CN105907752A - PCV2 strain infectious cloning construction kit and method based on in-vitro rolling circle replication - Google Patents

Abstract

The invention discloses a PCV2 strain infectious cloning construction kit and method based on in-vitro rolling circle replication. The PCV2 strain infectious cloning construction kit based on in-vitro rolling circle replication contains the following primers: a PCV2 specific upstream primer: 5'-CCATATGAAATAAATTACTGAG-3' (SEQ ID NO. 1); a PCV2 specific downstream primer: 5'-CAGCGCACTTCTTTCGTTTTCAG-3' (SEQ ID NO. 2); and a random primer: 5'-NNNNNN-3' (SEQ ID NO. 3). The PCV2 strain infectious cloning method comprises the following steps: performing multi-primer rolling circle replication on PCV2 DNA by using the abovementioned primers to obtain a PCV2 whole genome; separating the whole genome through single enzyme digestion, purifying the separated whole genome, and connecting the purified whole genome; performing cyclizing once again; constructing PCV2 strain infectious cloning.

Description

PCV2 virus strain infection based on external rolling-circle replication sex clone builds test kit and method

Technical field

The invention belongs to biological technical field, be specifically related to a kind of PCV2 (2 porcine circovirus based on external rolling-circle replication Type) virus strain infection sex clone builds test kit and method.

Background technology

Rolling circle amplification (rolling-circle amplification, RCA) be within 1998, set up to can be used for constant-temperature amplification ring-type A kind of DNA cloning technology of DNA profiling.This technology is to use for reference the rolling of pathogenic microorganism ring-shaped DNA molecule in nature Circle replication mode and a kind of nucleic acid amplification technologies of setting up.RCA may utilize the polymerizations such as Phi29, Bst and Phage T7 at present The outer rolling-circle replication of enzyme perfect aspect, these several enzymes all have the strongest persistence and strand displacement capability, it is possible to meet RCA amplification The requirement of mechanism.Polymerase can constantly extend single stranded circle DNA profiling by primer, complete one take turns duplication after, again Again reentering next round by primer recognition sequence to replicate, the displacement activity of nucleic acid interchain makes newly synthesized nucleic acid chains enter Old chain before one step replacement is as polymeric precursors, and therefore extending process can circulate further.Unless extraneous factor is (such as core Acid exhausts, variations in temperature destructive enzyme activity etc.) impact terminate RCA reaction, RCA can make full use of the displacement of nucleic acid chains With highly active archaeal dna polymerase, cyclic DNA is carried out high-speed circulating duplication.RCA, can by means of the specificity of primer With the ring-shaped DNA molecule of direct amplifying specific, it is currently one of present stage widely used isothermal amplification technology.

Porcine circovirus 2 type (Porcine Circovirus type 2, PCV2) is porcine circovirus section (Circoviridae) circle Circovirus (Circovirus) member, is find in current mammal minimum without cyst membrane, single stranded circle DNA disease Poison.PCV2 is considered as to cause pmws (Postweaning Multi systemic Wasting Syndrome, PWMS) etc. PCV2 correlation system disease (PCV2-systemic disease, PCV2-SD) main Pathogen.PCV2 presents global distribution, can damage the immune system of pig, causes the immunosuppressant that pig is serious, faces simultaneously PCV2 and other pathogen (such as swine fever virus, pig blue-ear disease poison etc.) multiple infection and mixed infection on bed it occur frequently that, Cause heavy economic losses to pig industry, also human health is caused potentially hazardous.

Replicating of PCV2 is mainly the archaeal dna polymerase by means of host cell and related raw material.At present, PCV2 is infectious After the structure of clone is mainly obtained PCV2 full-length genome by PCR method or recombinated with plasmid, utilize liposome mediated transfection PK-15 cell, thus separate acquisition PCV2 infection clones.In recent years, Yang Shunli in 2011 etc. will amplification by PCR method The PCV2 full-length gene group obtained is inserted in eukaryotic expression vector PcDNA3.1, it is thus achieved that single copy recombiant plasmid P-PCV2 and series winding double copy recombiant plasmid p-2PCV2, transfection PK-15 cell respectively, continuous passage is exempted from after cultivating indirectly Epidemic disease fluorescent test shows, containing PCV2 virus antigen in cell, RT-PCR detection has PCV2 specific gene transcription Occur.After immune mouse, 35 days virus almost can detect capsid protein specific antibody, internal energy after mouse lethal Viral DNA detected, demonstrate 2 kinds of recombiant plasmid and all can express and assemble infectious PCV2 virion in vitro Son.The PCV2 full-length gene group that Wang Wei assistant officers in 2015 etc. will use PCR method to amplify from the pathological material of disease that PCV2 is positive Fragment directed cloning, to PVAX1 carrier, constructs the pVAX1-PCV2 infective cloned plasmids of PCV2, is transfected Cell carries out virus rescue success, carries out Revive virus detection by immunoperoxidase and RT-PCR, and result shows it In-vitro multiplication ability is stable.Shao little Xue in 2016 etc. utilize the method that design specific primer carries out PCR reaction, with PCV1 Genome is skeleton, and PCV2 capsid gene is replaced with capsid gene, successfully builds Chimeric porcine circovirus (PCV1-2) DNA clone, transfects this clone PK-15 cell and obtains Revive virus, successfully constructs PCV1-2DNA clone, a step Growth curve shows that its multiplication characteristic in PK-15 cell is more consistent with parental virus, and the outer multiplication capacity of success construct is relatively High Chimeric porcine circovirus.

The few human relations of Zhai in 2010 etc. carry out RCA, product warp to the PCV2 positive DNA sample of detection by random primer Single digestion with restriction enzyme and agarose gel electrophoresis are identified and purpose band are reclaimed, clone and checked order, and become Merit obtains the full-length genome that 2 strain Xinjiang Strain sizes are all the PCV2 of 1768bp, and genotype is respectively PCV2a and PCV2e； Soup wisdom in 2015 etc. to go out the full-length genome of virus by the equal Successful amplification of RCA method of random primer or specific primer Fragment, establishes the external rolling circle replication methods of PCV2.

Relative to Standard PCR, RCA only needs thermostatic equipment to be obtained with the full-length genome of ring-type genomic viral, this To play a role in the epidemic investigation such as PCV sudden change and typing and research.If the genome sequence of virus is unknown, also Can be expanded by random primer, but the non-specific meeting of primer causes full-length genome of other Orbiviruses etc. ring-type The non-specific amplification interference of DNA, this is also that this kind of RCA sensitivity to template is not as a defect of PCR method.

Summary of the invention

It is contemplated that overcome the deficiencies in the prior art, it is provided that a kind of PCV2 virus strain infection based on external rolling-circle replication property gram Grand structure test kit and method.

In order to achieve the above object, the technical scheme that the present invention provides is:

The sex clone of described PCV2 virus strain infection based on external rolling-circle replication builds in test kit containing following primer:

PCV2 specific upstream primer: 5 '-CCATATGAAATAAATTACTGAG-3 ' (SEQ ID NO.1)；

PCV2 specific Down Stream primer: 5 '-CAGCGCACTTCTTTCGTTTTCAG-3 ' (SEQ ID NO.2)；

Random primer: 5 '-NNNNNN-3 ' (SEQ ID NO.3).

The method of described structure PCV2 virus strain infection sex clone be utilize primer in mentioned reagent box to PCV2DNA and PUC19 plasmid (pUC19 plasmid is comparison) obtains PCV2 full-length genome after carrying out many primers rolling circle amplification, then will be complete Genome is by the isolated and purified rear connection of single endonuclease digestion, and recirculation, is built into the sex clone of PCV2 virus strain infection.

More specifically, the method for described structure PCV2 virus strain infection sex clone is to extract from PCV2 strain or swine diseases material STb gene is template, with the PCV2 specific upstream primer described in claim 1, PCV2 specific Down Stream primer and Random primer mixing carries out many primers rolling circle amplification to STb gene, then the product of many primers rolling circle amplification is carried out EcoR I Single endonuclease digestion, after digestion products is attached after gel purification cyclisation, it is thus achieved that PCV2 genomic DNA, should DNA transfects to PK15 cell again, it is thus achieved that the sex clone of PCV2 virus strain infection.

Below in conjunction with principle, the invention will be further described:

The present invention utilizes many primers rolling circle amplification (Multiply-primed rolling-circle amplification, MPRCA) side Method in PCV2 tests positive pathological material of disease obtain PCV2 full-length genome, by single endonuclease digestion isolated and purified after connect ring again Change, build infection clones.MPRCA method can fast and convenient acquisition ring-type PCV2 complete genome DNA, utilize with The compatibility of power traction thing and the identification of specific primer, reasonably avoid PCV2 different subtype and gene mutation causes gene The impact that PCR total length is expanded by the uncertainty of group, also simplify the separation process of strain.This research is the clinic of RCA Application opens new direction.And the technical advantage of MPRCA can be applicable to viral grand genome research, also will assist in point Sub-Epidemiological study and the discovery of the new strain of virus, the result of study formed is also for the full-length genome separation of Orbivirus Research provides new technological approaches.

If the genome sequence of virus is it is known that can select the conserved regions design virus-specific of each parting gene group to draw Thing, such as RCA method utilizes the acquisition ring-type PCV2 complete genome DNA that specific primer can be fast and convenient.The present invention Select the specific primer of this viral gene of conserved regions design of PCV2 each parting gene group；Utilize the compatibility of random primer Property, can reasonably avoid PCV2 different subtype and gene mutation causes the uncertainty of genome to expand PCR total length Impact, and utilize specific primer, it is ensured that the viral specificity of RCA method, this kind RCA pair can be overcome The sensitivity of PCV2 genomic templates is not as the defect of PCR method.So utilizing random primer and PCV2 specific primer Mixing, can overcome and be used alone impact and the defect that primer brings, also by simplify the gene element of PCV2 strain from The process built with infection clones, especially PCV2 different subtype and gene mutation cause the conserved region of its genome sequence The strain of variation, random and PCV2 specificity mix primer RCA shows exclusive mobility.

Virus according to the infection clones results obtained based on MPRCA product in the present invention can infect piglet, has PCV2 viral infection.Compared with the method that conventional infection sex clone builds, this method is not required to use plasmid vector, for ring The full-length genome of shape virus separates and building of infection clones studies the technological approaches providing new, also answering for PCV2 strain The research of mechanism processed and pathogenesis provides effective infectious strain.

Accompanying drawing explanation

Fig. 1 is that PCV2 genome MPRCA product is identified；

Fig. 2 is that PCV2 genome MPRCA product carries out single endonuclease digestion product qualification；

Fig. 3 is that the enzyme action of recombiant plasmid is identified；

Fig. 4 is the indirect immunofluorescene assay of the PK-15 cell of PCV2HNLYYA1 strain sub-thread cyclic DNA transfection；

Fig. 5 is the PCV2 detection after PK15 cell transfecting；In figure: N, negative control；P, positive control；1, the 3rd generation Band poison PK15 cell；2, the 6th generation band poison PK15 cell；

Fig. 6 is to transfect the front and PCV2 genome sequence comparison of Transfected cells Secondary Culture；

Fig. 7 is MPRCA group pig adenoid PCV2 detection；In figure: N, negative control；P, positive control；1-10 MPRCA group pig lymphoid tissue DNA；

Fig. 8 is the ImmunohistochemistryResults Results of the pig lymph node tissue section that HNLYYA1 strain PCV2 infects.

Detailed description of the invention

Part I:

1.1PCV2 genome MPRCA

To PCV2DNA (GenBank accession number KJ867555) and pUC19 plasmid (2686bp, MPRCA positive control) Carry out MPRCA.Its system is as follows: be separately added into template 4 μ L or pUC19 0.5 μ L, 20 μ L samples in PCR pipe This buffer (10mM Tris-HCl, 0.1mMEDTA), puts into 95 DEG C of operation 3min in ABI 2700PCR instrument, After being cooled to 4 DEG C, add 20 μ L reaction buffers [330mM Tris-acetate (pH 7.9at 37 DEG C), 100mM Mg-acetate, 660mM K-acetate, 1% (v/v) Tween 20,10mM DTT, 30pmol PCV2 specific upstream Primer 5 '-CCATATGAAATAAATTACTGAG-3 ' (SEQ ID NO.1), PCV2 specific upstream primer 5 '-CAGCGCACTTCTTTCGTTTTCAG-3 ' (SEQ ID NO.2) and random primer 5 '-NNNNNN-3 ' (SEQ ID NO.3) and 0.8 μ L phi29DNA polymerase (purchase Thermo Scientific company), react 18h at 30 DEG C, Then in 65 DEG C of 10min, being finally cooled to 4 DEG C, MPRCA reacting final product is in-20 DEG C of preservations.

Enzyme action after 1.2PCV2 viral DNA MPRCA and coupled reaction

The product of above-mentioned MPRCA is carried out EcoR I single endonuclease digestion, and enzyme action system is according to Thermo company restriction enzyme Enzyme description, configures 10 μ L enzyme action systems as follows:

Endonuclease reaction condition is as follows: 37 DEG C, 1.5h.Reaction terminate after take 5 μ L products carry out agarose (10g/L) coagulate Gel electrophoresis is analyzed.And digestion products is carried out after nucleic acid electrophoresis glue recovery, reclaim fragment and carry out concentration mensuration (30 Ng/ μ L), coupled reaction 20 μ L system is as follows:

Coupled reaction condition is as follows: 22 DEG C of coupled reaction 1h in PCR instrument.Obtain PCV2DNA connection product to put Standby in-20 DEG C.

1.3PCV2DNA transfects PK-15 cell

According to3000 reagent experimental programs, transfect above-mentioned PCV2DNA to PK-15 cell, Transfection procedure is as follows:

1) being laid on 24 orifice plates by PK-15 cell, totally 4 hole, observation of cell grows to 70-80% (attached cell 0.2-5 × 10⁶) Shi Jinhang transfection is standby.

2) useCulture medium dilutes3000 reagent (2 pipe), often pipe 25 μ L Culture medium is separately added into 1.5 μ L or 0.75 μ L3000 reagent.Vortex oscillation 2-3s, fully mixes.

3) useCulture medium dilutes connection product respectively, prepares DNA premixed liquid, then adds P3000^TMReagent, Fully mixing.System is as follows: 50 μ LCulture medium, 1 μ g connects product and PEGFP-C3 plasmid, 2 μ L P3000^TMReagent.

4) diluted often managing3000 reagent add the DNA (1:1 ratio) of dilution, i.e. at two pipes 25 μ L dilution3000 reagent are separately added into and dilute connection product 25 μ L and 25 μ L PEGFP-C3 plasmid.Incubated at room 5min.

5) standby PK-15 cell adds 50 μ L DNA-liposome complexes.37 DEG C of incubated cells 24 days.Then use glimmering Light microscope analyzes transfectional cell.

6) transfectional cell of acquisition is carried out according to a conventional method passage cultivation, cultivate by 5% serum DMEM culture medium, pass For time be divided into 2 bottles, 1 bottle is used for preserving and passing on, and 1 bottle is used for gathering in the crops virus.

1.4PCV2 collection virus

1), when cell covers with, bottle cap mouth ParafilmTM ,-80 DEG C of frozen 12h of refrigerator are cultivated.

2) melt under room temperature after 12h, put into-80 DEG C of refrigerator 1h after thawing, then melt under room temperature, 3 times repeatedly.

3) cell pyrolysis liquid melted is centrifuged, 4000rpm, 30min, gathers in the crops supernatant.

The detection of 1.5PCV2

Detection primer is by this laboratory design and offer.

Detection primer sequence:

P1 (forward primer): CCATATGAAATAAATTACTGAG (SEQ ID NO.4),

P2 (downstream primer): CAGCGCACTTCTTTCGTTTTCAG (SEQ ID NO.5), amplified fragments size is 785bp。

By following reaction system: DNA1 μ L, P1 0.5 μ L, P2 0.5 μ L, 2 × Taq PCR Master Mix5 μ L, double steaming Water 3 μ L, presses response procedures: 94 DEG C of 5min, 94 DEG C of 30s, 55 DEG C of 30s, 72 DEG C of 3min, 35 are followed in PCR instrument Ring；72 DEG C extend 7min, carry out PCR reaction.Take 5 μ L PCR primer and carry out the agarose gel electrophoresis detection of 1%.

Part II:

2.1PCV2 the preparation of infection clones sub-thread cyclic DNA

1 part of PCV2 tests positive pathological material of disease STb gene is carried out respectively PCV2 genome MPRCA, PCV2 virus The enzyme action of DNA MPRCA product and coupled reaction (described in concrete steps 1.1,1.2), preparation PCV2 is infectious Clone's sub-thread cyclic DNA (GenBank accession number KJ867555), utilizes the above-mentioned DNA of conventional agarose gel electrophoresis detection (GenBank accession number KJ867555).

Result shows, PCV2 genome MPRCA product and expection size, band consistent (Fig. 1).

The enzyme action of 2.2PCV2 infection clones sub-thread circle DNA sequence is identified

Describing by concrete steps 1.2, MPRCA product carries out single endonuclease digestion experiment, utilizes conventional agarose gel electrophoresis showed enzyme action Result.

Result shows, it is thus achieved that a large amount of molecular weight are about the purpose band of 1.7kb size, in the same size with PCV2 Common genes group (Fig. 2), carry out glue recovery (reclaiming test kit explanation operation by OMEGA company agarose gel) subsequently, measure dense Be stored in after degree-20 DEG C standby.

2.3PCV2 infection clones sub-thread cyclic DNA checks order

Described in concrete steps 1.2, pSP72 plasmid carrying out conventional agarose gel electrophoresis after endonuclease reaction, glue reclaims mesh Band (2462bp) and measure concentration.Glue is reclaimed the pSP72 plasmid fragments and MPRCA product fragment obtained Be attached reaction by concentration than 1:3, it is thus achieved that connection product and DH5 α (Trans-CD201-Trans5 α Chemically Competent Cell) convert, use containing ammonia benzyl antibiotic (100 μ g/mL) LB solid medium, overnight train for 37 DEG C Supporting, picking grows single colony inoculation in the 5mL fluid medium containing Amp, and 12h cultivated by 37 DEG C of 220rpm shaking tables After, extract plasmid.

Showing (such as Fig. 3) through digestion verification result, after enzyme action, recombiant plasmid discharges about 1.7kb and 2.4kb band, respectively with PCV2 genome is consistent with the size of pSP72 plasmid.The plasmid of extraction is finally delivered to Nanjing Jin Sirui company survey Sequence, utilizes DNAstar software to sequencing result (name: HNLYYA1-MPRCA) be analyzed.

The coupled reaction of the PCV2 viral DNA MPRCA after 2.4 enzyme action

Glue after PCV2DNA MPRCA product enzyme action reclaims the fragment obtained be attached instead described in concrete steps 1.2 Should, regain ring-type PCV2 genome.

2.5PCV2DNA transfects PK-15 cell

Described in concrete steps 1, the sub-thread cyclic DNA of the PCV2HNLYYA1 strain obtained is transfected PK-15 cell.

2.5.1PCV2DNA the indirect immunofluorescene assay of PK-15 cell is transfected

PK-15 cell 0.25% trypsinization cultivated by Transfected cells culture bottle, is dispensed into 96 orifice plates, cultivates 24h for 37 DEG C, PBS washes 1 time, and change 10%DMEM continue cultivate, using PCV2 transfection PK-15 cell as positive control, Normal PK-15 cell is as negative control.Cell culture fluid is removed in 48h hypsokinesis, fixes 20 with cold methanol after PBS washing Min, discards fixative, is done by 96 orifice plate nature fine jades, is washed by fixing cell plates PBS, natural drying；Addition 1: The pig source PCV2 positive serum of 1000 dilutions, 37 DEG C of water-bath effect 1h, PBS wash 3 times, 5min/ time, pat dry；Add Diluting ELIAS secondary antibody goat-anti pig IgG-HRP with PBST 1:4000,37 DEG C of water-bath effect 45min, PBS washes 3 times, 5min/ Secondary, pat dry, fluorescence microscopy Microscopic observation.

Result shows, the PK-15 cell of PCV2HNLYYA1 strain sub-thread cyclic DNA transfection can be observed obvious green fluorescence letter Number (Fig. 4 B), and normal PK-15 cell does not has fluorescence signal (Fig. 4 A), shows that PCV2HNLYYA1 strain is at PK15 Replicating in cell, the virion of generation can identify pig source PCV2 positive serum, have PCV2 antigenicity.

2.5.2PCV2DNA PCR detection and Sequence Identification after transfection PK-15 cell

1) PCR detection after (describing by concrete steps 1.3) Secondary Culture is transfected

PK-15 cell 0.25% trypsinization cultivated by Transfected cells culture bottle, uses PBS to suspend and collects, -70 DEG C of preservations.Extract cell DNA and be stored in-20 DEG C.Use detection primer (describing by concrete steps 1.5) to extraction Cell DNA detects.

Result shows, can normally detect that PCV2 is positive (Fig. 5), show that PCV2 genome is with passage after transfection Cultivation carries out replicating propagation.

2) Sequence Identification after transfection also Secondary Culture

Extract the 6th generation band poison PK15 cell DNA after transfection Secondary Culture, carry out Sequence Identification and (retouch by case study on implementation 2.3 State) after by sequencing result (name: HNLYYA1-MPRCA-1) with MPRCA product sequencing result (name: HNLYYA1-MPRCA) comparison analysis.

Result shows, HNLYYA1-MPRCA-1 and HNLYYA1-MPRCA sequencing result is completely the same, sees Fig. 6, explanation The PCV2 genome that transfection and passage are cultivated does not changes, and stable.

2.6PCV2 collection virus

1), when cell covers with, bottle cap mouth ParafilmTM ,-80 DEG C of frozen 12h of refrigerator are cultivated.

2) melt under room temperature after 12h, put into-80 DEG C of refrigerator 1h after thawing, then melt under room temperature, 3 times repeatedly.

3) cell pyrolysis liquid melted is centrifuged, 4000rpm, 30min, gathers in the crops supernatant.

The pig challenge viral dosage of 2.7PCV2 virus

It is negative ternary piglet (male and female half and half) by the PCV2 antibody of 97 week old, average weight 7.1 kilograms, at random It is divided into 3 groups: 1 group, HNLYYA1 strain PCV2 virus group (MPRCA group) 3 for preparing of MPRCA method；2 groups, PCV2 wild type HNLYYA1 strain cell cultivation group (wild group) 3；3 groups, matched group 3.MPRCA group neck The PCV2 virus liquid 2ml that the virus infection clones that muscle of back injection utilizes MPRCA method to prepare obtains, matched group Nape portion intramuscular injection normal PK-15 cell suspension 2ml, wild type strains group nape portion's intramuscular injection wild type PCV2 are sick Venom 2ml.Mutually isolated raising.

After counteracting toxic substances, the 21st day (three weeks) slaughter after gathering blood, gather pig lymph node tissue, carry out DNA extraction, utilize Detection primer carries out the PCR detection of PCV2.Taking spleen and carry out virus purification, the virus of separation is judged to virus-positive, often group At least 7 swine diseases poison are separated into the positive (Fig. 7).

Result shows: detect in the pig lymphoid tissue of three weeks MPRCA groups and wild group after counteracting toxic substances that PCV2 is positive, normally It is positive (Fig. 7) that the pig lymphoid tissue of PK-15 groups of cells is not detected by PCV2.

After 2.8 counteracting toxic substances, the adenoid SABC of pig is identified

Selected materials is to determine, after PCR verifies, the pig lymph node tissue having HNLYYA1 strain PCV2 to infect, and negative control is The pig lymph node tissue infected without PCV2, conventionally fixes and makes paraffin section.Concrete SABC detection step Rapid as follows:

A. paraffin section, conventional dewaxing is to water.3%H₂O₂Hatch 10min with deionized water, cut eliminating the paraffin of above-mentioned material Endogenous peroxidase activity on sheet.

Soak 5min with distilled water flushing, PBS (0.01M pH=7.2) the most respectively, be subsequently placed in antigen retrieval buffers, repair for 95 DEG C Multiple 15min.

C. dropping lowlenthal serum is closed, and incubated at room 15min is inclined, do not washed.

D. the monoclonal antibody of the anti-PCV2VLPs that dropping PBS dilutes according to 1:600 as one resist, 37 DEG C hatch 2～3h or 4 DEG C overnight.PBS rinses 3 times, rinses 3min every time.

E. dropping biotin labeling sheep anti-mouse igg two resists, and room temperature or 37 DEG C hatch 10～15min.PBS rinses 3 times, rushes every time Wash 3min.

F. dropping Radix Cochleariae officinalis enzyme labelling strepto-avidin working solution, room temperature or 37 DEG C hatch 10～15min.PBS flushing 3 times, every time Rinse 3min.

G.DAB chromogenic reagent is also examined under a microscope, and terminates reaction in time.Tap water fully rinses.Haematoxylin dye liquor is multiple Dye 30s, is then dehydrated with graded ethanol, and dimethylbenzene is transparent.Mounting, observes.

Criterion: negative control produces brown color precipitation, quilt without specific chromogenic, the nucleus of positive control or cytoplasm reaction The SABC section result of inspection tissue is identical with positive control, is judged to the positive.

Result shows, nucleus or thin in the pig lymph node tissue section that HNLYYA1 strain PCV2 prepared by MPRCA method infects Brown color precipitation (Fig. 8 A, B) seen from endochylema, the pig lymph node tissue section that wild type HNLYYA1 strain PCV2 infects Middle nucleus or cytoplasm also show brown color precipitation (Fig. 8 C, D), and the pig lymph node tissue infected without PCV2 is (negative Comparison) in section nucleus or cytoplasm without specific chromogenic (Fig. 8 E, F).

Claims (3)

1. PCV2 virus strain infection based on an external rolling-circle replication sex clone builds test kit, it is characterised in that described examination Containing following primer in agent box:

PCV2 specific upstream primer: 5 '-CCATATGAAATAAATTACTGAG-3 '；

PCV2 specific Down Stream primer: 5 '-CAGCGCACTTCTTTCGTTTTCAG-3 '；

Random primer: 5 '-NNNNNN-3 '.

2. utilize the method that test kit described in claim 1 builds the sex clone of PCV2 virus strain infection, it is characterised in that described Method is to utilize the primer described in claim 1 to obtain the full base of PCV2 after PCV2 DNA is carried out many primers rolling circle amplification Because of group, then by full-length genome by the isolated and purified rear connection of single endonuclease digestion, and recirculation, it is built into PCV2 virus strain infection Sex clone.

3. method as claimed in claim 2, it is characterised in that described method is to extract from PCV2 strain or swine diseases material STb gene be template, with the PCV2 specific upstream primer described in claim 1, PCV2 specific Down Stream primer With random primer mixing, STb gene is carried out many primers rolling circle amplification, then the product of many primers rolling circle amplification is carried out EcoR I single endonuclease digestion, after being attached cyclisation, it is thus achieved that PCV2 genome after gel purification by digestion products DNA, this DNA transfect to PK15 cell again, it is thus achieved that the sex clone of PCV2 virus strain infection.