CN105859846B - There is the polypeptide and application thereof of binding affinity to HPV16 E7 - Google Patents

Abstract

The present invention relates to the polypeptides and application thereof that a kind of couple of HPV16 E7 has binding affinity.The E7 albumen for disclosing a kind of couple of HPV16 for the first time has the polypeptide of binding affinity；Diagnosis or therapeutical uses the present invention also provides the polypeptide as drug or molecular targeted reagent.

Description

There is the polypeptide and application thereof of binding affinity to HPV16 E7

Technical field

The present invention relates to biomedicine fields, more particularly it relates to which a kind of couple of HPV16 E7 has combination affine Polypeptide of power and application thereof.

Background technique

Cervical carcinoma is a kind of main cancer relevant to human papilloma virus (HPV) infection that the whole world is generally acknowledged, and the death rate exists Second is in global woman cancer.In the prior art, although the cancer, prophylaxis vaccine based on HPV L1 albumen has been engaged in trade Industry, but the therapeutic vaccine based on HPV and its E7 are still in the experimental study exploratory stage.And the problem is that: it is therapeutic Vaccine, which plays a role, to be built upon on body's immunity basis, more strong with tumour specific antigen or epitope excitation Antineoplastic specificity immunological effect, to achieve the purpose that remove tumour cell；But often there is autoimmune function in tumour patient Lowly or immunosupress or immunologic escape etc. and so that therapeutic vaccine is played a role limited, it is difficult to reach expected therapeutic purposes.

Targeted therapy is most desired method and strategy in current treatment of human cervical cancer, mainly includes following several types: (1) EGF-R ELISA (EGFR) is the treatment of target spot: EGFR is related with intracellular signal transduction, and it is normal to play adjusting The growth and differentiation of cell, enhancing invasive ability of tumor cell promote angiogenesis, inhibit the effects of apoptosis of tumor cells, and make Its novel targets for becoming a variety of human tumor diagnosing and treatings including cervical carcinoma.Currently, the oncotherapy of targeting EGFR Drug is broadly divided into two classes: EGFR monoclonal antibody and small molecule compound tyrosine kinase antagonist.Wherein monoclonal antibody Predominantly HER2 monoclonal antibody, including Herceptin (Trastuzumab, Herceptin) and Cetuximab etc.；And small molecule Compound mainly includes Gefitinib, Imatinib and erlotinib etc..(2) using Tumor Angiongesis as the treatment of target spot: swollen The growth of oncocyte and transfer depend on the formation of blood vessel, thus anti-angiogenesis be also neoplasm targeted therapy research hot spot it One.Such as 1. bevacizumab (rhuMAb-VEGF), a kind of Humanized monoclonal antibodies IgG1, passes through and inhibit VEGF bioactivity Inhibit angiogenesis, bevacizumab single therapy or with other chemotherapy drugs in combination application can reduce Tumor Angiongesis.② Sutent, a kind of multiple receptor tyrosine kinases inhibitor, by inhibiting the tyrosine kinase activity of VEGF R to specificity Cellular Signaling Transduction Mediated is blocked to play antitumor action.

In short, molecular targeted therapy can killing tumor cell to the maximum extent, be effectively reduced recurrence and the distant place of tumour The risk of transfer improves the survival rate of patient and improves total life span of patient.Although being based on monoclonal antibody and its small point The targeted molecular treatment of sub-piece has apparent advantage, but there is also deficiencies, comprising: (1) permeability is inadequate: limitation antibody The big solid tumor of penetration volume；(2) target site exosmoses: causing antibody in the extravasation of target site since vascular permeability reduces；(3) malicious Side effect: the non-specific binding of antibody on normal tissues and generate cross reaction, reduce Targeting Effect；(4) it removes in vivo: The antibody of injection, which is metabolized, to be improved, and therapeutic effect is reduced；(5) immunogenicity of antibody: antibody induction body generates anti-human antibody, Inactivate therapeutic antibodies.Due to cross reaction and the formation of immune complex, the poisonous effect for generating toxic side effect is It is directed to the major obstacle of cancer therapeutic antibody as development, generates liver, kidney and nervous system toxicity and makes the reduction of its function.Such as Cardiac toxic effect relevant to HER2 targeting antibodies trastuzumab (Herceptin).It is put with isotope marked antibodies The immunization therapy of penetrating property also results in bone marrow suppression.

Therefore, the novel drugs or new method of magnetic target therapy HPV related neoplasms disease are still urgently studied in this field, to change It is apt to current clinical status.

Summary of the invention

The purpose of the present invention is to provide the polypeptides and application thereof that a kind of couple of HPV16 E7 has binding affinity.

In the first aspect of the present invention, the E7 albumen for providing a kind of pair of HPV 16 (HPV16), which has, to be combined The polypeptide of affinity, the polypeptide be using the amino acid sequence of staphylococcal protein A (SPA) Z sections (Z structural domain) as skeleton, into The polypeptide obtained after row 12-20 (preferably 13-16, such as 14,15) amino acid variation.

In a preferred embodiment, described relative to Z sections of staphylococcal protein A of amino acid sequence (SEQ ID NO:5) Have the polypeptide of binding affinity in 9-11,13-14,17-18,24-25,27- in the E7 albumen of HPV 16 28,32,35,43 upper generation amino acid mutations.

In another preferred example, described to human papilloma virus relative to Z sections of staphylococcal protein A of amino acid sequence The E7 albumen of malicious 16 types has the polypeptide of binding affinity:

9th amino acids sport S or W；

10th amino acids sport F, L or V；

11st amino acids sport E, L or W；

13rd amino acids sport R, I or S；

14th amino acids sport S, L, M or A；

17th amino acids sport W or R；

18th amino acids sport A, W, T or Q；

24th amino acids sport G, R, D or P；

25th amino acids sport D, L, H or G；

27th amino acids sport G, V, A or Q；

28th amino acids sport R, E or L；

32nd amino acids sport L, V or E；

35th amino acids sport G, H, Q or D；

43rd amino acids sport E or K.

In another preferred example, the E7 albumen to HPV 16 has the polypeptide of binding affinity Shown in amino acid sequence such as SEQ ID NO:1-4 is any.

In another preferred example, the E7 albumen to HPV 16 have binding affinity polypeptide with The K of the E7 protein-interacting of HPV 16_DValue is 1 × 10^-6M to 1 × 10^-7M。

In another aspect of this invention, a kind of targeting molecule targeting HPV 16, the target are provided Tropism molecule includes any polypeptide in front, and the conjugate of (or coupling) of being connected with the polypeptide, the coupling Object includes but is not limited to: cysteine residues, Polypeptide tags, inhibits the drug of HPV 16, or detectable mark Remember object (such as fluorescent marker, enzyme, biotin or radioactive isotope).

In a preferred embodiment, the conjugate is peptide, the conjugate and described to human papilloma virus 16 There is the E7 albumen of type the polypeptide of binding affinity to constitute fused polypeptide.

In another preferred example, the Polypeptide tags include but is not limited to: His label (such as 6 × His), Myc label, GST label, Flag label.

In another preferred example, the enzyme includes but is not limited to: alkaline phosphatase or horseradish peroxidase.

In another preferred example, the drug of the inhibition HPV 16 includes but is not limited to: toxin；Compared with Goodly, the toxin is with the toxin for inhibiting HPV 16 virus infection or function of tumor inhibition, such as diphtheria poison Element, ricin (WA), Pseudomonas Exotoxin or the toxin functional fragment；And the tumour is human papilloma virus The tumour of the 16 types positive.

In another preferred example, it is green that the toxin, which is the functional fragment of Pseudomonas aeruginosa Exotoxin A or the toxin, The active fragment PE38KDEL of purulence bacillus exotoxin A.Preferably, the Pseudomonas aeruginosa Exotoxin A or its functional fragment are connected to The E7 albumen to HPV 16 has the carboxyl terminal (C-terminal) of the polypeptide of binding affinity.

In another preferred example, the conjugate and the E7 albumen to HPV 16, which have, combines The polypeptide of affinity is connected with flexible peptide, and the flexibility peptide includes but is not limited to: (Gly₄Ser)₃。

In another aspect of this invention, a kind of isolated polynucleotides are provided, coding front is any described to human milk The E7 albumen of head 16 type of tumor virus has the polypeptide of binding affinity.

In another aspect of this invention, a kind of polynucleotides, the coding targeting HPV 16 are provided Targeting molecule, and the wherein described conjugate is peptide.

In another aspect of this invention, a kind of recombinant vector is provided, which includes the polynucleotides.

In another aspect of this invention, a kind of host cell is provided, the host cell include the recombinant vector or its Include or genome in be integrated with the polynucleotides.

In another aspect of this invention, it provides and a kind of prepares any E7 egg to HPV 16 in front The method of the white polypeptide with binding affinity, which comprises (1) the culture cell, thus pair that expression is described The E7 albumen of HPV 16 has the polypeptide of binding affinity；(2) polypeptide of (1) acquisition is isolated and purified.

In another aspect of this invention, providing the E7 albumen to HPV 16 has binding affinity Polypeptide or the described targeting HPV 16 targeting molecule purposes, be used to prepare treatment human papilloma virus The drug of 16 types infectious disease or HPV 16 expression positive tumor；Or

It is used to prepare the detection reagent of detection HPV 16 virus infection；Or

It is used to prepare 16 type of diagnosis of human papilloma viral infectious disease or HPV 16 expresses positive tumor Diagnostic reagent.

In a preferred embodiment, in the targeting molecule of the targeting HPV 16, the conjugate It is the drug or anti-tumor drug (such as toxin) for inhibiting HPV 16, the E7 to HPV 16 There is albumen the polypeptide of binding affinity or the targeting molecule of the targeting HPV 16 to be used to treat human milk Head 16 type of tumor virus infectious disease or HPV 16 express positive tumor.

In another preferred example, in the targeting molecule of the targeting HPV 16, the conjugate It is detectable marker (such as fluorescent marker or enzyme), the E7 albumen to HPV 16 has binding affinity Polypeptide or the targeting molecule of the described targeting HPV 16 infect disease for 16 type of diagnosis of human papilloma viral Disease or HPV 16 express positive tumor.

In another preferred example, the described HPV 16 expression positive tumor includes: that cervical carcinoma, incidence are swollen Tumor or external genital organs tumour etc..

In another preferred example, the HPV 16 infection disease includes: cervical intraepithelial neoplasia (CIN) Or external genital organs wart etc..

In another aspect of this invention, a kind of pharmaceutical composition is provided, it includes: it is mentioned-above to human papilloma virus The E7 albumen of 16 types has the polypeptide of binding affinity or the targeting molecule of the targeting HPV 16；And medicine Acceptable carrier on.

In another aspect of this invention, it provides a kind of for diagnosing or treating HPV 16 infection disease or people 16 type of papillomavirus expresses the medicine box of positive tumor, includes: described in the medicine box to HPV 16 E7 albumen has the polypeptide of binding affinity or the targeting molecule or described of the targeting HPV 16 Pharmaceutical composition.

In a preferred embodiment, the E7 albumen to HPV 16 have binding affinity polypeptide or The targeting molecule of the targeting HPV 16 is a effective amount of.

In another aspect of this invention, it provides and a kind of treats HPV 16 infection disease or human papilloma virus 16 types express positive tumor, including by the E7 albumen to HPV 16 have binding affinity polypeptide or The targeting molecule of the targeting HPV 16 gives object in need for the treatment of.

In another aspect of this invention, a kind of 16 type of diagnosis of human papilloma viral infectious disease or human papilloma virus are provided 16 types express positive tumor, in need for the treatment of right including giving the targeting molecule of the targeting HPV 16 As；In the targeting molecule, the conjugate is detectable marker (such as fluorescent marker or enzyme).

Other aspects of the invention are apparent to those skilled in the art due to this disclosure 's.

Detailed description of the invention

Fig. 1, each Z_HPV16E7And Z_wtThe comparison of sequence.Polypeptide Z of the invention_HPV16E7In the amino acid sites that are modified exist Oneself marks (SEQ ID NO:1-4) with black matrix in figure.

The construction of recombinant plasmid figure (A) and amino acid sequence schematic diagram of the fused polypeptide generated in Fig. 2, embodiment 1 (B)。

Z_HPV16E7Representing has the HPV16E7 binding structural domain selected from SEQ ID NO:1-5 any sequence, and 6xHis is represented Six groups of ammonia phthalein labels, HM represent the amino acid of NdeI (CATATG) translation, and LE represents the amino acid of XhoI (CTCGAG) translation.

Fig. 3, pET21a (+)/affibody recombinant plasmid electrophoretogram.

M1:DNA marker；1-5 is respectively pET21a (+)/Z_HPV16E7:127、pET21a(+)/Z_HPV16E7:301、pET21a (+)/Z_HPV16E7:384、pET21a(+)/Z_HPV16E7:745And pET21a (+)/Z_wtRecombinant plasmid.

Fig. 4, Affibody recombinant protein prokaryotic expression (A) and the SDS-PAGE electrophoretic analysis for purifying (B).

In A: M: albumen marker；1-2 is respectively the BL21 of BL21 (DE3) bacterial strain and the transfection of pET21 (+) empty carrier (DE3) bacterial strain, 3-8 are respectively pET21a (+)/Z_HPV16E7:127、pET21a(+)/Z_HPV16E7:301、pET21a(+)/Z_HPV16E7:384、 pET21a(+)/Z_HPV16E7:745And pET21a (+)/Z_wtTransfected Recombinant Plasmid BL21 (DE3) bacterial strain.

In B: M: albumen marker；1-5 respectively after purification Z_{HPV16 E7:127}, Z_{HPV16 E7:301}, Z_{HPV16 E7:384}, Z_{HPV16 E7:745}And Z_wtAffibody recombination fusion protein.

The SDS-PAGE electrophoresis and Western Blot of Fig. 5, HPV16E7 recombinant protein are analyzed.

M:marker；1.E.coli.BL21 (DE3) bacterial strain；2. recombinant plasmid pET21a (+)/HPV16E7 protein expression； 3. HPV16E7 recombination fusion protein after purification.A:SDS-PAGE；B:Western Blot analysis, primary antibody be His monoclonal antibody (1: 10000)；C:Western Blot analysis, primary antibody are cervical cancer patient serum (1:500).

Fig. 6, Z_{HPV16 E7}In conjunction with SPR detection of the polypeptide on ProteOn XPR36 instrument.

A, B, C, D, E are respectively Z_{HPV16 E7:127}、Z_{HPV16 E7:301}、Z_{HPV16 E7:384}、Z_{HPV16 E7:745}And Z_wtAlbumen and target egg The affinity analysis of white HPV16E7.

Fig. 7, Z_{HPV16 E7}It is identified in conjunction with the cellular immunofluorescence method of polypeptide and HPV16 E7 native protein affinity.

A:Z_{HPV16 E7:127}In conjunction with the indirect immunofluorescene assay of polypeptide；B:Z_{HPV16 E7:301}The indirect immunofluorescence of albumen is examined It surveys；C:Z_{HPV16 E7:384}The indirect immunofluorescence of albumen；D:Z_{HPV16 E7:745}The indirect immunofluorescene assay of albumen；E:HPV16E7 Rabbit antibody is the indirect immunofluorescene assay of primary antibody.

The Z of Fig. 8, Dylight755 label_{HPV16 E7:384}In conjunction with polypeptide SDS-PAGE electrophoresis and fluorescence analysis.

A is Z_{HPV16 E7:384}Polypeptide SDS-PAGE electrophoretic analysis；B is the Z for marking Dylight755_{HPV16 E7:384}Polypeptide SDS- The fluorescence analysis of PAGE electrophoresis.

The Z of Fig. 9, Dylight755 label_{HPV16 E7:384}Bio distribution and cancer target of the polypeptide in tumor bearing nude mice at As analysis.A is the Z of Dylight755 label_{HPV16 E7:384}Polypeptide each time point respectively load Siha, Caski, HeLa229 and The intracorporal fluorescence imaging of A375 cell tumor bearing nude mice；B is each time point respectively in load Siha, Caski, HeLa229 and A375 The intensity of the intracorporal average fluorescence signal of cell (according to top-down order) tumor bearing nude mice.

The Z of Figure 10, Dylight755 label_{HPV16 E7:384}Imaging of the polypeptide in each internal organs of tumor bearing nude mice and tumor tissues Analysis.A1-D1 is the Z in injection Dylight755 label_{HPV16 E7:384}Polypeptide for 24 hours after, each main group in the nude mice of load tumour Knit the fluorescence distribution in internal organs；A2-D2 is the intensity of the average fluorescence signal of corresponding tumor tissues and each internal organs.

Figure 11, four kinds of Z_{HPV16 E7}It is analyzed in conjunction with IC50 of the polypeptide to Siha cell.A, B, C, D are respectively Z_{HPV16 E7:127}、 Z_{HPV16 E7:301}、Z_{HPV16 E7:384}And Z_{HPV16 E7:745}Albumen analyzes the IC50 of Siha cell.

Figure 12, various concentration Z_{HPV16 E7}In conjunction with polypeptide to the growth inhibition effect of Siha cell.A, B, C, D are respectively difference The Z of concentration_{HPV16 E7:127}、Z_{HPV16 E7:301}、Z_{HPV16 E7:384}And Z_{HPV16 E7；745}Growth inhibition effect of the albumen to Siha cell.

Figure 13, pET21a (+)/Z_{HPV16 E7}Affitoxin construction of recombinant plasmid figure.

Figure 14, Z_{HPV16 E7}Affitoxin protein SDS-PAGE electrophoresis and WB identification.

A:1, BL21 (DE3) bacterial strain；The BL21 (DE3) of 2, pET21a (+) carriers conversion；3-7 be respectively pET21a (+)/ HPV16 E7affitoxin127,301,384,745 and Z_wtBL21 (DE3) bacterial strain of affitoxin Transfected Recombinant Plasmid；

B:Z_{HPV16 E7}Affitoxin127,301,384,745 and Z_wtAffitoxin purifying protein SDS-PAGE electrophoresis Figure；1-5 is respectively Z_{HPV16 E7}Affitoxin127,301,384,745 and Z_wtaffitoxin；

C: for Z_{HPV16 E7}Affitoxin127,301,384,745Western blot analysis (primary antibody is His monoclonal antibody), 1 is BL21 (DE3) bacterial strain, 2 BL21 (DE3) converted for pET21a (+) carrier, 3-6 is respectively Z_{HPV16 E7}affitoxin127, 301,384,745；

D: for Z_wtAffitoxin albumen Western blot analysis (primary antibody is His monoclonal antibody), 1 is BL21 (DE3) bacterial strain, 2 BL21 (DE3) converted for pET21a (+) carrier, 3 be Z_wtAffitoxin albumen.

E:HPV16 E7-affitoxin albumen Western blot analysis (primary antibody is rabbit-anti SPA-Z mostly anti-), 1 is BL21 (DE3) bacterial strain 2 is the BL21 (DE3) of pET21a (+) carrier transfection, and 3-6 is respectively HPV16 E7affitoxinE127,301, 384,745.

F: for Z_wtAffitoxin albumen Western blot analysis (primary antibody is rabbit-anti SPA-Z mostly anti-), 1 is BL21 (DE3) bacterial strain, 2 BL21 (DE3) converted for pET21a (+) carrier, 3 be Z_wtAffitoxin albumen.

Figure 15, Z_{HPV16 E7}Affitoxin and the cellular immunofluorescence of HPV16 E7 native protein affinity are identified.A: Z_{HPV16 E7}Affitoxin127 albumen；B:Z_{HPV16 E7}Affitoxin301 albumen；C:Z_{HPV16 E7}Affitoxin384 albumen；D: Z_{HPV16 E7}745 albumen of affitoxin.

Figure 16, Z_{HPV16 E7}SPR detection of the affitoxin albumen on ProteOn XPR36 instrument.A, B, C, D, E distinguish For Z_{HPV16 E7}Affitoxin127,301,384,745 and Z_wtAffitoxin protein is affine with target protein HPV16E7's Power analysis.

Figure 17, Z_{HPV16 E7}Affitoxin384 analyzes the IC50 of Caski cell (A) and Siha cell (B).

Figure 18, Z_{HPV16 E7}Influence of the affitoxin384 to four kinds of growth of tumour cell.

Figure 19, various concentration Z_HPV16E7Growth inhibition effect of the affitoxin384 to Siha (A) and Caski (B) cell.

Z in Figure 20, blood plasma_HPV16E7: 384 (B) and Z_HPV16E7Affitoxin384 (A) half-life period is detected.

Figure 21, Z_{HPV16 E7}Tumor-inhibiting action effect of the affitoxin384 to Balb/c tumor bearing nude mice.

A: five groups of mouse are while being inoculated with Siha, the Z of tail vein injection 4mg/kg concentration_HPV16E7Affitoxin384 or Z_HPV16E7: 384, PE38KDEL albumen, Z_wtAffitoxin albumen and PBS, it is primary every injection in 3 days, totally 6 times, arrow in figure It is shown.

B: five groups of mouse are long to 100~200mm to tumour after being inoculated with Siha³When size, tail vein injection 4mg/kg is dense The Z of degree_HPV16E7Affitoxin384 or Z_HPV16E7: 384, PE38KDEL albumen, Z_wtAffitoxin albumen and PBS, every 3 days Injection is primary, and totally 6 times, in figure shown in arrow.

Specific embodiment

The present inventor passes through in-depth study, discloses the E7 egg of a kind of pair of HPV 16 (HPV16) for the first time The white polypeptide with binding affinity；Diagnosis or treatment the present invention also provides the polypeptide as drug or molecular targeted reagent Purposes.

As used herein, " polypeptide to HPV16 E7 with binding affinity " refers to staphylococcal protein A Z The amino acid sequence of section carries out the polypeptide obtained after 10-20 amino acid variation as skeleton, and the polypeptide specific can be tied Close HPV16 E7, have it is few or do not have non-specific binding.

As used herein, " polypeptide of the invention ", " to HPV16 E7 have binding affinity polypeptide ", " HPV16 E7 combination polypeptide ", " Z_HPV16E7Affibody polypeptide ", " Z_HPV16E7affibody”、“Z_HPV16E7", " affibody egg It is white ", " affibody recombinant protein ", " Z_{HPV16 E7}Recombinant protein " may be used interchangeably.

As used herein, " targeting molecule ", which refers to, has binding affinity to HPV16 E7 for of the invention Molecule that polypeptide obtains after connecting with other functional conjugates, that HPV16 E7 can be targeted.The conjugate can be Cysteine residues, Polypeptide tags inhibit the drug of HPV 16, enzyme or detectable marker etc..

As used herein, " fused polypeptide " is the subordinate concept of " targeting molecule ", refers to the present invention To HPV16 E7 have binding affinity polypeptide and other functional peptides (such as toxin protein or functional protein segment) Molecule obtained after connection, that HPV16 E7 can be targeted.

The infection of HPV16 type is the main type for causing cervical carcinoma.After HPV infection host cell, viral gene is integrated into place Main chromosome, and then make host cell mutate and develop for tumour, carcinogenic chief molecule first is that HPV gene The E7 albumen of early stage area (E) coding, E7 albumen mainly pass through the conserved sequence LXCXE of its aminoterminal in conjunction with cancer suppressor protein pRb, It dissociates the transcription factor E2F under normal condition in conjunction with Rb to come, and inactivates pRb albumen, the E2F of dissociation can activated gene Transcription, promote it is numerous it is cell proliferation related because transcription, cause cell hyperproliferation vicious transformation.High-risk HPV E7 egg White is the tumor antigenicity albumen of cervical carcinoma caused by HPV, is continued simultaneously steadily in cervical carcinoma and its Precancerous Lesion in high table It reaches, and is not present in the normal tissue.Comprehensively consider above-mentioned factor, the present inventor selects HPV16 E7 as target antigen.This hair Bright people is with the Z structural domain (Z of staphylococcal protein A_wt, SEQ ID NO:1) and it is used as bracket, its surface amino groups acid residue is simulated anti- Body binding site carries out random mutation, mutated library is constructed by display technique of bacteriophage, using HPV16 E7 as target antigen pair The library carries out affine screening, and by a large amount of screening operation, being finally obtained has high affinity for HPV16 E7 Polypeptide.

Polypeptide of the invention is to carry out 14-20 using the amino acid sequence of staphylococcal protein A Z structural domain as skeleton The polypeptide obtained after (preferably 14) amino acid variation.As preferred embodiment of the invention, polypeptide of the invention relative to The amino acid sequence (SEQ ID NO:5) that Z sections of staphylococcal protein A, in 9-11,13-14,17-18,24-25,27-28, 32,35,43 upper generation amino acid mutations.It is highly preferred that polypeptide of the invention have SEQ ID NO:1-4 it is any shown in ammonia Base acid sequence.

Present invention also contemplates that volume is added in the amino acid sequence either end of the HPV16 E7 combination polypeptide or both ends Outer amino acid residue and the polypeptide formed.These additional amino acid residues can be acted as in polypeptide combination HPV16 E7 With, but other purposes can also be equally used for, such as it is related to the production, purifying, stabilization, one kind or several of coupling or detection of the polypeptide Kind.These additional amino acid residues may include the amino acid residue that one or more are added for chemical coupling purpose.Such as It is added in first of polypeptide chain or last position, i.e., adds cysteine residues etc. in N or C-terminal.It is this additional Amino acid residue also may include one " label " for peptide purification or detection, such as six groups with labelled antibody interaction Propylhomoserin peptide (His₆) label, or " myc " label or " flag " label.In addition, other alternatives well known to those skilled in the art Formula is also included in the present invention.

" the additional amino acid residue " also may make up one or more polypeptide domains with expectation function, such as with First, the identical binding function of HPV16E7 binding structural domain or other binding functions or a kind of enzymatic functions, or A kind of fluorescent functional or a combination thereof.

The present invention is also contained on the basis of the HPV16 E7 combination polypeptide, is modified and then increases it in alkaline condition Under stability polypeptide.This stability includes being substituted in not with amino acid residue less sensitive for alkaline condition fixed point There is any asparagus fern phthalein amine residue occurred in the sequence of modification.Since affinity column will be subjected to frequently between different reactions Highly basic handle to be eluted, this characteristic that sensibility is reduced to alkali is conducive to use polypeptide of the invention as affine Affinity ligand in chromatography is able to extend the service life of affinity chromatography matrices.

The present invention is also contained on the basis of HPV16 E7 combination polypeptide of the invention, obtain after other modifications more Peptide.These modification (not changing primary structure usually) forms include: the chemical derivative form such as acetyl of internal or external polypeptide Change or carboxylated.Modification further includes glycosylation, is carried out in the synthesis and processing of polypeptide or in further processing step such as those Glycosylation modified and generation polypeptide.This modification can carry out glycosylated enzyme (such as mammal by the way that polypeptide to be exposed to Glycosylase or deglycosylation enzyme) and complete.Modified forms further include with phosphorylated amino acid residue (such as phosphoric acid junket ammonia Acid, phosphoserine, phosphothreonine) sequence.It further include being modified to improve its anti-proteolytic properties or optimization The polypeptide of solubility property.

HPV16 E7 combination polypeptide of the invention can be connect with conjugate, so that functional targeting molecule is constituted, This connection can be connected or be adsorbed by chemical bond (including peptide bond)；The chemical bond is covalent bond or non-covalent bond.As A kind of preferred embodiment, is keyed by peptide, to form fused polypeptide.

It can be connected directly between the HPV16 E7 combination polypeptide and conjugate, or pass through polypeptide linker (link peptide) connection.The connexon is for example including 1-30 amino acid；Preferably 1-20 amino acid.Link peptide is set Set the activity for having no substantial effect on each polypeptide in fusion protein.Preferably, can use flexible peptide (Gly₄Ser)₃It is attached. Other link peptides well known to those skilled in the art can also be applied to the present invention.

In " heterologous " fused polypeptide, the HPV16 E7 combination polypeptide constitutes first structural domain or first portion Point, second and other parts have in addition to combine HPV16 E7 other than other functions, these expected results are also in the present invention In the range of.Second and other parts of the fused polypeptide may be comprising having parent to other target molecules other than HPV16 E7 With the binding structural domain of power.This binding structural domain may also be related to SPA structural domain, but has 1 to about 20 position Replace mutation.The result is that fused polypeptide has at least one HPV16 E7 binding structural domain and at least one and other target molecules Structural domain with affinity.This extends the application of polypeptide of the invention, such as treatment preparation or as capture, detection or Separation agent.

Other selections of fused polypeptide second and other parts of the present invention include one or more portions for therapeutic application Point.In therapeutic application, other molecules can also be covalently or non-covalently coupled on polypeptide of the invention by other methods. As the preferred embodiment of the present invention, the pseudomonas aeruginosa exotoxin PE38KDEL of transformation is connected to by flexible peptide The end C- of HPV16 E7 combination polypeptide constitutes fusion protein.Non-limitative example includes using polypeptide guiding effect enzyme of the present invention (such as carboxypeptidase) and carry out " ADEPT " (antibody-mediated enzyme prodrug treatment, antibody-directed enzyme Prodrug therapy) enzyme；Protein including effector cell and other components to raise immune system；Including thin Intracellular cytokine, such as IL-2, IFN γ, IL-12, TNF α, IP10；Including clot-promoting factor, such as tissue factor, von Willebrand The factor；Including toxin, such as ricin A, calcheamicin, maytansinoid；Including toxic small molecule, such as Auristatin analog, adriamycin etc..Meanwhile in order to be more convenient incorporation radionuclide (such as⁶⁸Ga、⁷⁶Br、¹¹¹In、⁹⁹Tc 、¹²⁴I、¹²⁵I) (such as diagnosis or radionuclide⁹⁰Y、¹³¹I、²¹¹At) for treating, it may be considered that it is above-mentioned enumerate it is additional Amino acid (especially six histidines label and cysteine), the purpose is to radioisotopic intercalating agent is coupled to polypeptide Sequence.

Present invention also contemplates that connecting a detectable marker (such as fluorescence mark on the HPV16 E7 combination polypeptide Note, biotin or radioactive isotope), so as to the specificity based on polypeptide of the invention, realize detection HPV16 infection or The purpose of HPV16 infection related disease.

" HPV16 E7 binding affinity " refers to can be for example by utilizing surface plasma resonance (surface Plasmon resonance) technology is such asA kind of polypeptide nature that device is detected.HPV16 E7 binding affinity It can be detected by an experiment, wherein HPV16 E7 is fixed on the induction chip of the device, then will contain and need The sample for surveying polypeptide passes through the chip.Alternatively, polypeptide to be detected can also be fixed on the induction chip of the device, then Sample containing HPV16 E7 is passed through into the chip.Those skilled in the art can use sensed image obtained and establish polypeptide HPV16 E7 binding affinity at least one observational measurement method.If necessary to method for quantitative measuring, such as in order to establish Some K between interaction_DValue, also can be used surface plasma resonance method.For example, associated value can use 2000 devices (Biocore AB) are measured.HPV16 E7 is fixed on the induction chip of the device, and affinity is to be detected Polypeptide sample by serial dilution prepare and injected with random sequence.Then K can be calculated from result_DValue.In this hair In bright embodiment, the K of the polypeptide_DValue reaches 1 × 10^-6M to 1 × 10^-7M。

The present invention also provides points for encoding HPV16 E7 combination polypeptide or targeting molecule or fused polypeptide of the invention From nucleic acid, be also possible to its complementary strand.The nucleic acid can be artificial synthesized with complete sequence, it is also possible to which the method for PCR amplification is distinguished It obtains.

The present invention also provides the carriers comprising encoding the nucleic acid molecules.The carrier also may include and the nucleic acid The connected expression regulation sequence of the series of operations of molecule, in order to the expression of the fusion protein.As used herein, " operation Property be connected " or " being operably coupled to " refer to such a situation, i.e. certain parts of linear DNA molecule can influence same linear The activity of DNA sequence dna other parts.For example, it is exactly operationally if promoter control is with the transcription of coded sequence It is connected in coded sequence.

In the present invention, any suitable carrier can use, such as some for bacterium, fungi, yeast and lactation The clone of zooblast and the carrier of expression, such as Pouwels, cloning vector: described in laboratory manual.

In addition, the recombinant cell containing the nucleic acid sequence is also included in the present invention.Term " host cell " includes original Nucleus and eukaryocyte.Common prokaryotic host cell includes Escherichia coli, hay bacillus etc.；It is thin to may be, for example, Escherichia coli Born of the same parents (E.coli), such as Escherichia coli HMS174 (DE3) or BL21 (DE3).Common eukaryotic host cell include yeast cells, Insect cell and mammalian cell.

The method for producing HPV16 E7 combination polypeptide or targeting molecule or fused polypeptide of the invention has also been included in this In invention.The method includes cultivating the recombinant cell of the code nucleic acid containing corresponding polypeptide, product polypeptide is obtained.It can will be above-mentioned The peptide purification prepared is substantially uniform property, such as is in single band on SDS-PAGE electrophoresis.

The technical level of information and current recombinant expression protein based on polypeptide to be expressed, in conjunction in of the invention disclose Hold, the easily prepared polypeptide of the invention of those skilled in the art.For example, the plasmid for the Z structural domain that expression is not modified can be used Make starting material.Using known technology, required substitution mutation, which can be introduced into, obtains expression of the invention in this plasmid Carrier.

It is above-mentioned more when preparing polypeptide or targeting molecule or fusion protein of the invention using chemical polypeptide synthesis method Any naturally-produced amino acid residue in peptide can by amino acid residue that any corresponding, non-natural generates or its spread out Replaced biology, as long as the function of product polypeptide is not compromised substantially.

The invention further relates to the HPV16 E7 combination polypeptide or targeting molecules or fused polypeptide in different aspect Using, including it is applied to treatment, diagnosis and/or detection.

HPV16 E7 combination polypeptide of the invention can be used as HPV16 E7 antibody in one of different application substitute.Make For unrestricted example, it can be used for treating disease of the feature characterized by HPV16 E7 expression or HPV16 are infected, such as swollen Tumor (such as cervical carcinoma, head and neck neoplasm) etc..By combining HPV16 E7 intracellular to inhibit cellular signal transduction, it to be used for related disease Internal and external diagnosis.Polypeptide of the invention can be used as a kind of detection reagent, a kind of capture reagent or separation agent, and A kind of means for treating preparation or other treatment preparations are targeted to HPV16 E7 albumen can be also directly used as.It is external to use this The method of the polypeptide of invention can carry out in different ways, as microtiter plate, protein arrays, biosensor surface and tissue are cut Piece etc..It, in the case of without departing from the scope of the present invention, can be to this in order to make polypeptide of the present invention be suitable for special purposes The polypeptide of invention is modified and/or is added.These modifications and addition has been discussed in more detail below, may be included in same more The additional amino acid for including in peptide chain, or label and/or treatment preparation, chemical modification or in other ways combine this hair Bright polypeptide.In addition, present invention also contemplates that remaining the segment of the polypeptide in conjunction with HPV16 E7 ability.

HPV16 E7 combination polypeptide of the invention can be used as treatment preparation, and therapeutic effect is based at least one following machine System: (i) reinforces Chemotherapy, applies polypeptide of the invention and acts synergistically at present with the chemotherapeutic treatment in future.It blocks intracellular Destruction of the HPV16 E7 albumen to tumor suppressor gene pRb；(ii) inhibit the proliferation of tumour cell.May in the cell exist with Lower mechanism: when entering cell interior and HPV16 E7 protein binding in conjunction with polypeptide, having blocked the combination of HPV16 E7 and pRb, To block growth and proliferation of cell signal.

The HPV16 E7 binding characteristic of polypeptide of the present invention and with the polypeptide produce targeting molecule (including fusion protein) And/or the stability of the binding molecule of label means that the polypeptide can be used for other active material target tumors position, These tumours include the cell for expressing HPV16 E7.Therefore, there is provided HPV16 as described herein for another aspect of the present invention E7 combination polypeptide and a kind of application of the substance coupling with anticancer activity, are transported to expression HPV16 E7's for the substance Cell generates damage or the apoptosis of target cell.

The substance of this anticancer activity may be by merging or being coupled on HPV16 E7 combination polypeptide by chemical bond Protein, such as selected from for " ADEPT " (antibody-directed enzyme prodrug therapy) application effect Answer enzyme；For raising the effector cell of immune system and the albumen of other components；Cell factor, as IL-2, IFN γ, IL-12, TNF α a, IP 10 etc.；Clot-promoting factor, such as tissue factor, the von Willebrand factor；Toxin, as ricin A, Pseudomonas exotoxin, calcheamicin, maytansinoid etc..Alternatively, the active material is also likely to be cell toxicant Property drug, (such as such as auristatin analog or adriamycin or radioactive isotope⁹⁰Y、¹³¹I、²¹¹At etc.), this isotope can Polypeptide is bound directly in conjunction with HPV16 E7, or by a kind of intercalating agent, intercalating agent DOTA or DTPA as the well-known and and HPV16 E7 combination polypeptide combines.

In related fields, the substance with anticancer activity is oriented to expression in vivo the present invention also provides a kind of The method of HPV16E7 cell, including being administered to patient's active material as described herein and the polypeptide in conjunction with HPV16 E7 Conjugate.This conjugate is suitably described above.

The invention also includes the HPV16 E7 albumen used in the polypeptide test sample in conjunction with HPV16 E7.Example Such as, it is the disease event for expressing HPV16 E7 that this detection, which can be used to diagnostic characteristic,.The presence for detecting HPV16 E7 can be It can also carry out in vitro in vivo.Preferably selecting for in-vivo diagnostic is using positron emission x-ray tomography art, PET.It is tested The sample of survey may, for example, be biological fluid sample or tissue sample.Present common method be directed to and HPV16 E7 Antibody, this method can be adapted for the polypeptide of the invention in conjunction with HPV16 E7, and this method is histochemical method's detection With the presence of HPV16 E7, for identify it is fresh, freezing or formalin fix, in the tissue sample of paraffin embedding with HPV16 The expression of E7 albumen.In order to detect HPV16 E7, polypeptide of the invention can also serve as a part of fusion protein, wherein other knots Structure domain is reporter enzyme or luciferase.Alternatively, it is also possible to by one or more fluorescent reagents and/or labelled with radioisotope , optionally marked by intercalating agent.Suitable radioactive isotope includes⁶⁸Ga、⁷⁶Br、¹¹¹In、⁹⁹Tc、¹²⁴I and¹²⁵I etc..

The invention also includes the HPV16 E7 combination polypeptide is applied to HPV16 in detection biological fluid sample E7.For this method the following steps are included: (1) provides the biological fluid sample for being detected patient, (2) will be as described herein Sample is added under conditions of can make in conjunction with any HPV16 E7 present in the polypeptide and sample in HPV16 E7 combination polypeptide In, (3) remove uncombined polypeptide, and the polypeptide that (4) detection combines.It is deposited in the amount and sample of the polypeptide for the combination being detected HPV16 E7 amount it is related.In step (2), HPV16 E7 combination polypeptide can be added to sample in any suitable form In, include the case where for example such, when HPV16 E7 combination polypeptide is fixed on a kind of solid support, sample is made by it Contact or HPV16 E7 combination polypeptide exist in solution.

The other application of the HPV16 E7 combination polypeptide further include: the method for HPV16 E7 in test sample, including Following steps: (1) providing a kind of tissue sample of the suspection containing HPV16 E7, such as frozen section or is embedded with formalin HPV16 E7 combination polypeptide of the invention is added into the sample in histotomy, (2) under optimum conditions, and the condition is benefit In conjunction with any HPV16 E7 present in the polypeptide and sample, (3) remove unbonded polypeptide, and (4) detection combines Polypeptide.The amount of the polypeptide of the combination detected is related to the amount of HPV16 E7 present in sample.

The present invention also provides the kits that one diagnoses HPV16 E7 expression in tissue sample, including (such as with reporter enzyme Alkaline phosphatase or horseradish peroxidase) fusion, the reagent of of the invention HPV16 E7 combination polypeptide, detection enzymatic activity, With positive and negative control tissue slice.

The present invention also provides the kits that one diagnoses HPV16 E7 expression in tissue sample, including pass through antibody test In conjunction with label (as flag label or myc are marked) HPV16 E7 of the invention for merging polypeptide, one be specific to label Primary antibody, be specific to primary antibody and with the secondary antibody of reporter enzyme coupling, detect the reagent of enzymatic activity, and positive and negative control tissue is cut Piece.

One field of diagnostic application is exactly to detect cancer cell or its aggregation in vivo.The present invention provides a progress The kit of this diagnosis, the kit include being marked with a chelating object, of the invention HPV16 E7 combination polypeptide, one kind With radioactive isotope, (unrestricted example is for diagnosis⁶⁸Ga、⁷⁶Br、¹¹¹In、⁹⁹Tc、¹²⁴I and¹²⁵I etc.), and for analyzing The reagent of doping efficiency.

As described above, present invention encompasses HPV16 E7 combination polypeptides of the invention by active material targeted expression HPV16 The application of for example certain form of cancer cell of the cell of E7.The present invention also provides a kit for this purpose, the examinations Agent box includes (non-with HPV16 E7 combination polypeptide of the invention, a therapeutic radioisotopes for a chelating substance markers Restrictive example is⁹⁰Y、¹³¹I、²¹¹), and the reagent for analyzing doping efficiency At.

The present invention also provides a kind of pharmaceutical composition, it includes: it is a effective amount of of the present invention to human papilloma virus The E7 albumen of 16 types has the polypeptide of binding affinity or targets the targeting molecule of HPV 16, and pharmaceutically may be used The carrier of receiving.

As used herein, the ingredient of " pharmaceutically acceptable " is suitable for people and/or mammal and without excessively bad Side reaction (such as toxicity), i.e., with the substance of reasonable benefit/risk ratio.Term " pharmaceutically acceptable carrier ", which refers to, to be used for The carrier of Therapeutic Administration, including various excipient and diluent.The term refers to medicament carriers some in this way: themselves is not It is necessary active constituent, and does not have excessive toxicity after applying.Suitable carrier is well known to those of ordinary skill in the art 's.It can find in Remington ' s Pharmaceutical Sciences (Mack Pub.Co., N.J.1991) about medicine Acceptable carrier absolutely proves on.Pharmaceutically acceptable carrier can contain liquid in the composition, as water, salt water, Glycerol and sorbierite.In addition, there is likely to be complementary substances in these carriers, such as lubricant, glidant, wetting agent or cream Agent, pH buffer substance and stabilizer, such as albumin.

The composition can be made to the various dosage forms for being suitable for mammal administration, the dosage form includes but unlimited In: injection, capsule, tablet, emulsion, suppository.

It when in use, is that the E7 albumen of the present invention to HPV 16 of safe and effective amount is had into knot The polypeptide or targeting molecule for closing affinity are applied to mammal (such as people), and wherein the safe and effective amount typically at least about 1 is micro- G kg weight, and in most cases no more than about 10 mg/kg weight, preferably the dosage be about 1 microgram/ About 1 mg/kg weight of kg body weight-.Certainly, specific dosage is also contemplated that the factors such as administration route, patient health situation, this Within the scope of being all skilled practitioners technical ability a bit.

Present invention will be further explained below with reference to specific examples.It should be understood that these embodiments are merely to illustrate the present invention Rather than it limits the scope of the invention.In the following examples, the experimental methods for specific conditions are not specified, usually according to conventional strip Part such as J. Pehanorm Brooker etc. is write, Molecular Cloning:A Laboratory guide, the third edition, Science Press, condition described in 2002, or According to the normal condition proposed by manufacturer.

Embodiment 1, the library construction of HPV16E7 combination polypeptide and screening study

Construct the random combinatorial libraries of phage display HPV16 E7 combination polypeptide, i.e., many different SPA structural domain phases HPV16 E7 combination polypeptide is screened from the library, and its compatibility is identified in the library for closing polypeptide.

1, the building and identification of the random combine phage display library of HPV16 E7 combination polypeptide

According to the amino acid sequence of wild type SPA-Z and structure (Nilsson B etc., Protein Eng.1987；1(2): 107-113), random primer is designed for the corresponding coded sequence in three of them helical structure area, obtaining using PCR method amplification can The SPA coded sequence for causing random amino acid to be mutated, is named as SPA-N.

2, the building of pCANTAB5E/SPA-N recombinant plasmid

Selection carries out the expression of affine body with M13 bacteriophage systems (being purchased from Beijing Bao Kewei Shi An biotech firm), therefore With pCANTAB5E (being purchased from Beijing Bao Kewei Shi An biotech firm) for carrier, the SPA-N of acquisition is compiled by Sfi I and Not I Code sequence is cloned into the Sfi I/Not I site of pCANTAB5E carrier, constructs pCANTAB5E/SPA-N recombinant plasmid, conversion Into competence E.coli TG1 cell, it is coated with 2YT-A plate, 37 DEG C of overnight incubations.As primary library, is labeled as affibody Primary library is spare.As a result 28 monoclonal colonies grown on random picking plate, by extracting, plasmid is bis- with Sfi I and Not I Digestion is accredited as positive colony, is sequenced and is analyzed its randomness.

As a result: according to sequencing result, it is 26 clones that sending in 28 clones of sequencing, which has sequencing result, wherein connecting into Function 21 clones, randomness is entirely different, therefore recombination fraction is 21/26=88%；Diversity is 21/21=100%.Meanwhile it taking The bacterium solution cultivated after above-mentioned conversion, with 2 × YT culture solution doubling dilution (1:10,1:10²...), it is coated with SOB-AG plate, meter The single colonie number on plate is calculated, calculates storage capacity.The accumulative storage capacity of conversion number is connected by increasing, repeatedly makes to clone after connection conversion Number reaches 2.4 × 10⁵A Z protein variant (affibody molecule), the 9th, 10,11,13,14,17,18,24,25,27, 28,32,35 and 43 have random amino acid residue.

3, the screening of HPV16 E7 combination polypeptide and titer determination

The HPV16 E7 albumen of purifying is coated with 96 hole elisa Plates, is closed plus phage library (primary library) is incubated for, again 37 DEG C of E.coli TG1 are added, jog incubates；100 μ l are taken, do gradient doubling dilution with 2*YT culture medium, take 100 μ l of dilution It is coated with SOB-AG plate, 30 DEG C overnight, counts and combines phage-infect clump count, calculates HPV16E7 combination phage titre；Knot Fruit plate visible colonies, titre are 10²；It completes the first round at this time to eluriate, another part bacterium solution adds 10¹⁰Helper phage M13KO7 (be purchased from Beijing Bao Kewei Shi An biotech firm) and kanamycins overnight incubation takes supernatant through 0.22 μm of membrane filtration after centrifugation, Phage library after obtaining the affine screening of HPV16 E7 molecule is the library level-one affibody.Above-mentioned 4 wheel enrichment isolation is repeated, The phage library after the affine screening of HPV16 E7 molecule is obtained respectively, is second level, titre is respectively 1 × 10⁶；In second level library On the basis of repeat it is above-mentioned 4 wheel enrichment isolation, be three-level library, titre be 1 × 10⁸.The blank of bacteriophage is not added in setting simultaneously Synchronous Screening is made in control.

4, the preparation of HPV16 E7 combination polypeptide monoclonal phage and ELISA identification

ELISA is used to screen the bacteriophage of expression HPV16 E7 combination affibody molecule.By the HPV 16E7 of 10 μ g/ml Albumen is coated with 96 hole elisa Plates with 200 holes μ l/, and 4 DEG C overnight；PBS washing closes 2h with 2% skimmed milk power；Washing, takes four-wheel The bacteriophage and 3% isometric skimmed milk power obtained after screening mixes, 200 holes μ l/, and 37 DEG C, 2h.1:10000 is added in washing Diluted HRP/anti-M13 ELIAS secondary antibody (rabbit-anti M13, Abcam#ab6188), 200 holes μ l/, 37 DEG C, 1h；Washing is added 200 hole μ l/ of OPD developing solution, 37 DEG C, 15min；2M H₂SO₄50 holes μ l/ terminate reaction；Set microplate reader (ELx800TM, BIO- TEK, Winooski, USA) read OD490 value.

Selection combines the affibody molecule of antigen in four-wheel panning rounds, selects to recycle by this four-wheel, further It is detected with Phage-ELISA to analyze its HPV16 E7 and combine activity, the ELISA value with the OD490 higher than 0.5 is selection mark Standard, the bacteriophage of identification code HPV16 E7 combination polypeptide are selected above 150 of this ELISA signal value clones, and with it is another It selects 12 clones without ELISA value at random outside and carries out DNA sequence analysis.

5, the Sequence Detection and screening of the affine body molecule of HPV16 E7

Totally 150 monoclonals send Chinese Shanghai Sheng Gong company to be sequenced, sequencing primer CATATGGTTGACAAC AAATTCAACAAAGAA(SEQ ID NO:12).Sequencing result is analyzed with DNA STAR software to standard sequence SPA-Z and SPA- N further analyzes the randomness and diversity of three of them helical region.As a result 78 complete correct cloned sequences are obtained, there is partial sequence It repeats completely, obtains 65 right-on clones of sequence after annexing repetitive sequence.

It is analyzed according to DNA sequencing result, in correct 65 clones of above-mentioned sequencing, selection and HPV16 E7 albumen In conjunction with the DNA sequence of strongest 4 monoclonal phages of activity (monoclonal phage of the affine body molecule of HPV16 E7 is presented) Arrange (respectively Z_HPV16E7:127、Z_HPV16E7:301、Z_HPV16E7:384、Z_HPV16E7:745) studied as target, amino acid sequence is SEQ ID NO:1,2,3,4, such as Fig. 1, their coded sequence such as SEQ ID NO:6-9).It is combined in next step for HPV16 E7 The molecular cloning of affine body and expression and Function detection.

The present invention utilizes display technique of bacteriophage, and the affibody random peptide library of building is shown in phage surface, with HPV16 E7 albumen is target proteins, carries out the screening of the affine body of HPV16 E7.It is eluriated by four-wheel, every wheel passes through: affine- Washing-amplification, and the concentration of target protein HPV16 E7 albumen with eluriate number increase and reduce, 50 μ g/ml, 30 μ g/ml, 15 μ g/ml, 10 μ g/ml are so as to preferably filter out the high affine body of affinity, and with the massive amplification of every wheel, affine body Every wheel has 10²Selective enrichment.Higher (A is read through ELISA further screening OD value₄₉₀> 0.5) monoclonal is surveyed The complete correctly HPV16 E7 affibody sequence of sequencing is compared analysis by NTI software by sequence, and then random picking is affine Higher 4 monoclonals of power carry out the research of next step, the wild type ratio of this 4 amino acid sequence analysis cloned and standard Right, there is the change of about 13-14 amino acid in three helical structure Variable Areas.

Embodiment 2, HPV16E7 combination polypeptide construction of recombinant plasmid and prokaryotic protein expression and purifying

Such as 4 clone (affibody Z in Fig. 1 for preceding having selected to read with higher ELISA_{HPV16 E7:127}、 Z_HPV16E7:301、Z_{HPV16 E7:384}、Z_{HPV16 E7:745}), in order to carry out Function detection to the affibody molecule of screening, weight is carried out to it The expression and its identification of group plasmid construction, protokaryon albumen, and prepare purifying protein.

1.pET21a (+)/affibody construction of recombinant plasmid and identification

PCR primer, 5 ' GGGAAT of upstream primer are designed referring to affibody gene order (GenBank:GY324633.1) TCCATATGGTTGACAACAAATTCAACAAAGAA 3 ' (SEQ ID NO:13, underscore indicate Ned I restriction enzyme site), under Swim 5 ' CCG of primerGAATTCCGTTTCGGAGCCTGAGCGT3 ' (SEQ ID NO:14, underscore indicate I restriction enzyme site of Xho)； With the correct level Four library monoclonal affibody Z of the sequencing of screening_{HPV16 E7:127}、Z_{HPV16 E7:301}、Z_{HPV16 E7:384}、Z_{HPV16 E7:745} For template, by PCR amplification affibody target gene (SEQ ID NO:6-9), while by affibody Z_wt(SEQ ID NO:1) complete sequence (SEQ ID NO:10) synthesis is used as negative control after protokaryon codon optimization.By the purpose base of PCR amplification Because being cloned into pET21a (+) carrier through Nde I and Xho I, pET21a (+)/Z is constructed_{HPV16 E7}Recombinant plasmid, and through sequencing identify (Fig. 2, Fig. 3).

2. protokaryon protein production

By in recombinant plasmid transformed to Escherichia coli (E.coli) BL21 (DE3), 37 DEG C, 16h is cultivated；Add 0.8mM isopropyl Thio-β-D- the Thiogalactopyranoside (IPTG) of base (Merck & Co., Inc., Germany) IPTG Fiber differentiation 6h expression has His label Z_HPV16E7Affibody and Z_wtAffibody albumen.The recombinant protein expressed after inducing chelates affinity chromatography colloid with nickel (Ni-NTA Agarose) (QIAGEN company, the U.S.) affinity chromatography is purified and is analyzed and identified through SDS-PAGE.

As a result, successfully constructing pET21a (+)/Z using Protocols in Molecular Biology_{HPV16 E7}Recombinant plasmid, and use protokaryon Expression system is prepared for the Z of purifying_{HPV16 E7:127}、Z_{HPV16 E7:301}、Z_{HPV16 E7:384}、Z_{HPV16 E7:745}And Z_WTAffibody recombination Fusion protein confirms the band molecular mass of the dense dye of Coomassie brilliant blue occur about through SDS-PAGE electrophoretic analysis (Fig. 4) 7.8kDa, with expected Z_{HPV16 E7}The molecular mass of affibody polypeptide is in the same size.The present invention selects pET21a (+) carrier, The starting enzyme site that its multiple cloning sites is utilized in design is NdeI (CATATG), and codon ATG is destination protein translation Amino acid (M) initiation codon, in this way using prokaryotic expression albumen be overall length destination protein Z_{HPV16 E7} And without carrier protein segment, avoid interference of the carrier protein to experimental result.

Embodiment 3, Z_{HPV16 E7}The combination of affibody polypeptide and HPV16 E7 albumen

To identify Z_{HPV16 E7}Affibody polypeptide and the protein bound specificity of HPV16 E7, utilize surface plasma resonance Four Z of technology (SPR) Analysis and Screening_{HPV16 E7:127}、Z_{HPV16 E7:301}、Z_{HPV16 E7:384}、Z_{HPV16 E7:745}Molecule and its control Z_wt The specific binding of affibody and target protein HPV16 E7.

The preparation of HPV16 E7 albumen: HPV16 E7 gene is expanded from cervical cancer tissues with PCR method, is cloned into PET21a (+) carrier constructs pET21a (+)/HPV16 E7 recombinant plasmid, and identification is sequenced；By recombinant plasmid transformed to big Enterobacteria BL21 (DE3), expresses recombinant protein after IPTG is induced, purified with Ni-NTA affinity chromatography and through SDS-PAGE and Western blot analyze and identify (referring to Wang Bingbing etc., the expression of HPVl6 type E7 recombinant protein and its system of polyclonal antibody It is standby；Cell and molecular immunology magazine, 2014 (2): 167-170).As a result, be successfully prepared HPV16 E7 purifying protein and its Polyclonal antibody, and carried out specificity verification (Fig. 5 A-C).

Z_{HPV16 E7}The biosensor analysis of affibody polypeptide: ProteOn XPR36 system instrument (Bio-Rad company) into Row HPV16 E7 albumen and Z_{HPV16 E7}The affinity analysis to interact between affibody polypeptide, i.e., it is total using surface plasma Vibration technology (SPR) analyzes the above-mentioned Z with His label_{HPV 16 E7:127}、Z_{HPV16 E7:301}、Z_{HPV16 E7:384}、Z_{HPV16 E7:745}And Z_wt Interaction between affibody molecule (as control) and HPV16 E7.According to operation manual, on different flow cells HPV16 E7 recombinant protein is fixed by being coupled to GLH chip, carries out and screen the affinity determination between polypeptide.6th Flowing pool surface be activated and inactivate using as inject when blank control.Affibody molecule carries out six different gradients respectively Concentration dilution is in conjunction with HPV16 E7 recombinant protein, i.e. Z_{HPV16 E7:127}Concentration be 1.0nM, 2.0nM, 4.0nM, 8.0nM, 16.0nM, 32.0nM, 64.0nM, Z_{HPV16 E7:301}Concentration be 0.7nM, 1.4nM, 2.8nM, 5.6nM, 11.2nM, 22.4nM, 44.8nM Z_{HPV16 E7:384}Concentration is 0.6nM, 1.2nM, 2.4nM, 4.8nM, 9.6nM, 19.2nM, 38.4nM, Z_{HPV16 E7:745}It is dense Degree is 1.1nM, 2.2nM, 4.45nM, 9.1nM, 18.3nM, 36.5nM, 73.2nM and Z_wtAffibody molecular concentration is 1.0nM, 2.0nM, 4.0nM, 8.0nM, 16.0nM, 32.0nM, 64.0nM, all analyses are carried out at 25 DEG C, and flow velocity is 30 μ l/ Min, the capacity of specimen injection are 200 μ l, and with the injection of 30 μ l/min random sequence of flow velocity, then use HCl (BIO-RAD goods Number: 6min (dissociation) #176-2250 100mM HCl) is washed, utilizes ProteOn Manager^TMThe 1:1 of software (BIO-RAD) Langmuir binding model analyzes binding curve (influence chart).

It is detected using surface plasma resonance technology (SPR), it is that analysis is repeated twice detection as a result, affinity balance dissociation Constant KD mean value, Z_{HPV16 E7:127}、Z_{HPV16 E7:301}、Z_{HPV16 E7:384}、Z_{HPV16 E7:745}And Z_wtAffibody molecule is respectively 1.91×10^-6mol/L、1.18×10^-7mol/L、1.73×10^-6mol/L、5.02×10^-5Mol/L and 4.63 × 10^-2mol/ L.As a result, the Z of purifying_{HPV16 E7:127}、Z_{HPV16 E7:301}、Z_{HPV16 E7:384}、Z_{HPV16 E7:745}Protein molecular and HPV16 E7 recombinate egg The white ability with interaction, if Fig. 6 A-E is shown, compared with Z_wtAffibody molecular dissociation constant KD value difference 1000 to 10000 times.The Z obtained through screening_{HPV16 E7:127}、Z_{HPV16 E7:301}、Z_{HPV16 E7:384}、Z_{HPV16 E7:745}It can be recombinated with HPV16E7 Protein binding, in conjunction with affinity have reached nmol/L grades of levels, the at the same time Z of wild type_wtAffibody molecule and HPV16 E7 recombinant protein shows filter out 4 affibody molecules and HPV16 E7 recombinant protein almost without binding force Special affinity with higher, while showing the Z of protokaryon inducing expression_{HPV16 E7}Affibody molecule and HPV16 E7 recombinate egg It is white to all have bioactivity.

Therefore, Z of the invention_{HPV16 E7:127}、Z_{HPV16 E7:301}、Z_{HPV16 E7:384}、Z_{HPV16 E7:745}Protein molecular and HPV16E7 Protein target molecule, which has, to be combined with each other and recognition capability.Z is demonstrated from protein level_{HPV16 E7:127}、Z_{HPV16 E7:301}、 Z_{HPV16 E7:384}、Z_{HPV16 E7:745}Affinity between molecule and HPV16E7 target protein.

Embodiment 4, Z_{HPV16 E7}Affibody polypeptide and the combination for expressing HPV16 E7 albuminous cell

For the Z for further verifying screening_{HPV16 E7}The affinity of affibody polypeptide and HPV16E7 target protein, utilizes expression The cervical cancer cell of HPV16 E7 is as research object, i.e. (ATCC:HTB-35 expresses HPV16 to Human cervical cancer cell lines Siha The cervical cancer cell of E7), Caski (ATCC:CRL-1550 expresses the cervical cancer cell of HPV16 and 18 E7) and HeLa229 (ATCC:CCL-2HPV 18 positive cervical cancer cell), and utilize K-1735 A375 (ATCC:CRL-1619, HPV Negative melanoma cells) as control, further verify Z_{HPV16 E7:127}、Z_{HPV16 E7:301}、Z_{HPV16 E7:384}、Z_{HPV16 E7:745} Combination between protein molecular and HPV16 E7 protein molecular.

Cell culture: Human cervical cancer cell lines Caski, Siha, HeLa229 and K-1735 A375 cell culture In 1640 culture medium of RPMI (10% fetal calf serum, 2.05mM L- paddy ammonia phthalein amine and 100IU/ml penicillin and 100 μ g/ml chains Mycin).Cell contains 5%C0 at 37 DEG C₂Incubator in culture to for 24 hours, Immunofluorescence test is carried out when cell state is good.

Cellular immunofluorescence detection: the coverslip of sterilizing is put into six orifice plates, by culture to for 24 hours Caski, Siha, It is 1 × 10 that HeLa229, A375 cell, which adjust number,⁶/ hole, 5%CO₂, 37 DEG C of cultures are for 24 hours to cell monolayer.It is added final concentration of 50μg/ml Z_{HPV16 E7}Affibody polypeptide is in above-mentioned culture medium containing 10%FBS, 5%CO₂, 37 DEG C of culture 6h, culture is sucked out Liquid is washed with pre-cooling PBS；It is washed 3 times using the fixed cell monolayer 10min of 2% paraformaldehyde, PBST, 0.3%Triton is added X-100 punches 10min, and 37 DEG C of closing 1h of 10%FBS+1640 culture medium, washing are added after washing；It is mono- to be separately added into the anti-His of mouse Clonal antibody (ABR company, the U.S., 1:2000), rabbit-anti SPA serum (1:500) and HPV16E7 rabbit anteserum antibody (1:500), set 37 DEG C of 1h, after washing plus FITC- goat anti-rabbit igg secondary antibody (Shanghai Lian Ke biotech company, China) and PI (Suo Laibao company, Beijing) 2 μ l/ hole 1h, be protected from light, after washing cover slide and with buffer glycerol mounting, confocal fluorescent microscopic (Leica TCS SP2 microscope Germany) it observes and makes film (400 ×).

With the Z of purifying_{HPV16 E7:127}、Z_{HPV16 E7:301}、Z_{HPV16 E7:384}、Z_{HPV16 E7:745}It is incubated for HPV16 E7 protein expression sun Property cervical carcinoma Caski, Siha cell 6h after, respectively with His monoclonal antibody, SPA rabbit anteserum analysis recombination affibody albumen The identification and binding ability for the HPV16 E7 recombinant protein expressed with cell strain, while HPV16 E7 protein expression feminine gender is set Humanmachine tumour A-375 cell strain and the cervical carcinoma HeLa229 cell strain of the HPV18 E7 positive are arranged at the same time as control HPV16 E7 rabbit anteserum antibody is as positive control.

The results show that Z_{HPV16 E7:127}、Z_{HPV16 E7:301}、Z_{HPV16 E7:384}、Z_{HPV16 E7:745}Siha, Caski that albumen is incubated for The dotted or lumps fluorescin (Fig. 7 A-D) of the multiple strong greens of the nuclear membrane and cytoplasm kernel Zhou Kejian of cell strain, with The result of HPV16 E7 rabbit anteserum antibody incubation is consistent (Fig. 7 E), and HeLa229 cell and A375 cell strain are showed no significantly Fluorescence agglomerate (Fig. 7 A-E).Show Z_{HPV16 E7:127}、Z_{HPV16 E7:301}、Z_{HPV16 E7:384}、Z_{HPV16 E7:745}Recombinant protein can specificity HPV16 E7 albumen, Z prepared by the present invention are naturally expressed in identification cell_{HPV16 E7:127}、Z_{HPV16 E7:301}、Z_{HPV16 E7:384}、 Z_{HPV16 E7:745}Recombinant protein and the 16 E7 albumen of HPV of living cells expression have very strong specific bond ability.

The above results further demonstrate Z from cellular level_{HPV16 E7:127}、Z_{HPV16 E7:301}、Z_{HPV16 E7:384}、Z_{HPV16 E7:745} Recombinant protein and HPV16 E7 albumen have very strong targeting binding specificity and affinity.

Embodiment 5, Z_{HPV16 E7}Bio distribution and cancer target of the affibody polypeptide in cervical cancer cell tumor bearing nude mice In the experiment of the present embodiment, the Z in above-mentioned affibody molecule is selected_{HPV16 E7:384}Affibody polypeptide as test object, It is marked near infrared fluorescent dye DyLight755 NHS Ester (Thermo Fisher company, the U.S., article No. 62278) Z_HPV16E7:384Affibody polypeptide, and it is injected into the Mice Body for carrying Siha, Caski, HeLa229 and A375 transplantation tumor It is interior, carry out Z_{HPV16 E7:384}Affibody polypeptide biodistribution research, and positioning is imaged to study the target of labeling polypeptide to nude mouse To characteristic.

The preparation of animal tumor model: (be purchased from Shanghai Si Laike experimental animal has selection 6-7 week old BALB/c-nu mouse Limit responsible company, quality certification SCXK (Shanghai) 2012-0002), weight 15-18g).It will cultivate to logarithmic growth phase, growth conditions After good Siha, Caski, HeLa229 and A375 are digested with EDTA (pancreatin), blown with containing 10% serum cell culture fluid It beats, collect, 1000 turns/min of room temperature is centrifuged 3min, uses the culture solution without serum to be resuspended centrifuge cell and counts, is configured to 1 ×10⁷/ ml takes 0.2ml in the nearly right forearm in back or the nearly groin inoculated with subcutaneous injections nude mice of lower limb.Every 3 days observation mouse The state of mind, energy, reaction, diet, weight and inoculate region appearance and sense of touch, and measured with electronic vernier caliper Tumorous size diameter.It is long to 300-500mm to tumour³For Z_{HPV16 E7}The bio distribution and imaging research of affibody polypeptide.

The results show that nude mice by subcutaneous is inoculated with the visible apparent tumour growth of above-mentioned cell, 22 nude mice whole tumor formations.3 Zhou Hou, longest diameter of tumor reach 300-500mm³When start to test.

Z_{HPV16 E7:384}Polypeptide near infrared fluorescent dye Dylight755 label and identification: to specifications step carry out by The label of Dylight755 and identification.91 μ g DyLight755 NHS-Ester dyestuffs are taken to be dissolved into 273 μ l DMF organic molten Z after agent, after dialysis is added_{HPV16 E7:384}In affibody albumen (300 μ g/ml, total 1ml) solution, it is protected from light, it is anti-under the conditions of 4 DEG C 1h is answered, the solution after reaction is protected from light dialysis, dialyzate (phosphate buffer, pH7.2-7.4) is replaced every half an hour, after 2h Collect Dy755-Z_HPV16E7:384Fluorescin, it is 100 μ g/ml that protein concentration is surveyed in sampling, is identified using SDS-PAGE electrophoresis. The Z for taking Dy755 to mark respectively_HPV16E7:384(Dy755-Z_HPV16E7:384) 1 μ g, 0.5 μ g and 0.1 μ g, it is diluted with phosphate buffer To 10 μ l, while 10 μ l Dy755-DMF dyestuffs being taken to do negative control, is separately added into 10 μ l albumen loading buffer, in Electrophoresis under the conditions of being protected from light on ice, and gel is put in living imaging instrument (CRi Maesro 2.10, in-vivo Fluorescence imaging system) in, exciting light filter disc is 671-705nm, and transmitting light filter disc is 750longpass, Using 8bit and 2 × 2 modes, 5000ms is exposed every time with the wavelength interval 730-950nm 10nm and collects image information, uses Maesro Software carries out image process and analysis.Identified Dy755-Z_HPV16E7:384It is sub-packed in brown centrifuge tube, -20 DEG C save backup.

The results show that labelled protein Dy755-Z_HPV16E7:384Through SDS-PAGE electrophoretic analysis, 1.0 μ g, 0.5 μ g and 0.1 μ g Swimming lane in relative molecular mass be that single stainable bands occurs in the place 7.8kDa, but Dylight755 dyestuff (is schemed without band 8A), it is scanned through small animal living body imager, occurs single fluorescent bands (figure at corresponding 1.0 μ g and 0.5 position μ g 8B).Show that near infrared fluorescent dye Dylight755 marks Z_{HPV16 E7:384}The success of affibody polypeptide.

Z_{HPV16 E7:384}Bio distribution and cancer target of the affibody polypeptide in the nude mice of tumour cell xenograft Effect: the tumour to nude mice is long to 300-500mm³When take nude mice out of SPF barrier system, be injected intraperitoneally with 10% chloraldurate Induced anesthesia, through 10 μ g Dy755-Z of tail vein injection after it enters deep anaesthesia state_HPV16E7:384Fluorescin is placed in small Imaging in living animal imager (CRi Maesro 2.10, in-vivo fluorescence imaging system), and Maintain narcosis with 0.8-1.0 μ l/g chloraldurate, with guarantee mouse in imaging process in deep anaesthesia, 5min, 10min, 15min, 30min, 45min, 1h, 1.5h, 2h, 4h, 6h, 8h and for 24 hours continuous imaging observation (Fig. 9 A-B).And in for 24 hours After put to death and dissect mouse, take tumor tissues, liver, spleen, kidney and brain etc. tissue internal organs be placed in imaging system.Imaging Exciting light filter disc be 671-705nm, transmitting light filter disc be 750longpass, using 8bit and 2 × 2 modes, 730-950nm Wavelength interval 10nm exposes 5000ms every time and collects image information, and carries out image process and analysis with Maesro software, respectively Display background autofluorescence and target fluorescent signal, then measure its fluorescent value, set black, target for background auto-fluorescence Fluorescence signal is set as red, finally that two kinds of colors are superimposed.The data obtained is handled with GraphPAD software.

As a result, Siha and Caski tumor bearing nude mice is in 50 μ g Dy755-Z of tail vein injection_HPV16E7:384Fluorescin 10min Afterwards, there is apparent fluorescence signal in tumor locus, and 1h-1.5h fluorescence signal is most complete, corresponding with tumor size, tumour when 8h Fluorescence imaging obviously become smaller, for 24 hours when still have fluorescence imaging.In addition to kidney, the fluorescence intensity in tumor tissues is opened when 30min Begin to increase, the fluorescence intensity of other each internal organs is about all remarkably higher than to 6h, although weaken to fluorescence intensity for 24 hours, but still Higher than other each internal organs.HeLa229 and A-375 control group is not detected during observing and is clearly distinguishable from the glimmering of background fluorescence Optical signal.Experimental group and the corresponding position of nude mice of control group the liver and spleen Dy755-Z after intravenous injection_HPV16E7:384After fluorescin It can be seen that apparent fluorescence signal, as dyestuff is constantly metabolized in Mice Body, signal is gradually decreased, until having weakened disappearance for 24 hours； And kidney Dy755-Z after intravenous injection_HPV16E7:38410min after fluorescin is until for 24 hours, it is seen that strongest fluorescence signal (figure 9).Analyze tumor tissues fluorescence signal intensity discovery, Siha and Caski cell tumor-bearing mice 30min left-right signal intensity most Height gradually decreases later, the most obvious (Fig. 9) to 6h and 8h left-right signal intensity respectively.

In 50 μ g Dy755-Z of tail vein injection_HPV16E7:384Fluorescin for 24 hours when dissect mouse, take experimental group and control group The vital tissues organ such as tumour, heart, lung, spleen, liver and kidney be imaged, discovery tumour, kidney, the heart, brain, intestines, Fluorescence signal is distributed (Figure 10 A-D) substantially consistent with intensity and living imaging result in the tissue such as lung, muscle and bone, and In Siha and Caski tumor-bearing mice, the fluorescence intensity of the fluorescence intensity of tumor tissues and other each internal organs have significant difference (p < 0.05) fluorescence intensity of tumor tissues and the fluorescence intensity of other each internal organs are without aobvious, and in HeLa229 and A375 tumor-bearing mice It writes sex differernce (p > 0.05).Tumor-bearing mice is in good condition during observation, has no that overt toxicity reacts.

The result shows that label Dylight755-Z_HPV16E7:384There is polypeptide targeting to combine HPV16E7 expression positive tumor Characteristic, and without serious toxic side effect.

Embodiment 6, Z_{HPV16 E7}The biological function of affibody polypeptide is studied

To study Z_{HPV16 E7}Whether affibody polypeptide in-vitro cell growth is inhibited, and the present invention selects Siha swollen Tumor cell strain is as experimental subjects.It is carried out using the cells survival rate at each time point in CCK-8 reagent detection cell growth process Detection, and Z is calculated using Grahpad primer5.0 software_HPV16E7The IC50 of affibody polypeptide.

Preparation Siha tumor cell suspension is simultaneously inoculated in 96 porocyte culture plates, and 0.5 × 10⁴/ hole.After culture for 24 hours, it is added 1 μ g/ml cycloheximide, 5% fetal calf serum are then respectively adding 4 i.e. Z of affibody albumen_{HPV16 E7:127}、Z_{HPV16 E7:301}、 Z_{HPV16 E7:384}、Z_{HPV16 E7:745}, 100 μ g/ml, 50 μ g/ml, 25 μ g/ml, 10 μ g/ml, 1 μ g/ml, five concentration are respectively set Group, and with Z_wtAffibody is control group, while setting culture medium control, using CCK-8 kit (Cell Counting Kit-8, GC-0030, CN) detection cell survival rate, i.e., be added combine polypeptide after 0,1,3,6,12,24,36,48 and 72h, CCK-8 reagent, 10 holes μ l/, in CO are added₂Continue incubation 30min in incubator and is placed on reading at microplate reader A450.Every group equal If 3 multiple holes, and carry out 3 repetitions and test.Cell survival (Cell viability) calculation method are as follows: Cell viability (%)=(the OD value of affitoxin384 group-culture medium group OD value)/(SPA-Z_wtControl group OD value-culture medium group OD value) × 100%；The IC50 value of cell growth survival is calculated with 5.0 software of GraphPad primer simultaneously.

As a result, Z_{HPV16 E7:127}、Z_{HPV16 E7:301}、Z_{HPV16 E7:384}、Z_{HPV16 E7:745}Growth of the polypeptide to Siha tumour cell Have inhibiting effect (Figure 12 A-D), IC50 is 2.882 ± 0.661 μM, 3.876 ± 0.125 μM, 2.725 ± 0.358 μ respectively M and 1.835 ± 0.233 μM (Figure 11 A-D).It has been shown that, Z_{HPV16 E7:127}、Z_{HPV16 E7:301}、Z_{HPV16 E7:384}、Z_{HPV16 E7:745}To expression The cervical cancer cell Siha of the HPV16 E7 positive all has inhibiting effect, and it inhibits cell growth effect to show as most in 6h By force, until 72h, with Z_wtStill there is significant difference (p < 0.001) with culture medium control；It shows simultaneously, Z_{HPV16 E7:127}、 Z_{HPV16 E7:301}、Z_{HPV16 E7:384}、Z_{HPV16 E7:745}Polypeptide has a concentration dependent to the inhibiting effect of Siha cell, 100 μ g/ml, Cells survival rate between 50 μ g/ml and 10 μ g/ml groups has significant difference (p < 0.001), while three groups of dosage groups and Z_wt More also there is significant difference (p < 0.001) with the cells survival rate of medium controls.

The above result shows that Z_{HPV16 E7:127}、Z_{HPV16 E7:301}、Z_{HPV16 E7:384}、Z_{HPV16 E7:745}Polypeptide, which has, inhibits Siha The characteristic of cell growth, further demonstrates Z_{HPV16 E7:127}、Z_{HPV16 E7:301}、Z_{HPV16 E7:384}、Z_{HPV16 E7:745}With external HPV16 E7 targets binding specificity.

Embodiment 7, Z_{HPV16 E7}Protective effect of the affitoxin albumen to cervical cancer cell tumor bearing nude mice

In the present embodiment, Z is utilized_{HPV16 E7}Targeting, carry through changed structure have cytotoxicity Pseudomonas aeruginosa The active fragment PE38KDEL of exotoxin A (pseudomonas exotoxinA, PEA) is as Cytotoxic molecules (Gao J, et Al.Mol Cancer Ther, 2008,7 (10): 3399-3407).Construct Z_{HPV16 E7}/ PE38KDEL prokaryotic expression carrier, and benefit It is prepared with prokaryotic expression system and has purified Z_HPV16E7/ PE38KDEL albumen, i.e. affitoxin, to affitoxin and target protein The specific binding of HPV16 E7 and targeting carry out and verifying, and it is further injected into carry Siha (ATCC: HTB-35 expresses the cervical cancer cell of HPV16), Caski (ATCC:CRL-1550, express HPV16 and 18 cervical cancer cell), HeLa229 (ATCC:CCL-2 HPV 18 positive cervical cancer cell) and A-375 (ATCC:CRL-1619, HPV16 feminine gender it is black Melanoma) transplantation tumor Mice Body in, carry out tumor protection and Experiment on therapy.Z is used simultaneously_wtAffitoxin is compared.

Z_{HPV16 E7}The preparation and authentication of affitoxin albumen: selection Z_{HPV16 E7}Targeting of the affibody as HPV16 E7 Molecule utilizes flexible peptide (Gly₄Ser)₃PE38 (KDEL) is connected in its C-terminal, flexible Peptide C end is connected excellent through protokaryon codon The complete sequence DNA of the complete sequence (SEQ ID NO:11) of the PE38 (KDEL) of change, PE38 (KDEL) is synthesized and through EcoRI and XhoI Site is cloned into pET21a (+) carrier, constructs pET21a (+)/PE38 (KDEL) carrier, further will by molecular cloning method Z_{HPV16 E7:127}、Z_{HPV16 E7:301}、Z_{HPV16 E7:384}、Z_{HPV16 E7:745}And Z_wtCoded sequence is cloned into pET21a through NedI and EcoRI Simultaneously identification is sequenced in (+)/PE38 (KDEL) vector construction recombinant plasmid, is further converted to e. coli bl21 (DE3), warp Recombinant protein is expressed after IPTG induction, is purified with Ni-NTA affinity chromatography and is analyzed through SDS-PAGE and Western Blot and reflected It is fixed.

As a result, successfully constructing pET21a (+)/Z_{HPV16 E7}Affitoxin127,301,384,745 and pET21a (+)/ Z_wtAffitoxin recombinant plasmid (Figure 13)；The recombinant plasmid is in prokaryotic expression and obtains purifying Z_HPV16E7affitoxin127、Z_HPV16E7affitoxin301、Z_HPV16E7affitoxin384、Z_HPV16E7Affitoxin745 and Z_wtAffitoxin recombinant protein, it is about 45kDa (Figure 14 A, B) that SDS-PAGE electrophoresis, which prompts the molecular mass of the albumen,； Western blot result (Figure 14 C, D) display, how anti-His monoclonal antibody and rabbit SPA-Z be as primary antibody, is about in molecular mass 45kDa locates single band occur, prompts Z_HPV16E7affitoxin127、Z_HPV16E7affitoxin301、 Z_HPV16E7affitoxin384、Z_HPV16E7Affitoxin745 and Z_wtAffitoxin recombinant protein energy specific recognition rabbit SPA- Z polyclonal serum antibody.The result shows that Z_HPV16E7affitoxin127、Z_HPV16E7affitoxin301、 Z_HPV16E7affitoxin384、Z_HPV16E7Affitoxin745 and Z_wtAffitoxin recombination purifying protein is successfully prepared.

Z_HPV16E7Affitoxin albumen and target protein binding characteristic are studied: to verify Z_HPV16E7Affitoxin albumen with The characteristic that HPV16 E7 is combined, is further verified using SPR and cellular immunofluorescence method.Select Siha (HPV16+), Caski (HPV16+, HPV18+), HeLa229 (HPV16-, HPV18+) and melanoma cells A375 are as negative control, and method is the same as real Apply example 4.It will cultivate to Caski, Siha, HeLa229, A375 cell for 24 hours, adjusting cell number is 1 × 10⁶/ hole, culture For 24 hours to cell monolayer, the Z of final concentration of 50 μ g/ml is added_{HPV16 E7}affitoxin127、Z_{HPV16 E7}affitoxin301、 Z_{HPV16 E7}affitoxin384、Z_{HPV16 E7}Affitoxin745 and Z_wtAffitoxin albumen, 5%CO₂, 37 DEG C of culture 6h, warp After fixed, washing, 0.3%Triton x-100 punching is added 37 DEG C of closing 1h of 10%FBS+1640 culture medium, washs 3 with PBS It is secondary；It is separately added into the anti-His monoclonal antibody of mouse (ABR company, the U.S., 1:2000), rabbit-anti SPA serum (1:500) and rabbit-anti PE38KDEL serum (1:5000) sets 37 DEG C of 1h, and FITC- goat anti-rabbit igg secondary antibody is added after washing, and (Shanghai connection section biotechnology is public Department, China) and 2 μ l/ hole 1h of PI (Suo Laibao company, Beijing), it is protected from light, slide is covered after washing and with buffering glycerol mounting, it is total Confocal fluorescence microscope (Leica TCS SP2microscope Germany) is observed and makes film (40 ×).Meanwhile using being not added Z_{HPV16 E7}affitoxin127、Z_{HPV16 E7}affitoxin301、Z_{HPV16 E7}affitoxin384、Z_{HPV16 E7}affitoxin745 Albumen is primary antibody (1:5000) as positive control using rabbit HPV16 E7 serum antibody.

As a result, detecting through cellular immunofluorescence, display, Z are observed under confocal fluorescent microscopic_{HPV16 E7}affitoxin127、Z_{HPV16 E7}affitoxin301、Z_{HPV16 E7}affitoxin384、Z_{HPV16 E7}Affitoxin745 albumen is incubated The dotted or lumps fluorescence egg of the multiple greens of the nuclear membrane and cytoplasm kernel Zhou Kejian for Siha, Caski cell strain educated It is white, it is consistent with the result of HPV16 E7 rabbit anteserum antibody incubation, and HeLa229 cell and A375 cell strain are showed no significantly Fluorescence agglomerate (Figure 15 A-D), while Z_wtSiha, Caski, HeLa229 and A375 cell strain that affitoxin albumen is incubated for are equal Do not occur fluorescence agglomerate.Show Z_{HPV16 E7}affitoxin127、Z_{HPV16 E7}affitoxin301、Z_{HPV16 E7}affitoxin384、Z_{HPV16 E7}Affitoxin745 recombinant protein identification HPV16 E7, and nonrecognition HPV18E7, i.e., specifically Property identification living cells in naturally express the ability of HPV16 E7 albumen and remain unchanged, and the natural HPV16 E7 with living cells expression Albumen has very strong binding ability.The present embodiment further demonstrates Z from cellular level_{HPV16 E7}affitoxin127、Z_{HPV16 E7}affitoxin301、Z_{HPV16 E7}affitoxin384、Z_HPV16E7Affitoxin745 recombinant protein, which has, expresses with living cells HPV16 E7 albumen has very strong affinity.

Further Z is carried out in ProteOn XPR36 system instrument (Bio-Rad company)_{HPV16 E7}Affitoxin albumen and The affinity analysis to interact between HPV16E7 analyzes above-mentioned His label using surface plasma resonance technology (SPR) Z_HPV16E7affitoxin127、Z_{HPV16 E7}affitoxin301、Z_{HPV16 E7}affitoxin384、Z_{HPV16 E7}Affitoxin745 and Z_wtInteraction between affitoxin molecule (as negative control) and HPV16 E7.Experiment step Suddenly with embodiment 3.

As a result, surface plasma resonance technology (SPR) analysis is used to measure affinity dissociation constant KD value and be respectively 1.36×10^-6mol/L、1.76×10^-6mol/L、1.45×10^-6mol/L、3.90×10^-6mol/L.It is repeated twice detection.Knot Fruit shows the Z of purifying_HPV16E7Affitoxin 127, affitoxin 301, affitoxin 384,745 egg of affitoxin It is white (to have His₆Label) and ability of the HPV16E7 recombinant protein with interaction, as shown in Figure 16 A-D and table 2,4 Affitoxin albumen can in conjunction with HPV16 E7 recombinant protein, in conjunction with affinity have reached nmol/L grades of levels, and it is wild The Z of raw type_wtAffitoxin and HPV16 E7 recombinant protein shows filter out four affibody eggs almost without binding force White and HPV16E7 recombinant protein special affinity with higher.

The result shows that Z of the invention_HPV16E7affitoxin 127、affitoxin 301、affitoxin 384、 745 protein molecular of affitoxin (has His₆Label) have with HPV16E7 protein target molecule and be combined with each other and recognition capability. Further Z is demonstrated from protein level_HPV16E7affitoxin 127、Z_HPV16E7affitoxin 301、Z_HPV16E7affitoxin 384、Z_HPV16E7Affinity between affitoxin 745 and HPV16E7 target protein.

Z_HPV16E7Affitoxin in-vitro cell growth inhibiting effect: to study Z_HPV16E7Affitoxin in-vitro cell growth Inhibiting effect selects Z_HPV16E7Affitoxin384 albumen is as research object.Same selection Caski, Siha, HeLa229 and Tetra- kinds of tumor cell lines of A375 are as target cell.It prepares above-mentioned four kinds of cell suspensions and counts and be inoculated in 96 porocyte culture plates, 0.5×10⁴/ hole.After culture for 24 hours, 1 μ g/ml cycloheximide and 5% fetal calf serum is added, is then added Z_HPV16E7100 μ g/ml, 50 μ g/ml, 25 μ g/ml, 10 μ g/ml, 1 μ g/ml, five concentration groups are arranged in affitoxin384 albumen, With SPA-Z_wtFor control group (PE38KDEL), five same concentration groups are set, while setting culture medium control, using CCK-8 reagent Box detects the survival rate of cell, after sample-adding 1h, 3h, 6h, 12h, for 24 hours, 48h and 72h, 10 hole μ l/ of CCK-8 reagent is added, CO₂Continue incubation 30min in incubator and is placed on reading at microplate reader A450.Every group is respectively provided with 3 multiple holes, and carries out 3 weights Multiple experiment.Cell survival (Cell viability) calculation method are as follows: Cell viability (%)= (Z_HPV16E7The OD value of affitoxin384 group-culture medium group OD value)/(SPA-Z_wtControl group OD value-culture medium group OD value) × 100%；The IC50 value of cell growth survival is calculated with 5.0 software of GraphPad primer simultaneously.

As a result such as Figure 17, the growth survival of Siha and Caski cell is calculated through 5.0 software of GraphPad primer IC50 value, respectively 0.28 μM and 0.24 μM.Figure 18 shows, Z_HPV16E7384 pairs of affitoxin are expressed the HPV16 E7 positive Cervical cancer cell Siha and Caski have stronger lethal effect, and thin to the cervical carcinoma HeLa229 of the expression HPV18E7 positive Born of the same parents and the melanoma cells A375 of expression HPV feminine gender are without apparent lethal effect.Figure 19 shows, Z_HPV16E7affitoxin After 384 act on Siha and Caski 72h, cells survival rate is compared between control cell, Siha and Caski cells survival Compare between rate indifference (p > 0.05), Siha and Caski cell has conspicuousness compared between HeLa229 cells survival rate Difference (p < 0.05), and Siha and Caski cell compared between A375 cells survival rate also have significant difference (p < 0.05) there was no significant difference (p > 0.05) compared with, and between HeLa229 and A375 cells survival rate.Z_HPV16E7affitoxin Have significantly between 384 three dosage groups (100 μ g/ml, 10 μ g/ml and 1 μ g/ml) to Siha and Caski cell growth rate Sex differernce (p < 0.05), and there are no significant between 1 μ g/ml and PE38KDEL and medium controls difference (p < 0.05). Z_HPV16E7Affitoxin 384 and reference protein PE38KDEL act on Siha, and the comparison of cells survival rate has conspicuousness poor Different (p < 0.05)；And Z_HPV16E7Affitoxin384 and PE38KDEL compareed with culture medium between indifference (p > 0.05). Z_HPV16E7Affitoxin 384 and reference protein PE38KDEL act on Caski, and the comparison of cells survival rate has conspicuousness poor Different (p < 0.05)；And Z_HPV16E7Affitoxin384 and PE38KDEL compareed with culture medium between indifference (p > 0.05).With Upper result further demonstrates that, Z_HPV16E7There is affitoxin 384 external HPV16E7 targeting to combine and kill the special of cell Property.

Z_HPV16E7The pharmacokinetics of affitoxin384 albumen: 7 week old BALB/C-nu Female nude mices of selection, 5 nude mices Tail vein injection 5mg/kg Z_HPV16E7Affitoxin384, respectively in 1min, 5min, 15min, 30min, 60min, 120min When tail vein take blood 100 μ l, 5h after, anesthetized mice terminal takes blood.Separately take 5 nude mice tail vein injection 4mg/kg Z_{HPV16 E7:384}, 3 nude mice tail vein injection PBS100 μ l method and take the time point of blood specimen to be same as above as control.By blood After putting 37 DEG C of water bath 20min, 1500r, 4 DEG C of centrifugation 10min collect the degree packing of serum -80 and save.It is examined using ELISA method Survey affitoxin the and affibody concentration in serum.The HPV16E7 albumen of 10 μ g/ml is coated with 96 hole elisa Plates, 4 DEG C of mistakes At night, 1:50 dilute serum is added, 37 DEG C of incubations 2h after washing plus 3% skimmed milk power, after 37 DEG C of closing 2h, are added this room and prepare SPA-Z rabbit anteserum as secondary antibody, goat anti-rabbit igg-HRP (1:5000) 100 μ l/ is added in 100 holes μ l/, 37 DEG C of 1h after washing Hole, 37 DEG C of 1h；TMB developing solution is added in washing, and 100 holes μ l/, 37 DEG C are protected from light colour developing 30min；Set the reading of microplate reader 450nm wavelength Absorbance value.Repeat 3 multiple holes.It is arranged simultaneously and affibody is not added to be coated with after HPV16E7 albumen, and respectively with anti-16E7's Rabbit anteserum (1:1000) and SPA-Z rabbit anteserum (1:2000) are primary antibody as positive and negative control.Take 0,0.1 μ g/ml, 1 μ g/ Affibody the and affitoxin albumen of ml, 10 μ g/ml, 100 μ g/ml make standard curve through ELISA detection.

As a result, using the HPV16E7 albumen of purifying as envelope antigen, using Z in ELISA method detection serum_{HPV16 E7}Affibody and Z_{HPV16 E7}Affitoxin concentration draws standard curve.Z_HPV16E7Affibody and Z_HPV16E7Affitoxin's Calculation formula is respectively y=0.1295x-0.11065, R²=0.9942；Y=0.2378x-0.141, R²=0.9782.In nude mice The content in 1min, 5min, 15min, 30min, 60min, 120min and 300min blood after tail vein injection is respectively 122.59μg/ml、82.82μg/ml、54.25μg/ml、48.07μg/ml、45.37μg/ml、34.17μg/ml、28.49μg/ Ml, 20.66 μ g/ml and 112.28 μ g/ml, 91.36 μ g/ml, 67.28 μ g/ml, 51.09 μ g/ml, 42.05 μ g/ml, 32.49 μ G/ml, 29.54 μ g/ml, 24.14 μ g/ml draw curve (Figure 20 A, B) according to Graphpad prisimer5.0 and calculate, Z_{HPV16 E7}Affibody and Z_{HPV16 E7}The half-life period of affitoxin be respectively 6.231 ± 0.717min and 8.95 ± 0.389min, Z_{HPV16 E7}Affitoxin ratio Z_{HPV16 E7}The half-life period of affibody is about 2 minutes more.

Z_HPV16E7The median lethal dose of affitoxin albumen analyzes LD50: to study Z_{HPV16 E7}Affitoxin384 albumen Acute Toxicity selects BALB/c female mice as experimental subjects, and calculates its median lethal dose.Select 4w age BALB/c female Mouse, 18-20g are divided into 9 dosage groups, and every group of 5-7 only, is shown in Table 3.Every mouse tail vein is only once administered, and injects 200 μ l phases Answer the Z of dosage_{HPV16 E7}Affitoxin384 albumen.Observation index after administration: appearance, sign, weight and each dosage group mouse are dead It dies the time, continuous observation calculates LD50 to 14 days, and with Graphpad Primer5.0 method, detects in triplicate.As a result Z_{HPV16 E7}The LD50 of affitoxin384 albumen cause mouse half death are as follows: 15.577 ± 3.738mg/kg.

Table 3, Z_HPV16E7The Acute Toxicity of affitoxin384 albumen

Dosage, mg/kg

25

20

15

10

5

2.5

1

0.5

0.25

The death rate (1)

5/5

4/5

3/5

1/5

0/6

0/7

0/7

0/7

0/7

The death rate (2)

5/5

2/5

0/5

0/5

0/6

0/7

0/7

0/7

0/7

The death rate (3)

5/5

3/5

2/5

0/5

0/6

0/7

0/7

0/7

0/7

Z_{HPV16 E7}The protective effect of affitoxin albumen: to detect Z_{HPV16 E7}Affitoxin384 albumen is to tumour cell The protective effect of oncogenic function, the present embodiment prepare the tumour mould of BALB/c nude mice using the Siha cell of the HPV16 E7 positive Type, specific method are raised big in Wenzhou medical courses in general with embodiment 5, i.e. selection 4-5 week old BALB/c-nu mouse, weight 12-15g It learns in barrier system in experiment animal center in colleges (SPF grades), is divided into 5 groups, i.e. Z_HPV16E7Affitoxin384 protein groups, are arranged simultaneously Z_HPV16E7:384、PE38KDEL、Z_wtAffitoxin and PBS are as a control group.Every group 10~12. Affitoxin384.0mg/kg, while PE38KDEL (mg/kg) is set as a control group.48h will be cultivated to logarithmic growth phase Siha cell is configured to required cell number i.e. 1x10⁷/ ml takes 0.2ml in the nearly left forearm subcutaneous injection in the back of nude mice, together When each histone (being 4mg/kg) is diluted in the PBS of 0.2ml, while carrying out tumor cell inoculation by group through tail Intravenous injection 0.2ml corresponds to albumen, and PBS group only injects the PBS of 0.2ml.It injects 1 time, totally 6 times within every 3 days.Every 3 days observation mouse Life and the state of mind etc. measure tumor size and photograph to record, observe to 60 days.Mouse is put to death, while detecting mice serum Survey liver function.

Meanwhile to detect Z_{HPV16 E7}Therapeutic effect of the affitoxin384 albumen to Siha tumor-bearing mice, is optionally selected 4-5 weeks Age BALB/c-nu mouse is inoculated with 1x10⁷/ ml Siha cell, to 100~200mm of tumour growth³When size, it is divided into above-mentioned same 5 groups, every nude mice is through the total 0.2ml counter sample of tail vein injection 4mg/kg albumen.It injects 1 time, totally 6 times within every 3 days.Simultaneously Observation mouse life in every 3 days and the state of mind etc., measure tumor size and photograph to record, observe to 60 days.Mouse is put to death, simultaneously It detects mice serum and surveys liver function.

As a result as shown in Figure 21 A, Z_{HPV16 E7}Affitoxin384 albumen has certain guarantor to tumour cell oncogenic function Shield effect, Z_{HPV16 E7}The volume size and control group Z of affitoxin384 albumen dosage group tumour_HPV16E7:384、PE38KDEL、 Z_wtAffitoxin albumen and PBS group began to have significant difference (p < 0.01) at the 36th day respectively, and Z_HPV16E7: 384 with PE38KDEL、Z_wtAffitoxin albumen and PBS group began also to start to occur significant difference (p < 0.01) at the 42nd day respectively, but PE38KDEL、Z_wtIndifference (p > 0.05) between affitoxin albumen and PBS group.With the extension of time, gross tumor volume is big Small difference obviously becomes larger between each group, until 60 days.It is normal that liver function detects transaminase index.

Z_{HPV16 E7}Affitoxin384 albumen is shown in Figure 21 B to the therapeutic effect result of Siha tumor-bearing mice.Z_{HPV16 E7}Affitoxin384 protein groups and Z_HPV16E7:384、PE38KDEL、Z_wtAffitoxin albumen and PBS control group compare, to swollen The inhibiting effect of tumor growth began to have significant difference (p < 0.01) at the 30th or 36 day respectively, and Z_HPV16E7: 384 and Z_wt Affitoxin albumen, PE38KDEL albumen and PBS group compare also began significant difference (p < 0.01), Z occur in 36 days_wt Compare that there was no significant difference (p > 0.05) between affitoxin albumen, PE38KDEL albumen and PBS group.With the extension of time, Between each group, difference obviously becomes larger gross tumor volume size, until 60 days.It is normal that liver function detects transaminase index.

The above results show Z_{HPV16 E7}Affitoxin384 and Z_HPV16E7: 384 albumen all have protection or inhibit tumour thin The growth of born of the same parents, but with Z_{HPV16 E7}Affitoxin384 effect is strong.That is Z_{HPV16 E7}Affitoxin384 albumen and Z_HPV16E7: 384 there is HPV16 E7 to target tumor-inhibiting action.And toxic side effect is unobvious.

All references mentioned in the present invention is incorporated herein by reference, independent just as each document It is incorporated as with reference to such.In addition, it should also be understood that, after reading the above teachings of the present invention, those skilled in the art can To make various changes or modifications to the present invention, such equivalent forms equally fall within model defined by the application the appended claims It encloses.

Claims (14)

1. the polypeptide that the E7 albumen of a kind of pair of HPV 16 has binding affinity, which is characterized in that the polypeptide is Using Z sections of staphylococcal protein A of amino acid sequence as skeleton, the polypeptide obtained after 12-20 amino acid variation is carried out；This is more The amino acid sequence of peptide is selected from: sequence shown in SEQ ID NO:1-4 is any.

2. having the polypeptide of binding affinity, feature to the E7 albumen of HPV 16 as described in claim 1 It is, the K of the E7 protein-interacting of the polypeptide and HPV 16_DValue is 1 × 10^-6M to 1 × 10^-7M。

3. a kind of targeting molecule for targeting HPV 16, which is characterized in that the targeting molecule includes power Benefit requires any polypeptide of 1-2, and the conjugate being connected with the polypeptide, the conjugate include: cysteine Residue, Polypeptide tags inhibit the drug or detectable marker of HPV 16.

4. targeting molecule as claimed in claim 3, which is characterized in that the connection is coupling.

5. the targeting molecule of targeting HPV 16 as claimed in claim 3, which is characterized in that the inhibition The drug of HPV 16 includes: toxin, has and inhibits HPV 16 virus infection or inhibition tumour Effect, the tumour is the tumour of the HPV 16 positive.

6. targeting molecule as claimed in claim 5, which is characterized in that the toxin is selected from: diphtheria toxin, ricin Element, Pseudomonas Exotoxin.

7. a kind of isolated polynucleotides, any E7 egg to HPV 16 of coding claim 1-2 The white polypeptide with binding affinity.

8. a kind of polynucleotides, the targeting point of any targeting HPV 16 of coding claim 3-6 Son, and the wherein described conjugate is peptide.

9. a kind of recombinant vector, which is characterized in that the carrier includes polynucleotides described in claim 7 or 8.

10. a kind of host cell, which is characterized in that the host cell includes recombinant vector as claimed in claim 9, or it includes Have or genome in be integrated with polynucleotides described in claim 7 or 8.

11. a kind of any E7 albumen to HPV 16 of claim 1-2 for preparing has binding affinity Polypeptide method, which is characterized in that the described method includes:

(1) cell described in any one of claim 10 is cultivated, so that it is any described to human papilloma virus 16 to express claim 1-2 The E7 albumen of type has the polypeptide of binding affinity；

(2) polypeptide of (1) acquisition is isolated and purified.

12. any E7 albumen to HPV 16 of claim 1-2 have binding affinity polypeptide or The purposes of the targeting molecule of any targeting HPV 16 of claim 3-6, is used to prepare treatment human milk The drug of head 16 type of tumor virus infectious disease or HPV 16 expression positive tumor；Or

It is used to prepare the detection reagent of detection HPV 16 virus infection；Or

It is used to prepare the diagnosis of 16 type of diagnosis of human papilloma viral infectious disease or HPV 16 expression positive tumor Reagent.

13. a kind of pharmaceutical composition, which is characterized in that it includes:

E7 albumen claimed in claims 1-2 to HPV 16 has the polypeptide or claim of binding affinity The targeting molecule of any targeting HPV 16 of 3-6；With

Pharmaceutically acceptable carrier.

14. one kind is positive swollen for diagnosing or treating HPV 16 infection disease or HPV 16 expression The medicine box of tumor, which is characterized in that include: described in claim 1-2 any in the medicine box to HPV 16 E7 albumen there is the target of the polypeptide of binding affinity or any targeting HPV 16 of claim 3-6 Pharmaceutical composition described in tropism molecule or claim 13.