from reading this disclosure that various changes in form and detail may be made therein without departing from the invention and the appended claims true range.

general method

1. Subject Characteristics

Harlan Labs.，Inc.，Madison，WI，US)自由采食，并在光暗周期下(在8:00a.m.光照)保持12h。对于组织采样，将小鼠通过吸入麻醉异氟烷(

AbbottLaboratories，Abbott Park，IL，US)麻醉并割去头部。切离感兴趣的组织并在-80℃下或使用甲醛保存直至分析。8-12 week old male ICR mice, 9-13 week old C57Bl/6J mice and 8 week old B6.V-Lep ^ob /OlaHsd(ob/ob) and BKS.Cg-+Lepr ^db / +Lepr ^db /OlaHsd(db/db) mice. Standard chow for mice (TekladGlobal

Harlan Labs., Inc., Madison, WI, US) fed ad libitum and maintained for 12 h under a light-dark cycle (light at 8:00 a.m.). For tissue sampling, mice were anesthetized by inhalation of isoflurane (

Abbott Laboratories, Abbott Park, IL, US) anesthetized and decapitated. Tissues of interest were excised and stored at -80°C or with formaldehyde until analysis.

2. Recombinant AAV Vectors

Vectors were generated by three transfections of HEK293 cells according to standard methods. See Ayuso, 2010, supra. Cells were cultured to 80% cell coverage in 10 roller bottles (850 cm ² , flat; Corning ^™ , Sigma-Aldrich Co., Saint Louis, MO, US) in DMEM with 10% FBS and carried Co-transfection with a plasmid containing the expression cassette flanked by the AAV2 ITR, a helper plasmid carrying the AAV2rep gene and the cap gene of AAV serotypes 1, 2, 4, 5, 6, 7, 8 or 9, and a plasmid carrying the helper adenovirus . The transgenes used were: a) eGFP driven by: a1) hybrid cytomegalovirus enhancer/chicken β-actin constitutive promoter (CAG) and WPRE regulatory element, a2) murine mini/aP 2 regulatory region or a3) mouse mini/UCP1 regulatory region; b) murine hexokinase II (mHKII) cDNA driven by: b1) CMV ubiquitous promoter and WPRE, b2) mouse mini/aP2 regulatory region or b3) mouse mini/UCP1 regulatory region, c) secreted alkaline phosphatase (hSeAP) derived from human placenta by murine mini/aP2 regulatory region and WPRE, d) murine driven by mouse mini/UCP1 regulatory region _VEGF164 , and e) RFP driven by the CMV ubiquitous promoter. See Ross, 1990, Graves, 1992 and Cassard-Doulcier, 1998, supra. Empty particles were generated using a non-coding plasmid carrying the CMV promoter (pAAV-MCS, Stratagene ^™ , Agilent Technologies, Inc., Santa Clara, CA, US), mini/aP2 regulatory regions or mini/UCP1 regulatory regions, and multiple cloning sites . AAV was purified using an optimized method based on a polyethylene glycol precipitation step and two successive cesium chloride (CsCl) gradients. This second-generation CsCl-based method significantly reduces empty AAV capsids as well as DNA and protein impurities. See Ayuso, 2010, supra. Purified AAV vectors can be dialyzed against PBS, filtered and stored at -80°C. The titer of the viral genome was determined by quantitative PCR following the method described for the AAV2 reference standard material using linearized plasmid DNA as a standard curve. See Lock M et al., Hum. Gene Ther. 2010;21:1273-1285. The vector is constructed according to molecular biology techniques known in the art. See Brown (1995), Watson (1992), Alberts (2008), Innis (1990), Erlich (1989), Sambrook (1989), Bishop (1987), Reznikoff (1987), Davis (1986) and Schleef, supra (2001).

3. In vivo eWAT administration of AAV vectors

Mice were anesthetized with intraperitoneal injections of ketamine (100 mg/kg) and xylazine (10 mg/kg). A laparotomy was performed to expose the white adipose tissue of the epididymis. AAV vectors were resuspended in saline with or without 2% Pluronic F88 (BASF Corp., Florham Park, NJ, US) and injected directly into the epididymal fat pad. Each epididymal fat pad was injected twice with 50 [mu]L of AAV solution (one injection close to the testis and another in the middle of the fat pad). The abdomen was rinsed with sterile saline and closed with a two-layer approach.

4. Intra-iBAT and intra-iWAT administration of AAV vectors in vivo.

Mice were anesthetized with intraperitoneal injections of ketamine (100 mg/kg) and xylazine (10 mg/kg). A longitudinal 1.5-2 cm long incision was made in the interscapular or inguinal region to expose the iBAT or iWAT, respectively. Each iBAT or iWAT received four injections of 10 μl of AAV solution using a Hamilton syringe to disperse the vector throughout the pool. Close the skin using a one-layer method.

5. Systemic Administration of AAV Vectors

The appropriate amount of AAV solution was diluted in 200 μL of saline and manually injected into the lateral caudal vein at the time of delivery without pressure. Prior to injection, animals were placed under a 250W infrared heating lamp (Philips NV, Amsterdam, NL) for several minutes to dilate blood vessels and facilitate visualization and better access to the tail vein. Animals were immobilized for injection using plastic restraints (Harvard Apparatus, Holliston, MA, US). Anesthesia was not used due to the use of appropriate restraint devices. Animals are injected with a 30 gauge needle.

6. Immunohistochemistry

Life Technologies Corp.，Carslbad，CA，US)用作荧光染料并且将Hoescht bisbenzimide(Sigma-Aldrich Co.，Saint Louis，MO，US)用于细胞核对比染色。可替代地，使用1:50稀释的ABC过氧物酶试剂盒(Pierce Biotechnology，Inc.，Rockford，IL，US)并将切片在Mayer的苏木精中对比染色。Tissues were fixed in formaldehyde for 12 to 24 hours, embedded in paraffin, and sectioned for detection of GFP, RFP, and α-SMA. Sections were plated with 1:300 diluted goat anti-GFP antibody (Abcam plc, Cambridge, MA, US), 1/400 diluted rabbit anti-RFP antibody (Abcam plc, Cambridge, MA, US) or 1/300 diluted Murine anti-α-SMA antibody (Sigma-Aldrich Co., Saint Louis, MO, US) was incubated overnight at 4°C. Biotinylated donkey anti-goat antibody (Santa Cruz Biotechnology, Inc., Santa Cruz, CA, US) at 1:300 dilution, or biotinylated goat anti-rabbit antibody (Pierce Antibodies, Thermo Fisher) at 1/300 dilution Scientific Inc., Rockford, IL, US) or a 1/300 dilution of biotinylated horse anti-mouse antibody (Vector Laboratories, Burlingame, CA, US) were used as secondary antibodies. Streptavidin Alexa Fluor 488 (Molecular

Life Technologies Corp., Carslbad, CA, US) was used as a fluorescent dye and Hoescht bisbenzimide (Sigma-Aldrich Co., Saint Louis, MO, US) was used for nuclei contrast staining. Alternatively, a 1:50 dilution of the ABC Peroxidase Kit (Pierce Biotechnology, Inc., Rockford, IL, US) was used and sections were counterstained in Mayer's Hematoxylin.

7. Analysis of β-galactosidase expression in eWAT samples

To detect all β-galactosidase present in eWAT, tissue samples were fixed in 4% paraformaldehyde for 1 h, washed twice in PBS solution, and then in 5 mM K ₃ Fe(CN) ₅ , 5 mM K ₄ Fe( _CN ) and 1 mM MgCl in X-Gal (5-bromo-4-chloro- ₃ -β-D-galactopyranoside) in PBS for 6-8 h at 37 °C in the dark .

8. GFP content

型号组织匀浆器机械破碎并在室温下温育10分钟。温育之后，将样品以14000rpm离心10分钟。将上层清液移至新管并且用具有488nm激发波长和512nm发射波长的闪光光谱仪Flx800(Bio-Tek Instruments，Inc，Winooski，VT，US)测量100μL的该溶液中的GFP含量。通过含有蛋白的样品校正总GFP含量值。To determine GFP content, tissues were lysed in 1 mL of lysis buffer (50 mM/L Tris, 1% NonidetP40, 0.25% sodium deoxycholate, 150 mM/L NaCl, 1 mM/L EDTA, pH 7.4, sterile filtered) in PBS. Chinese use

Model tissue homogenizers were mechanically disrupted and incubated for 10 min at room temperature. After incubation, samples were centrifuged at 14000 rpm for 10 minutes. The supernatant was transferred to a new tube and 100 μL of this solution was measured for GFP content with a flash spectrometer Flx800 (Bio-Tek Instruments, Inc, Winooski, VT, US) with an excitation wavelength of 488 nm and an emission wavelength of 512 nm. Total GFP content values were corrected for samples containing protein.

9. Isolation of Adipocytes from Epididymal Fat Pads

AAV-transduced adipocytes were isolated using a modified Rodbell's method. See Rodbell M, J. Biol. Chem. 1964;239:375-380. Isoflurane-anaesthetized mice were sacrificed by decapitation and epididymal WAT was minced and incubated at 37°C for 35-45 minutes in 4% BSA (without fatty acids), 0.5mM/L glucose and 0.5mg/L mL of collagenase type II (C6885; Sigma-Aldrich Co., Saint Louis, MO, US) in Krebs-Ringer bicarbonate HEPES buffer (KRBH). Adipocytes were isolated by gentle centrifugation and washed three times with fresh KRBH without collagenase without glucose. Adipocytes were resuspended in fresh KRBH without glucose and cell numbers were estimated as previously described. See DiGirolamo M et al. Am. J. Physiol 1971;221:850-858.

10. RNA Analysis

(Cepheid，Sunnyvale，USA)中进行实时定量PCR。正义和反义寡核苷酸引物的序列是：Total RNA was isolated from adipose tissue using QIAzol lysis reagent (Qiagen NV, Venlo, NL) or tripure isolation reagent (Roche Diagnostics Corp., Indianapolis, IN, US), and RNeasy Lipid Tissue Minikit, respectively. Cells and fat depots or liver obtained. To remove residual viral genome, total RNA was treated with DNAseI (Qiagen NV, Venlo, NL). For RT-PCR, 1 μg of RNA samples were reverse transcribed using the Superscript VILO cDNA synthesis kit (Invitrogen ^™ , Life Technologies Corp., Carslbad, CA, US). After using EXPRESS SYBRGreen qPCR supermix (Invitrogen ^™ , Life Technologies Corp., Carslbad, CA, US)

(Cepheid, Sunnyvale, USA) for real-time quantitative PCR. The sequences of the sense and antisense oligonucleotide primers are:

Data were normalized with 36B4 values and analyzed as previously described. See Pfaffl M, Nucleic Acids Res. 2001;29(9):e45.

11. Ex vivo glucose uptake in isolated adipocytes

For isolated adipocytes from mice, 2-[ ^1-3H ]deoxy-D-glucose (2-DG; Amersham Pharmacia Biotech Inc., Piscataway, NJ, US) intake. See Traxinger R et al, J. Biol. Chem. 1989;264:8156-8163. Briefly, isolated adipocytes were obtained by collagenase digestion of epididymal WAT from mice raised as previously described. 250 μL of adipocyte suspensions were incubated with KRBH + 4% BSA (without fatty acids), 10 mM/L deoxy-glucose, 0.4 μCi 2-[1- ³ H]deoxy-D-glucose and various insulin concentrations for 5 minutes. Finally, adipocytes and media were isolated in polypropylene tubes by silicone oil (Sigma-Aldrich Co., Saint Louis, MO, US), and radioactivity in adipocyte samples was assessed by liquid scintillation counting. Results are expressed as pmol of 2-[ ³ H]-DG per 10 ⁶ cells per minute.

12. Glucose uptake in the body

In vivo basal glucose utilization index was determined as previously described. See Franckhauser S et al. Diabetes 2002;51:624-630. Briefly, 148 GBq (4 μCi) of the non-metabolizable glucose analog, deoxy-D-[ ^1,2-3H ]glucose (2-DG; PerkinElmer, Inc., Waltham, MA, US), was mixed in BSA-Lemon in salt buffer. A flash injection of the radiolabeled mixture was administered into the jugular vein of anesthetized (ketamine + xylazine) housed mice at time zero. Specific blood 2-DG clearance was determined using 25 [mu]L blood samples (tail vein) obtained at 1, 15 and 30 minutes post-injection as previously described. See Somogyi M, J. Biol. Chem. 1945;160:69-73. Tissue samples were removed 30 minutes after injection. The Glucose Utilization Index is determined by measuring the accumulation of radiolabeled compounds. See Ferré P et al, Biochem. J. 1985;228:103-110. Divide the amount of 2-DG-6 phosphate per milligram of protein by the integral of the measured concentration ratio of 2-DG to unlabeled glucose. Because the values were not corrected for the "discrimination constant" of 2-DG in the glucose metabolic pathway, the results were expressed as an index of glucose utilization in picomoles per milligram of protein per minute.

13. Measurement of blood hSeAP levels

Phospha-Light^TM系统(Applied Biosystems^TM，Life TechnologiesCorp.，Carslbad，CA，US)，由5μL的血清测定循环hSeAP水平。use

Circulating hSeAP levels were determined from 5 μL of serum on the Phospha-Light ^™ system (Applied Biosystems ^™ , Life Technologies Corp., Carslbad, CA, US).

14. Statistical analysis

All values are expressed as mean ± SEM. Differences between groups were compared by Student's t-test. Differences were considered significant at p<0.05.

Example 1

In vivo transduction of white adipocytes by local administration of AAV

To evaluate the in vivo transduction efficiency of white adipose tissue (WAT) using AAV vectors, 4 x 10 ¹¹ viral genomes (vg)/mouse of AAV serotypes 1, 2, 4, 5, 6, 7, 8 and 9 ( The marker protein GFP (AAV-CAG-GFP) encoding the marker protein under the control of the ubiquitous promoter CAG, with or without the nonionic surfactant Pluronic F88, was injected bilaterally into epididymal white adipose tissue (eWAT) in mice. See Croyle M et al, Mol. Ther. 2001; 4:22-28, Gebhart C et al, J. Control Release 2001; 73: 401-416, Mizukami H et al, Hum. Gene Ther. 2006; 17:921-928 and Sommer J et al. Mol. Ther. 2003;7:122-128. Administration of AAV1, AAV2, AAV4 and AAV5 without Pluronic F88 resulted in a very low percentage of transduction of white adipocytes two weeks after injection, as assessed by immunostaining for GFP in eWAT. Furthermore, no improvement in adipotransduction efficiency mediated by any of the tested serotypes was achieved by the addition of Pluronic F88. See Figure 1A. Therefore, the use of this nonionic surfactant was discarded for subsequent experiments. Independent of the addition of Pluronic F88, AAV1 was more efficient than AAV2, AAV4 and AAV5 in eWAT transduction in vivo. See Mizukami, 2006, supra. In contrast to the groups with few scattered adipocytes and very few adipocytes transduced by AAV1, animals injected with AAV 6 and AAV7 exhibited groups of multiple larger GFP ⁺ white adipocytes. Furthermore, animals treated with AAV8 and AAV9 showed much greater transduction of eWAT, and the vast majority of adipocytes per eWAT region were transduced. See Figure 1B. Quantification of GFP content in eWAT two weeks after administration by fluorescence analysis further confirmed that AAVs of serotypes 6, 7, 8 and 9 were more efficient than AAV1 in eWAT transduction in vivo. See Figure 1C. Notably, epididymal fat pads injected with AAV8 and AAV9 exhibited the highest GFP content and there was no significant statistical difference between them. See Figure 1C. Two weeks after intraunilateral eWAT administration of 2 x 10 ¹¹ vg/mouse of AAV8 encoding the LacZ gene under the control of the ubiquitous CMV promoter (AA8-CMV-LacZ), the LacZ substrate 5-bromo-4- Staining for chloro-3-indolyl-β-D-galactoside (X-gal) showed extensive distribution throughout eWAT-transduced adipocytes. See Figure 1D. Local administration of AAV8 and AAV9-CAG-GFP vectors to inguinal WAT (iWAT) mediated massive transduction of white and beige adipocytes in this depot. See Figures 1G and H. Taken together, these results suggest that AAV8 and AAV9 are the most suitable vectors for in vivo inheritance of WAT.

Furthermore, intra-eWAT administration of AAV vectors results in transduction that is virtually restricted to eWAT. Two weeks after injection, animals treated with AAV1, AAV6, AAV7, AAV8, or AAV9-CAG-GFP did not exhibit transduction of mesenteric, retroperitoneal, and inguinal depots, whereas small amounts of GFP ⁺ brown adipocytes were present in cells treated with AAV1, AAV6, AAV7, AAV8, or AAV9-CAG-GFP. AAV9eWAT in iBAT of mice injected internally. See Figure 8A. However, transgene expression in BAT was minimal compared to that detected in eWAT. See Figure 8B. Regarding transduction of non-adipose tissue, eWAT administration of AAV7, AAV8 and AAV9-CAG-GFP also resulted in significant gene transfer to the liver and heart and to a smaller number of exocrine cells of the pancreas. See Figure 8C.

As a proof-of-concept to assess whether AAV-transduced adipocytes in vivo could be a viable model for studying adipocyte function, ⁴ x 1011 vg/mouse, controlled by the ubiquitous promoter CMV, encoding a murine enzyme AAV9 vector of glycokinase II (mHKII) (AAV9-CMV-mHKII) or an equal dose of AAV9-CMV-null vector was injected bilaterally into eWAT of healthy mice. Two weeks after injection, isolated adipocytes from animals treated with AAV9-CMV-mHKII exhibited a 3-fold increase in mHKII expression compared to adipocytes from mice injected with AAV9-CMV-null. See Figure 1E. To analyze AAV-mediated overexpression of mHKII in adipocytes, basal and insulin-stimulated 2-[ ^1-3H ]deoxy-D-glucose uptake by ex vivo isolated adipocytes was determined. Basal 2-[ ^1-3H ]deoxy-D-glucose uptake was slightly increased in AAV9-CMV-mHKII transduced adipocytes compared to AAV9-CMV-null transduced adipocytes. In contrast, insulin stimulation resulted in increased 2-[ ^1-3H ]deoxy-D-glucose uptake by AAV9-CMV-mHKII-transduced adipocytes compared to adipocytes from animals treated with AAV9-CMV-null vector larger. See Figure 1F.

Example 2

In vivo AAV-mediated specific genetic engineering of white adipocytes

The use of a short version of the murine adipocyte protein 2 (mini/aP2) promoter consisting only of adipocyte-specific enhancers in combination with the aP2 basal promoter was evaluated. See Ross, 1990 and Graves, 1992, supra. The purpose of this assay was to restrict AAV-mediated transgene expression to adipocytes. AAV8 and AAV9 encoding GFP mediated limited transduction of white adipocytes in unilateral eWAT administered internally at 10 ¹² vg/mouse, controlled by the mini/aP2 regulatory region, and in liver and heart two weeks after injection There was no detectable GFP expression. See Figures 2A and 9.

To assess the time course of transgene expression mediated by the mini/aP2 regulatory region in mice, a dose of 4 x 10 ¹² vg/mouse, controlled by the mini/aP2 regulatory region, encoding a secreted base derived from human placenta was administered. AAV9 vector (AAV9-mini/aP2-SeAP) or saline solution of sex phosphatase (hSeAP) cDNA was injected bilaterally into eWAT, and circulating hSeAP levels were measured at various time points after AAV administration. High levels of hSeAP were detected until two weeks after AAV delivery and gradually increased for up to 40 days. Thereafter, circulating hSeAP levels were maintained for a follow-up period of at least one year after injection. Quantification of hSeAP expression levels in liver and eWAT by qPCR confirmed that eWAT is the tissue responsible for the main production of hSeAP. See Figures 2B-2C.

To assess whether AAV-mediated specific genetic engineering of white adipocytes could constitute a new tool to study adipocyte function, differentiation, and metabolism in mice, 1.4×10 ¹² vg/mouse of adipocytes, controlled by the mini/aP2 regulatory region, was added. Yes, an AAV9 vector encoding mHKII (AAV9-mini/aP2-mHKII) or an equal dose of AAV9-mini/aP2-null vector was administered to eWAT. Two weeks after injection, basal in vivo 2-[ ^1-3H ]deoxy-D-glucose uptake was determined. Animals receiving AAV9-mini/aP2-mHKII vector showed increased basal 2-[l ^- 3H]deoxy-D-glucose uptake by eWAT compared to animals treated with AAV9-mini/aP2-null vector. Under basal conditions, no 2-[ ^1-3H ]deoxy-D-glucose uptake was found between groups in iBAT and in tissues such as the heart, where the use of the mini/aP2 regulatory region prevents transgene expression difference. See Figure 2D.

Example 3

Genetic engineering of in vivo brown adipocytes via localized delivery of AAV vectors

Considering that AAV8 and AAV9 are the most efficient genetically engineered vectors to mediate white adipocytes, transduction of brown adipocytes by the same serotype was evaluated. Two weeks after administration of 2 x ¹⁰⁹ vg/mouse of AAV8 and AAV9-CAG-GFP vectors to interscapular brown adipose tissue (iBAT), multiple GFP ⁺ brown adipocytes were detected. See Figure 3A. Evaluation of GFP expression levels by qPCR indicated higher transduction efficiency by AAV8 compared to AAV9 at a dose of 2 x ¹⁰⁹ vg/mouse. See Figure 3B. Once transduction of brown adipocytes was demonstrated using AAV8 and AAV9 vectors, we characterized brown adipose tissue (BAT) transduction efficiency using AAV of serotypes 1, 2, 4, 5, 6, 7, 8 and 9 in vivo. For this purpose, AAV of serotypes 4 and ⁸ at a dose of 1.2 x 1010 vg/mouse or AAV of serotypes ¹ , 2, 4, 5, 6, 7, 8 and 9 at a dose of 1011 vg/mouse (AAV- CMV-RFP) (under the control of the ubiquitous promoter CMV, encoding the marker protein RFP) was injected into the iBAT of mice. Quantification of RFP expression levels by qPCR showed higher transduction efficiency of iBAT by AAV7, AAV8, and AAV9 compared to AAV1, 2, 4, 5, and 6 after two weeks of internal iBAT administration. See Figure 3C. Consistently, extensive RFP ⁺ brown adipocyte distribution was detected in iBAT of animals receiving AAV9 vectors. See Figure 3D.

Furthermore, intra-iBAT administration of AAV resulted in limited transduction of this pool, with undetectable transgene expression in epididymal, mesenteric, retroperitoneal and inguinal pools. Regarding transduction of non-adipose tissue, animals treated with AAV7, AAV8 and AAV9 vectors inside iBAT exhibited transduction in the heart and liver, while in pancreas, intestine, spleen, lung, kidney, skeletal muscle, testis, epididymis and brain GFP expression was not detectable in . See Figure 10.

Example 4

AAV-mediated specific genetic engineering of brown adipocytes in vivo

The expression of a gene of interest in brown adipose tissue is specifically regulated using a mini UCP1 (mini/UCP1) regulatory region consisting of an enhancer that imparts brown adipocyte-specific expression and a basal promoter of the rat UCP1 gene. See Boyer B et al., Mol. Cell Biol. 1991; 11:4147-4156, Kozak U et al., Mol. Cell Biol. 1994; 14:59-67, Cassard-Doulcier, 1998, supra, and Larose, 1996. High-efficiency transduction of brown adipocytes was obtained two weeks after intra-iBAT administration of 2 x 10 ¹¹ vg/mouse of AAV8 or AAV9-mini/UCP1-GFP vector. See Figure 4A. Similarly, AAV8 and AAV9-mini/aP2-GFP delivered internally in ^iBAT at 2 x 1011 vg/mouse also transduced brown adipocytes. See Figure 11A. Furthermore, the mini/UCP1 regulatory region achieves highly adipocyte-specific GFP expression, completely abolishes AAV-mediated transgene expression in the heart, and mediates only a small amount of liver transduction. See Figure 11B.

To examine that AAV-mediated transduction of iBAT could be a new model for studying brown adipocyte function, 7×10 ¹⁰ vg/mouse of AAV8-mini/UCP1-mHKII vector was administered to iBAT. Animals receiving AAV8-mini/UCP1-mHKII vector exhibited increased basal 2-[1- ³ H]deoxy-D-glucose uptake via iBAT compared to animals treated with AAV8-mini/UCP1-null vector, And under basal conditions, no difference in 2-[ ^1-3H ]deoxy-D-glucose uptake was found between the eWAT and heart groups. See Figure 4B. Then, 2×10 ¹¹ vg/mouse of AAV9-mini/UCP1-VEGF ₁₆₄ vector or AAV9-mini/UCP1-null vector was delivered inside iBAT. Two weeks after injection, animals receiving AAV9-mini/UCP1-VEGF ₁₆₄ vector exhibited overexpression of VEGF ₁₆₄ and increased total VEGF levels in iBAT compared to animals treated with AAV9-mini/UCP1-null vector. In addition, overexpression of PECAM1, a commonly used endothelial cell marker, was obtained in animals overexpressing VEGF ₁₆₄ . Animals treated with AAV9-mini/UCP1-VEGF ₁₆₄ vector exhibited an increased number of blood vessels compared to animals receiving AAV9-mini/UCP1-null vector as demonstrated by immunostaining for α-SMA in iBAT. See Figures 4C-4F.

Example 5

In vivo genetic engineering of white and brown adipocytes by systemic administration of AAV8 and AAV9

A dose of 5 x ¹⁰¹² vg/mouse AAV8 or AAV9-CAG-GFP vector was administered to lean mice via tail vein. Transduction of fat depots was assessed two weeks after injection. Immunostaining of GFP against eWAT fractions demonstrated AAV8- and AAV9-mediated transduction of white adipocytes. Furthermore, measurements of GFP expression levels and GFP content demonstrated that the transduction efficiencies of AAV8 and AAV9 were similar. Furthermore, systemic delivery of 5 x 10 ¹² vg/mouse of AAV8 or AAV9 vectors efficiently mediated the transduction of iBAT brown adipocytes. Measurement of GFP expression levels by qPCR and GFP content by fluorescence analysis indicated that AAV8 showed a tendency to exhibit superior iBAT transduction efficiency compared to AAV9. Furthermore, measurement of GFP expression levels by qPCR demonstrated gene transfer to inguinal, retroperitoneal and mesenteric repertoires. However, significant differences in transduction efficiency were observed among the pools. See Figures 5A-5H. Importantly, intravenous administration of AAV8 or AAV9 vectors to diabetic-obese ob/ob mice or db/db mice also resulted in the genetic engineering of WAT and BAT with efficiencies similar to those obtained in lean mice. See Figure 13. Systemic administration of AAV8 or AAV9-CAG-GFP vectors transduced various non-adipose tissues. See Figure 12.

Example 6

In vivo-specific genetic engineering of white and brown adipocytes using AAV-mini/aP2 and AAV-mini/UCP1 vectors

Although providing lower levels of transgene expression, systemic delivery of AAV8 or AAV9-mini/aP2-GFP to 2 x ¹⁰¹² vg mice resulted in transduction of white and brown adipocytes. See Figure 7A. In contrast, systemic administration of AAV8 or AAV9-mini/UCP1-GFP vectors to 2 x ¹⁰¹² vg mice mediated significant transduction of brown adipocytes. See Figure 6A. In addition, the AAV-mini/aP2-GFP and AAV-mini/UCP1-GFP vectors delivered intravenously achieved highly adipocyte-specific GFP expression, with no detectable transgene expression in the heart and only a few scattered in the liver. Small expression of GFP ⁺ hepatocytes. See Figures 7B-7C.

To further demonstrate the genetic engineering of adipocytes administered systemically by AAV, 2 x ¹⁰¹² vg of AAV9-mini/UCP1-VEGF ₁₆₄ or AAV9-mini/UCP1-null were delivered via tail vein. Two months after injection, animals receiving AAV9-mini/UCP1-VEGF ₁₆₄ vector showed increased expression of VEGF ₁₆₄ compared to animals treated with AAV9-mini/UCP1-null vector. See Figures 6B-6C. In addition, AAV9-mini/UCP1-VEGF164 or AAV9-mini/UCP1-null vector was also delivered via tail vein at a dose of 8×10 ¹² vg. One month after injection, animals receiving 8 x ¹⁰¹² vg of AAV9-mini/UCP1-VEGF164 vector exhibited increased expression of _VEGF164 and _PECAM1 and increased vessel density. See Figures 6D-6G.

Example 7

In vivo-specific genetic engineering of brown adipocytes using AAV-mini/aP2-GK

The AAV9 vector (AAV9-mini/aP2-rGK) encoding mouse glucokinase or an equal dose of AAV9-mini/aP2-null vector controlled by the mini/aP2 regulatory region was administered at a dose of 2 × 10 ¹¹ vg/mouse. Topically administered to iBAT of mice. Two weeks/month post-injection, basal and insulin-stimulated 2-[ ^1-3H ]deoxy-D-glucose uptake in vivo was determined to evaluate animals receiving AAV9-mini/aP2-rGK vector compared to those treated with AAV9- Whether mini/aP2-null vehicle-treated animals exhibited increased specific basal 2-[1- ³ H]deoxy-D-glucose uptake by iBAT.

Example 8

Efficient adipocyte transduction and off-targeting of transgene expression from liver and heart with mirT sequences following systemic administration of AAV vectors

Systemically administered at a dose of 10 ¹² vg/mouse, cloned in the 3'UTR of the expression cassette, supported by the ubiquitous CAG promoter (AAV9-CAG-GFP) or the CAG promoter plus four tandem target sites of liver-specific miR122a AAV9 vector encoding a GFP-tagged protein controlled by (AAV9-CAG-GFP-miRT122), heart-specific miR1 (AAV9-CAG-GFP-miRT1), or both (AAV9-CAG-GFP-dual-miRT). Two weeks after injection, in white and brown adipocytes from mice receiving AAV9-CAG-GFP, AAV9-CAG-GFP-miRT122, AAV9-CAG-GFP-mirT1, or AAV9-CAG-GFP-dual-miRT vectors Higher levels of GFP expression were observed. In contrast, GFP production in liver or heart was almost completely abolished in mice treated with AAV9-CAG-GFP-mirT122 or AAV9-CAG-GFP-mirT1 vectors, respectively. It is evident that GFP production is largely inhibited in liver and heart from mice treated with AAV9-CAG-GFP-dual-miRT. See Figure 14.

Claims (26)

1. An adeno-associated viral vector comprising a recombinant viral genome which is AAV6, AAV7, AAV8 or AAV9, wherein the recombinant viral genome comprises an expression cassette comprising an adipose tissue-specific transcriptional regulatory region operably linked to a polynucleotide of interest.

2. The adeno-associated viral vector according to claim 1 wherein the adipose tissue-specific transcriptional regulatory region comprises a promoter region which is the aP2 basal promoter or the UCP1 basal promoter.

3. The adeno-associated viral vector according to claim 2 wherein the adipose tissue-specific transcriptional regulatory region further comprises an enhancer region operably linked to the promoter region.

4. The adeno-associated viral vector according to claim 3 wherein the enhancer region is the fat specific aP2 enhancer or the fat specific UCP1 enhancer.

5. The adeno-associated viral vector according to claim 4 wherein the adipose tissue-specific transcriptional regulatory region is:

(i) a polynucleotide comprising the fat specific aP2 enhancer and the murine aP2 basal promoter; or

(ii) A polynucleotide comprising the fat-specific UCP1 enhancer and the rat UCP1 basic promoter.

6. The adeno-associated viral vector according to any one of claims 1 to 5 wherein the expression cassette further comprises a post-transcriptional regulatory region.

7. The adeno-associated viral vector according to claim 6 wherein the post-transcriptional regulatory region is a woodchuck hepatitis virus post-transcriptional regulatory element.

8. The adeno-associated viral vector according to any one of claims 1 to 7 wherein the polynucleotide of interest encodes a secreted protein that acts systemically or a protein that acts on or near adipocytes.

9. The adeno-associated viral vector according to any one of claims 1 to 8 wherein the polynucleotide of interest encodes the following proteins: hexokinase, glucokinase, alkaline phosphatase, or vascular endothelial growth factor.

10. The adeno-associated viral vector according to any one of claims 1 to 9 wherein the adeno-associated virus further comprises an ITR which is an AAV2 ITR.

11. The adeno-associated viral vector according to any one of claims 1 to 10 further comprising at least one miRNA target sequence.

12. The adeno-associated viral vector according to claim 11 wherein the at least one miRNA target sequence is mirT122 a.

13. The adeno-associated viral vector according to claim 11 wherein the at least one miRNA target sequence is mirT 1.

14. The adeno-associated viral vector according to claim 11 comprising at least one copy of mirT1 and one copy of mirT122 a.

15. A pharmaceutical composition comprising the adeno-associated viral vector according to any one of claims 1 to 14.

16. Use of the adeno-associated viral vector according to any one of claims 1 to 14 or the pharmaceutical composition according to claim 15 in the manufacture of a medicament for the treatment or prevention of a disease requiring expression of the polynucleotide of interest in the adipose tissue.

17. The use of claim 16, wherein the adipose tissue comprises white adipose tissue.

18. The use of claim 16, wherein the adipose tissue comprises brown adipose tissue.

19. The use according to claim 16, wherein the adeno-associated viral vector or the pharmaceutical composition is administered systemically or locally.

20. An in vitro method of transducing a cell, the method comprising contacting the cell with the adeno-associated viral vector according to any one of claims 1 to 14.

21. The in vitro method of claim 20, wherein said cells are adipocytes.

22. The in vitro method of claim 20, wherein said adipocytes are white adipocytes or brown adipocytes.

23. An adipocyte cell that has been obtained by the method of any one of claims 20 to 22.

24. A method for obtaining an adeno-associated viral vector according to any one of claims 1 to 14, comprising the steps of:

(i) providing a cell comprising a polynucleotide, an AAV cap protein, an AAV rep protein, and a viral protein upon which AAV relies for replication, said polynucleotide comprising an expression cassette flanked by adeno-associated viral ITRs, wherein said expression cassette comprises an adipose tissue-specific regulatory region operably linked to a polynucleotide of interest;

(ii) maintaining the cell under conditions suitable for AAV assembly, and

(iii) purifying the adeno-associated viral vector produced by the cell, wherein the rep or cap protein is derived from AAV serotype AAV6, AAV7, AAV8 or AAV 9.

25. The method according to claim 24, wherein the viral protein upon which AAV is dependent for replication is derived from adenovirus.

26. The method of claim 24 or 25, wherein step (iii) is further performed by a polyethylene glycol precipitation step or cesium chloride gradient fractionation.

Images