CN105861743B - A kind of kit and detection method for being used to detect hepatitis C virus nucleic acid of containing the internal standard - Google Patents
A kind of kit and detection method for being used to detect hepatitis C virus nucleic acid of containing the internal standard Download PDFInfo
- Publication number
- CN105861743B CN105861743B CN201610160974.5A CN201610160974A CN105861743B CN 105861743 B CN105861743 B CN 105861743B CN 201610160974 A CN201610160974 A CN 201610160974A CN 105861743 B CN105861743 B CN 105861743B
- Authority
- CN
- China
- Prior art keywords
- hepatitis
- kit
- nucleic acid
- probe
- internal standard
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
- C12Q1/706—Specific hybridization probes for hepatitis
- C12Q1/707—Specific hybridization probes for hepatitis non-A, non-B Hepatitis, excluding hepatitis D
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Communicable Diseases (AREA)
- Biotechnology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Virology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The kit and a kind of method of measurement detection hepatitis C virus nucleic acid that the invention discloses a kind of for detecting hepatitis C virus nucleic acid.UNG enzyme is used in kit in RT-PCR reaction solution and removes pollution products that may be present, can be generated to avoid false positive results, also make testing result more accurate；Reverse transcription and amplification are carried out with Tth enzyme system simultaneously, avoids the interference of dual-enzyme system reaction condition difference bring；This outer primer introduces nucleoside analog I base in the site that primer overlay area is easier to morph, and can avoid causing missing inspection because of hepatitis c virus gene mutation, while guaranteeing the detection sensitivity of different genotype sample；The internal standard of the designed entire pattern detection of participation avoids the generation of false negative result.Therefore the kit can highly sensitive, high specific the hepatitis C virus nucleic acid detected in human serum or plasma sample.Furthermore hepatitis C virus nucleic acid is detected using RT-PCR one-step method in detection method, reduces operating procedure and also shortens the operating time.
Description
Technical field
The present invention relates to the detections of hepatitis C virus nucleic acid.More specifically the present invention relates to one kind for detecting people's blood
Clearly, the primer sets of the hepatitis C virus nucleic acid in blood plasma, probe, kit and detection method；More particularly to it is highly sensitive, high
The curative effect monitoring of the infection and infection with hepatitis C virus treatment for clinical assistant diagnosis Hepatitis C Virus of specificity
Hepatitis C virus nucleic acid detection kit and detection method.
Background technique
For Hepacivirus in flaviviridae Hepacivirus, genome is single-stranded positive RNA, full-length genome
It is about 9.6kb.Hepatitis c virus gene group contains an open reading frame, more than coding 10 structure and non-structural protein, NS3 egg
White is a kind of multifunctional protein, and aminoterminal has proteinase activity, and c-terminus has helicase/nucleoside triphosphate enzymatic activity；
NS5B albumen is the RNA polymerase that RNA is relied on, and is needed for hepatitis c viral replication, is the important target position of antiviral therapy,
End has nucleotidyl transferase activity, but cannot correct mispairing since RNA enzyme lacks correcting function, easily leads to after multiple copies
The generation of a variety of variations of hepatitis C.Hepatitis C Virus can be divided into 6 genotype and more than 50 kinds of different subtypes at present, according to
The method of the current international practice indicates the genotype of Hepatitis C Virus with Arabic numerals, indicates gene with the English alphabet of small letter
Hypotype (such as 1a, 2b, 3a).
Hepatitis C is in global prevalence, is American-European and Japan and other countries End-stage liver disease main reason.According to the world
Health organization statistics, there are about 1.85 hundred million people to infect Hepatitis C Virus for estimation, wherein being chronic infection there are about 1.5 hundred million, has every year
Ten thousand people of 35-50 dies of hepatitis complication, annual new hair hepatitis C case about 3,000,000-400 ten thousand.1 type of genotype is in global
Distribution, 70% or more of Zhan Suoyou infection with hepatitis C virus.It is mainly common, wherein 1b type with 1b and 2a genotype in China
Based on, there are 1a, 2b and 3b type report in certain areas, and 6 types are mainly seen in Hong Kong and Macao.
The quantitative detection of Hepatitis C Virus is mainly used for the auxiliary diagnosis and hepatitis C virus of infection with hepatitis C virus
Poison carries the Treatment monitoring of patient.Whether auxiliary diagnosis has infected Hepatitis C Virus, the third type in infected person anteserum or blood plasma
The carrying capacity of hepatitis virus has decided on whether to need to carry out antiviral therapy to patient.After medication treatment, hepatitis C viral load
Variation tendency be also Treatment monitoring an important content.It requires hepatitis C virus virus detection method have high efficiency,
High sensitivity, high specific and accuracy.
Currently, there are domestic or import a variety of quantitative fluorescent PCR reagents on domestic market.Domestic reagent prevailing price is just
Preferably, but relative to import reagent, sensitivity is low, less reproducible, for lower virus load Hepatitis C Virus often
It can not accurately detect.Current import reagent prevailing at home is mainly the COBAS AmpliPrep/ of Roche
COBAS Taqman HCV test.COBAS Taqman HCV test is a kind of detection kit of automation.Kit tool
Have the advantages that high sensitivity, the range of linearity are wide, reproducible, detection is limited to 15IU/ml, detection range up to 43IU/ml~
6.9×107IU/ml.But its equipment is expensive, and testing cost is high, is also difficult at present in wide clinical application, especially less-developedly
The middle and small hospital in area.In addition, the Hepatitis C Virus level after treatment is likely lower than Roche COBAS Taqman HCV test
Monitoring lower-cut, so as to cause missing inspection.Therefore, for the existing situation in China, it is still desirable to which a price is relatively cheap, highly sensitive
Degree, high specific, reproducible hepatitis C virus nucleic acid detection kit and a kind of efficient detection Hepatitis C Virus
The method of nucleic acid, to instruct the clinical diagnosis and treatment of Hepatitis C Virus.
Summary of the invention
To solve the above-mentioned problems, a kind of highly sensitive, high specific for detecting the object of the present invention is to provide
The kit of hepatitis C virus nucleic acid and a kind of method of efficient detection hepatitis C virus nucleic acid.
A technical solution of the invention be to provide a kind of highly sensitive, high specific containing the internal standard for detecting the third type
The kit of HBV nucleic acid.The kit include: RT-PCR reaction solution, negative quality-control product, positive quality control product, calibration object and
Internal standard.
Wherein the RT-PCR reaction solution include: RT-PCR pre-reaction liquid, the first primer, the second primer, the first probe and
Second probe；
Wherein the first primer is the primer with nucleotide sequence shown in SEQ ID NO.1；Second primer is
Primer with nucleotide sequence shown in SEQ ID NO.2；First probe is with nucleotides sequence shown in SEQ ID NO.3
The probe of column, or the probe for the reverse complementary sequence with nucleotide sequence shown in the SEQ ID NO.3；Described second visits
Needle is the probe with nucleotide sequence shown in SEQ ID NO.4, or for nucleotide sequence shown in the SEQ ID NO.4
Reverse complementary sequence probe.5 ' ends of first probe and the second probe are marked using fluorophor, and described
3 ' ends of the first probe and the second probe are marked using quenching group.The fluorophor be FAM, Yakima Yellow,
Any one in ROX, CY5, CY3, NED, TAMRA, TAXAS RED, VIC, TET, HEX and JOE.The quenching group is
Any one in BHQ, TAMRA, DABCYL and MGB.The internal standard, which is diluted by internal standard pseudovirion with phosphate buffer, to be made
Standby to form, wherein internal standard pseudovirion is according to obtained by the artificial synthesized preparation of nucleotide sequence shown in SEQ ID NO.5.Institute
Stating RT-PCR pre-reaction liquid includes RT-PCR buffer, UNG enzyme, Tth enzyme, dNTPs and dUTP.The internal standard participates in hepatitis C
The overall process of viral nucleic acid detection, and it is 1E+4copies/ml that the interior target concentration is optimal.
Another technical solution of the invention is to provide a kind of to be carried out using primer described in mentioned reagent box and/or probe
The method of hepatitis C virus nucleic acid detection, the detection method include the following steps: that hepatitis C in sample is extracted and purified in (1)
Viral nucleic acid；(2) specific detection is carried out to extraction and purified hepatitis C virus nucleic acid；The wherein specific detection
Used primer and/or probe are as described below: wherein the primer includes the first primer and the second primer, and described first draws
Object is the primer with nucleotide sequence shown in SEQ ID NO.1；Second primer is with nucleosides shown in SEQ ID NO.2
The primer of acid sequence；The probe includes the first probe and the second probe, and first probe is with SEQ ID NO.3 institute
Show the probe of nucleotide sequence, or the probe for the reverse complementary sequence with nucleotide sequence shown in the SEQ ID NO.3；
Second probe is the probe with nucleotide sequence shown in SEQ ID NO.4, or for shown in the SEQ ID NO.4
The probe of the reverse complementary sequence of nucleotide sequence；5 ' ends of first probe and the second probe are marked using fluorophor
Note, and 3 ' ends of first probe and the second probe are marked using quenching group；The fluorophor be FAM,
Yakima Yellow, ROX, any one in CY5, CY3, NED, TAMRA, TAXAS RED, VIC, TET, HEX and JOE；Institute
Stating quenching group is any one in BHQ, TAMRA, DABCYL and MGB.Its further technical solution is: described special
Property be detected as using the RT-PCR reaction solution in mentioned reagent box to hepatitis C virus nucleic acid carry out real time fluorescent quantitative detection.
The method have the benefit that: the present invention provides a high sensitivity, false negative rate is low, the range of linearity
Extensively, the quantitatively accurate and high hepatitis C virus nucleic acid detection kit of precision and a kind of efficient detection Hepatitis C Virus core
The method of acid, wherein the kit is at low cost, detection time is short, is suitable for clinical labororatory and promotes；The detection method is quasi-
True rate is high, reduces operating procedure and shortens the operating time, and whether kit or detection method all have faces well
Bed prospect and market value.
Detailed description of the invention
Fig. 1 is the range of linearity of kit of the present invention, and the range of linearity that as a result can obtain kit of the present invention is 10IU/
Ml~1 × 109IU/ml。
Specific embodiment
Come that the present invention will be described in detail combined with specific embodiments below claimed technical scope, but the application and unlimited
In following specific embodiments.
(1) to reported Hepatitis C Virus full-length genome sequence in US National Biotechnology Information center (NCBI)
Column compare and analyze, and designed for detecting the primer sequence and the first probe sequence of hepatitis C virus nucleic acid, and manually close
At above-mentioned designed primer sequence and the first probe sequence:
The first primer: 5 '-GAGTAGIGTTGGGTIGCGAA-3 ' (SEQ ID NO.1)；
Second primer: 5 '-GTGCACGGTITACGAGACCTC-3 ' (SEQ ID NO.2)；
First probe: 5 '-TGCCTGATAGGGTGCTTGCGAGTGC-3 ' (SEQ ID NO.3).
Having used in the design of above-mentioned the first primer and the second primer can be avoided due to hepatitis c virus gene mutation
Cause the nucleoside analog I base of missing inspection, I base can be in conjunction with A/T/G/C base pairing, together in RT-PCR amplification procedure
When ensure that the detection of different genotype sample is highly sensitive.The I base is that (English name is deoxyinosine
It deoxyinosine), is the analog of G base, technology contents known to those skilled in the art, in the application no longer
It repeats.
(2) design is directed to interior the second probe sequence of target, and artificial synthesized second probe sequence:
Second probe: 5 '-ACCAGACACACGCTCACACCTCCC-3 ' (SEQ ID NO.4).
(3) internal standard template sequence is designed, and manually prepares internal standard pseudovirion referring to the internal standard template sequence:
1. internal standard template sequence is the nucleotide sequence as shown in SEQ ID NO.5:
5’-atcgtcctgggtggttatagcataattgggaacgacttgaactgagcttaactctttaatagccg
agtagtgttgggtcgcgaagaaggtttactctgaccagacacacgctcacacctcccgatagtgaggtctcgtaga
ccgtgcaccatgagcacgaatcctaaacctcaaagaaaaaccaatctgcaattatcaggcaagttccactcgcccg
tgacgaccaaac-3’(SEQ ID NO.5)
2. the nucleotide sequence referring to shown in SEQ ID NO.5 carries out the preparation of internal standard pseudovirion, preparation method can join
The method that documents and materials are reported is examined, the phosphate buffer for being then 8.0 with pH value is dilute by the internal standard pseudovirion prepared
1E+4copies/mL is released, using the good liquid of the dilution as the internal standard sample in the kit.
(4) nucleotide sequence of hepatitis C pseudovirion is designed, and manually prepares hepatitis C vacation referring to the sequence
Virion:
1. hepatitis C pseudovirion sequence is the nucleotide sequence as shown in SEQ ID NO.6:
5’-taatacgactcactatagggcgtcgagccatggcgttagtatgagtgtcgtacagcctccaggac
cccccctcccgggagagccatagtggtctgcggaaccggtgagtacaccggaattgccaggacgaccgggtccttt
cttggataaacccgctcaatgcctggagatttgggcgtgcccccgcaagactgctagccgagtagtgttgggtcgc
gaaaggccttgtggtactgcctgatagggtgcttgcgagtgccccgggaggtctcgtagaccgtgcaccatgagca
cgaatcctaaacctcaaagaaaaaccaaacgtaacaccaaccgtcgcccacaggacgtcaagttcccgggtggcgg
tcagatcgttggtggagtttacttgttgccgcgcaggggccctagattgggtgtgcgcgcgacgaggaagacttcc
gagcggtcgcaacctcgaggtagacgtcagcctatccccaaggcacgtcggcccg-3’(SEQ ID NO.6)
2. the nucleotide sequence referring to shown in SEQ ID NO.6 carries out the preparation of hepatitis C pseudovirion, preparation method
The method of biliographic data report, the hepatitis C pseudovirus that then will be prepared with the phosphate buffer that pH value is 8.0
Grain is diluted to suitable concentration, using the good liquid of the dilution as the hepatitis C virus particle sample of high level.
(5) hepatitis C virus nucleic acid standard items:
1.WHO plasmid standards for quantitation: purchase WHO plasmid standards for quantitation (WHO International Standard for 4th
WHO International Standard for Hepatitis C Virus for Nucleic Acid
Amplification Techniques, NIBSC code:06/102).It requires to be marked with 0.5ml DEPC water to specifications
Quasi- product redissolve, and obtain the sample of 260000IU/ml, then extremely by the clear commercially available negative standards' diluted plasma of the sample appearance
Suitable concentration.
2.WHO different genotype standard items: hepatitis c virus genotype disk (the Non WHO Reference of WHO is bought
Material 3nd HCV RNA Genotype Panel for Nucleic Acid Amplification
Techniques, NIBSC code:12/172).It is quantified using WHO plasmid standards for quantitation, it is then clear commercially available with appearance
Negative standards' diluted plasma is to suitable concentration.
(6) clinical sample of high level
It is quantified by the COBAS Taqman HCV test kit of Roche Holding Ag, uses the clear commercially available yin of appearance
Property standard plasma is diluted to suitable concentration.
(7) hepatitis C virus nucleic acid detection RT-PCR reaction solution
Including 5 × RT-PCR pre-reaction liquid, the first primer, the second primer, the first probe and the second probe.According to following tables
1 configuration RT-PCR reaction solution:
Table 1
| Reagent name | 1 test (μ L) | Ultimate density |
| 5 × RT-PCR pre-reaction liquid | 10 | 1× |
| The first primer (100 μM) | 0.5 | 1uM |
| Second primer (100 μM) | 0.5 | 1uM |
| First probe (50 μM) | 0.05 | 50nM |
| Second probe (50 μM) | 0.05 | 50nM |
| Pure water | 0.9 | —— |
It after the completion of preparation, is dispensed into PCR reaction tube by 12 μ l/ pipes, and the good sample of 38 μ l extraction purifications is added.
The fluorescence quantitative PCR instrument used is the SLAN-96P of the macro stone in Shanghai, augmentation detection program are as follows: 50 DEG C of 2min；60℃
25min；95℃1min；95 DEG C of 15s, 56 DEG C of 1min are acquired fluorescence (FAM and CY5), totally 50 circulations；25℃1min.
(8) selection of quality-control product
Negative quality-control product: the standard plasma of commercially available feminine gender, appearance clarification
Critical positive quality control product: hepatitis C pseudovirion sample is carried out using the standard plasma of commercially available feminine gender dilute
It releases, quantifies its concentration (using WHO plasmid standards for quantitation) in 50IU/ml~1000IU/ml.
Strong positive quality-control product: being diluted hepatitis C pseudovirion sample using the standard plasma of commercially available feminine gender,
Quantify its concentration (using WHO plasmid standards for quantitation) in 10000IU/ml~100000IU/ml.
(9) calibration object
Calibration object includes SPC1, SPC2, SPC3 and SPC4, using the standard plasma of commercially available feminine gender to hepatitis C pseudovirus
Particle specimens carry out 10 times of gradient dilutions, make its concentration SPC1, SPC2, SPC3 and SPC4 in 1000IU/ml~10000000IU/
It (is quantified using WHO plasmid standards for quantitation) between ml.Concentration differs about 10 times between each adjacent calibration object.
(10) the extraction purification kit of hepatitis C virus nucleic acid sample
The extraction purification of hepatitis c virus-like sheet using QIAGEN QIAamp Viral RNA Mini Kit (article No.:
52904), concrete operations carry out to specifications.
The implementation method of actual conditions is not specified in the following example, usually according to normal condition or kit factory
The method that family is recommended carries out.
Specific embodiment 1: the anti-pollution of the kit for detecting hepatitis C virus nucleic acid of containing the internal standard of the present invention
Dye ability
Using pure water by the Hepatitis C Virus amplified production gradient dilution of 424000000copies/ml at
1000000copies/ml, 100000copies/ml, 10000copies/ml, 1000copies/ml isoconcentration, are separately added into
In RT-PCR reaction solution in this kit, each concentration does 4 repetitions, and centrifugation mixes, and carries out RT-PCR augmentation detection.As a result
As shown in table 2, show that the sample of 10000copies/ml can illustrate the anti-of kit of the invention completely by UNG enzymic digestion
Pollution capacity is stronger.
2 contamination resistance of table
Specific embodiment 2: containing the internal standard of the present invention for detect hepatitis C virus nucleic acid kit it is minimum
Detection limit (LOD)
By WHO plasmid standards for quantitation (WHO International Standard for 4th WHO International
Standard for Hepatitis C Virus for Nucleic Acid Amplification Techniques,
NIBSC code:06/102) with negative plasma it is diluted to 20,10,5IU/ml.Using the QIAamp Viral RNA of QIAGEN
Mini Kit carries out the extraction purification of hepatitis C virus nucleic acid, and carries out augmentation detection, Mei Genong using kit of the present invention
The sample of degree repeats detection 24 times.The recall rate of sample under each concentration is calculated, so that it is determined that minimum detectability is (according to minimum detection
The minimum concentration of recall rate >=95% is set to minimum detectability by the definition of limit), the results are shown in Table 3.As can be seen from the results,
The recall rate that the recall rate of 10IU/ml sample can reach 100.00%, 5IU/ml sample can reach 91.67%, illustrate the present invention
The minimum detectability of kit is 10IU/ml.
3 detection limit of table
Specific embodiment 3: the kit for detecting hepatitis C virus nucleic acid of containing the internal standard of the present invention quantifies
It limits (LOQ)
WHO plasmid standards for quantitation is diluted to 10,20,30IU/ml with negative plasma.Using the QIAamp Viral of QIAGEN
RNA Mini Kit carries out the extraction purification of hepatitis C virus nucleic acid, and carries out augmentation detection using kit of the present invention, often
The sample of a concentration repeats detection 10 times.It is required that the sample of quantitative limit concentration must be detected all, and calculate pair of quantitative result
The coefficient of variation CV of numerical value and logarithm, and compared with the logarithm of theoretical value, the difference △ Log of the two is calculated, not by △ Log
It is quantitatively accurate to be considered as higher than ± 0.5log value, and quantitative accurate and CV may be set to quantitative limit less than 10%.Experimental result such as 4 institute of table
Show, when concentration of specimens is 10IU/ml, the quantitative accuracy rate of kit of the present invention is 100% and CV value less than 10%.Therefore,
Quantifying for kit of the present invention is limited to 10IU/ml.
4 quantitative limit of table
Specific embodiment 4: containing the internal standard of the present invention for detect hepatitis C virus nucleic acid kit it is linear
Range
The hepatitis C pseudovirion demarcated by WHO plasmid standards for quantitation is taken, it is dilute that gradient is carried out to it with negative plasma
It releases, from 4 × 109IU/ml is diluted to 1 × 109IU/ml、1×108IU/ml、1×107IU/ml、1×106IU/ml、1×105IU/
ml、1×104IU/ml、1×103IU/ml、1×102IU/ml,50IU/ml,20IU/ml,10IU/ml,5IU/ml.Using
The QIAamp Viral RNA Mini Kit of QIAGEN carries out the extraction purification of hepatitis C virus nucleic acid, and uses the present invention
Kit carries out augmentation detection, and each concentration makees 3 repetitions.Calculate the absolute deviation (△ of the logarithm of each concentration of specimens
Log): △ Log=TLog-MLog(TLogFor test result logarithm, MLogTo indicate log concentration value), if the concentration of specimens is exhausted
± 0.5log value is not higher than to deviation △ Log, and the CV of the logarithm between three repeated samples is not higher than 10%, then this concentration sample
This accuracy meets the requirements, and can be used for range of linearity analysis.Then with the logarithm of satisfactory concentration of specimens sign value
It is Xi with log concentration value with Ct value, Ct value is Yi, linear fit carried out, its linearly dependent coefficient r is calculated, if | r | >=
0.980, then the series of concentrations is within the range of linearity of this kit.The results are shown in Table 5 for detection data.
Table 5
It is found that testing result does not meet accuracy requirement, therefore it is not received when concentration of specimens is 5IU/ml from result
Enter within the range of linearity.By 10IU/ml~1 × 109The data of each concentration of IU/ml are fitted, as a result as shown in Figure 1.As a result
It has been shown that, R2=0.99929, r=0.9996 > 0.98.Therefore, obtain this kit the range of linearity be 10IU/ml~1 ×
109IU/ml。
Specific embodiment 5: the kit for detecting hepatitis C virus nucleic acid of containing the internal standard of the present invention is to difference
The covering of genotype
By hepatitis c virus genotype disk (the Non WHO Reference Material 3nd HCV RNA of WHO
Genotype Panel for Nucleic Acid Amplification Techniques, NIBSC code:12/172) in
1b, 2b, 3a, 4r, 5a and 6l genotype sample, it is quantitative using WHO plasmid standards for quantitation.With negative human plasma by each Sample Dilution
To 10IU/ml, the extraction for carrying out hepatitis C virus nucleic acid using the QIAamp Viral RNA Mini Kit of QIAGEN is pure
Change, and carry out augmentation detection using kit of the present invention, each concentration makees 24 repetitions.Calculate the recall rate of each genotype.
The results are shown in Table 6.As can be seen from the results, inspection of the kit of the present invention to 1b, 2b, 3a, 4r, 5a and 6l genotype sample
Extracting rate illustrates that kit of the present invention can detect 1~6 genotype 95% or more, and detecting limit is 10IU/ml.
The detection of 6 different genotype of table
Specific embodiment 6: the precision of the kit for detecting hepatitis C virus nucleic acid of containing the internal standard of the present invention
Degree
With negative plasma, by high level clinical sample, (the COBAS Taqman HCV test kit through Roche Holding Ag is carried out
It is quantitative) it is diluted to two different concentration: 100IU/ml and 10000IU/ml.Using the QIAamp Viral RNA of QIAGEN
Mini Kit carries out the extraction purification of hepatitis C virus nucleic acid, and carries out augmentation detection, Mei Genong using kit of the present invention
The sample of degree repeats detection 24 times respectively.The coefficient of variation (CV, %) of same concentration pattern detection result logarithm is calculated, as a result
As shown in table 7.It is respectively less than 5% using the coefficient of variation (CV, %) that kit of the present invention detects the sample of two concentration, illustrates this
Invention kit has preferable detection precision.
7 precision of table
The present invention provides a kind of highly sensitive, high specific kit for detecting hepatitis C virus nucleic acid and
A kind of method of efficient detection hepatitis C virus nucleic acid.The present invention using RT-PCR one-step method to hepatitis C virus nucleic acid into
Row detection, had both reduced operating procedure or had shortened the operating time, and the removal of UNG enzyme is used in RT-PCR reaction system may
Existing pollution products can generate to avoid false positive results in this way, also make testing result more accurate.The present invention is in RT-PCR
Reverse transcription and amplification are carried out using single Tth enzyme system in reaction system, eliminate the various reaction items of dual-enzyme system bring
The interference of part.Specific primer and probe in the present invention can detecte the UTR of conserved region in Hepatitis C Virus full-length genome
Area, and nucleoside analog I base is introduced in the site that primer overlay area is easier to morph, I base is expanded in RT-PCR
The missing inspection because caused by hepatitis c virus gene is unexpected can be can avoid, simultaneously in conjunction with A/T/G/C base pairing in the process
It ensure that the high sensitivity of different genotype pattern detection.Internal standard has also been devised in the present invention, internal standard participates in the whole of pattern detection
A process avoids the generation of false negative result.By RT-PCR reaction solution, negative quality-control product, positive quality control product, calibration object and interior
The kit of composition is marked, it can highly sensitive, high specific the Hepatitis C Virus core detected in human serum or plasma sample
Acid.
Those skilled in the art should be understood that invention described herein in addition to the content being expressly recited, also allow for variation and
Modification, especially equivalent change and modification.It should be understood that all such change and modification each fall within the present invention.
Claims (5)
1. a kind of containing the internal standard for detecting the kit of hepatitis C virus nucleic acid, it is characterised in that: the kit includes:
RT-PCR reaction solution, negative quality-control product, positive quality control product, calibration object and internal standard；
The RT-PCR reaction solution includes: RT-PCR pre-reaction liquid, the first primer, the second primer, the first probe and the second probe；
Wherein the first primer is the primer of nucleotide sequence shown in SEQ ID NO.1；
Wherein second primer is the primer of nucleotide sequence shown in SEQ ID NO.2；
Wherein first probe is the probe of nucleotide sequence shown in SEQ ID NO.3, or for shown in the SEQ ID NO.3
The probe of the reverse complementary sequence of nucleotide sequence；
Wherein second probe is the probe of nucleotide sequence shown in SEQ ID NO.4, or for shown in the SEQ ID NO.4
The probe of the reverse complementary sequence of nucleotide sequence；
Wherein the RT-PCR pre-reaction liquid includes RT-PCR buffer, UNG enzyme, Tth enzyme, dNTPs and dUTP；
Wherein the internal standard is prepared by the dilution of internal standard pseudovirion phosphate buffer, and wherein internal standard pseudovirion is
According to obtained by the artificial synthesized preparation of nucleotide sequence shown in SEQ ID NO.6.
2. a kind of kit for being used to detect hepatitis C virus nucleic acid of containing the internal standard according to claim 1, feature
Be: 5 ' ends of first probe and the second probe are marked using fluorophor, and first probe and second is visited
3 ' ends of needle are marked using quenching group.
3. a kind of kit for being used to detect hepatitis C virus nucleic acid of containing the internal standard according to claim 2, feature
Be: the fluorophor be FAM, YakimaYellow, ROX, CY5, CY3, NED, TAMRA, TAXAS RED, VIC, TET,
Any one in HEX and JOE.
4. a kind of kit for being used to detect hepatitis C virus nucleic acid of containing the internal standard according to claim 2, feature
Be: the quenching group is any one in BHQ, TAMRA, DABCYL and MGB.
5. a kind of kit for being used to detect hepatitis C virus nucleic acid of containing the internal standard according to claim 1, feature
Be: the internal standard participates in the overall process of hepatitis C virus nucleic acid detection.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610160974.5A CN105861743B (en) | 2016-03-21 | 2016-03-21 | A kind of kit and detection method for being used to detect hepatitis C virus nucleic acid of containing the internal standard |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610160974.5A CN105861743B (en) | 2016-03-21 | 2016-03-21 | A kind of kit and detection method for being used to detect hepatitis C virus nucleic acid of containing the internal standard |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105861743A CN105861743A (en) | 2016-08-17 |
| CN105861743B true CN105861743B (en) | 2019-08-16 |
Family
ID=56624784
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610160974.5A Active CN105861743B (en) | 2016-03-21 | 2016-03-21 | A kind of kit and detection method for being used to detect hepatitis C virus nucleic acid of containing the internal standard |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105861743B (en) |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109423526A (en) * | 2017-08-29 | 2019-03-05 | 湖北省疾病预防控制中心 | Mosquito matchmaker's infectious disease pathogens premix fluorescence PCR detection reagent and kit |
| CN107653344A (en) * | 2017-10-13 | 2018-02-02 | 杭州迪安医学检验中心有限公司 | A kind of nucleotide sequence and kit for HCV detection |
| CN108949960A (en) * | 2018-08-13 | 2018-12-07 | 郑州安图生物工程股份有限公司 | People's CYP2C19 genetic polymorphism detection kit |
| CN108977580A (en) * | 2018-08-13 | 2018-12-11 | 郑州安图生物工程股份有限公司 | A kind of kit of the quick detection hepatitis C virus nucleic acid of 2-8 DEG C of preservation |
| CN109593887B (en) * | 2018-12-29 | 2022-10-11 | 广州达安基因股份有限公司 | Kit for quantitative detection of hepatitis C virus nucleic acid |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2007084567A2 (en) * | 2006-01-17 | 2007-07-26 | The Government Of The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services | Detection and discrimination of hepatitis c virus, human immunodeficiency virus type-1 and hepatitis b virus |
| CN102154510A (en) * | 2011-02-25 | 2011-08-17 | 湖南圣湘生物科技有限公司 | Nucleic acid quantitative detection kit for hepatitis C virus (HCV) |
| CN102559930A (en) * | 2012-01-16 | 2012-07-11 | 中山大学达安基因股份有限公司 | Kit of detecting hepahtis C virus by fluorescence quantitative RT-PCR (reverse transcription-polymerase chain reaction) |
| CN103642942A (en) * | 2013-12-12 | 2014-03-19 | 东北制药集团辽宁生物医药有限公司 | High-precision nucleic acid quantitative detection kit for hepatitis C virus (HCV) |
| CN105400903A (en) * | 2015-12-08 | 2016-03-16 | 珠海丽珠试剂股份有限公司 | Primer set, probe and kit for detection of HBV nucleic acid and method for detection of HBV nucleic acid in sample |
-
2016
- 2016-03-21 CN CN201610160974.5A patent/CN105861743B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2007084567A2 (en) * | 2006-01-17 | 2007-07-26 | The Government Of The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services | Detection and discrimination of hepatitis c virus, human immunodeficiency virus type-1 and hepatitis b virus |
| CN102154510A (en) * | 2011-02-25 | 2011-08-17 | 湖南圣湘生物科技有限公司 | Nucleic acid quantitative detection kit for hepatitis C virus (HCV) |
| CN102559930A (en) * | 2012-01-16 | 2012-07-11 | 中山大学达安基因股份有限公司 | Kit of detecting hepahtis C virus by fluorescence quantitative RT-PCR (reverse transcription-polymerase chain reaction) |
| CN103642942A (en) * | 2013-12-12 | 2014-03-19 | 东北制药集团辽宁生物医药有限公司 | High-precision nucleic acid quantitative detection kit for hepatitis C virus (HCV) |
| CN105400903A (en) * | 2015-12-08 | 2016-03-16 | 珠海丽珠试剂股份有限公司 | Primer set, probe and kit for detection of HBV nucleic acid and method for detection of HBV nucleic acid in sample |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105861743A (en) | 2016-08-17 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105861743B (en) | A kind of kit and detection method for being used to detect hepatitis C virus nucleic acid of containing the internal standard | |
| CN111235316B (en) | Primer probe for identifying novel coronavirus and application of primer probe in triple fluorescence RPA | |
| CN106119413B (en) | AIDS virus multiple fluorescence PCR detection kit and detection method | |
| CN111500776A (en) | Novel coronavirus 2019-nCoV fluorescent RPA detection primer, probe, kit and method | |
| CN103275862A (en) | Fluorescent quantitative reverse transcription-polymerase chain reaction (RT-PCR) kit for detecting influenza A virus subtype H7N9 | |
| CN105400903B (en) | The method of HBV nucleic acid in primer sets, probe, kit and detection sample for detecting HBV nucleic acid | |
| CN108034764A (en) | Multiplex PCR detection Coxsackie virus, enterovirns type 71 and enterovirus universal primed probe group | |
| CN105420410B (en) | Detect primer sets, probe, kit and the detection method of hbv nucleic acid | |
| CN109777893A (en) | The invisible hepatitis B detection kit of droplet type digital pcr | |
| US20220195542A1 (en) | Use of primer probe combination and kit thereof in hbv detection | |
| CN108676913A (en) | A kind of human parainfluenza viruses' nucleic acid is hands-free to take gene parting detecting reagent | |
| CN107022651A (en) | The kit and its detection method of a kind of quick detection hepatitis C virus nucleic acid | |
| CN105713993A (en) | PCR primer set for detecting multiple respiratory viruses, probe set and kit | |
| CN108330212A (en) | A kind of primer sets, composition and kit for detecting hepatitis B | |
| CN108531647A (en) | A kind of zika virus one-step method fluorescence rt-PCR detection methods and kit | |
| CN105039599A (en) | Primers, probes and kit for typing qualitative detection of hepatitis B virus (HBV) | |
| CN105238880A (en) | Enterovirus real-time fluorescent quantitative detection kit | |
| CN103088151B (en) | Kit for hepatitis B virus four-color fluorescence quantitative PCR (polymerase chain reaction) assay and application | |
| CN111154920A (en) | Kit for detecting hepatitis B virus and special primer probe set thereof | |
| CN104561349B (en) | Method for flexibly detecting human papilloma virus genotypes in broad spectrum | |
| CN105525036B (en) | A kind of hepatitis b virus hbv real-time fluorescence nucleic acid isothermal amplification detection kit | |
| CN110241264A (en) | A kind of hepatitis type B virus (HBV) DNA immue quantitative detection reagent box | |
| CN113817870B (en) | Primer composition for simultaneously detecting seven respiratory tract related viruses and application thereof | |
| CN102108420A (en) | Fluorescence quantitative polymerase chain reaction (PCR) kit for detecting dengue virus type 1 | |
| CN108517375A (en) | A kind of double probe compositions and kit for detecting hepatitis B |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |