CN105838722A - Application of OsPEX11 gene and protein of gene to improvement of rice salt tolerance - Google Patents

Abstract

The invention discloses application of an OsPEX11 gene to improvement of rice salt tolerance. Downstream target protein OsPEX11 interacting with vital function protein OsCYP2 for adjusting and controlling rice salt tolerance is screened and verified through a yeast two-hybrid system (in vivo) and the GST pull-down (in vitro) technology, and it is proved that the gene participates in adjusting and controlling rice salt stress tolerance through the RNAi technology. The novel gene for adjusting and controlling rice salt tolerance is explored, the rice salt tolerance gene adjusting and controlling network and coherent signal transduction pathway are enriched, and a new thought is provided for the rice salt stress gene function research. Meanwhile, great significance is achieved for revealing the rice salt stress adjusting and controlling mechanism and improving rice productivity.

Description

OsPEX11 gene and albumen application in improving Salt Resistance of Rice thereof

Technical field

The present invention relates to biology field, particularly relate to OsPEX11 gene and albumen thereof answering in improving Salt Resistance of Rice With.

Background technology

The salination in agricultural land is on the rise, and China there are about 6.7 × 10⁴km²(Zhang Jianfeng, Shu Yumin, punishment is still in salting soil Army, etc. alkaline land improving utilizes and afforestation technology [J]. Journal of northeast Forestry university, and 2002,30 (6): 124-129), it has also become agriculture The restraining factors of industry sustainable development.

Under the conditions of hypersaline environment, crop growth is significantly suppressed, and mainly shows as photosynthetic rate low, nourishes and grows Slow with reproductive growth, effective dry-matter accumulation is low, thus has a strong impact on setting percentage.Salt stress is restriction crops in nature One of main abiotic stress of growth promoter and yield, along with the development of biotechnology and extensively apply, plant salt tolerance physiology And the research of molecular mechanism is achieved with certain progress.By the functional gene that salt tolerant regulatory pathway is relevant is cloned, and utilize Genetic transformation, it is thus achieved that the genetically modified crops of some salt tolerances, the most only crop breeding for stress tolerance provide new genetic resources, with Time agricultural land salination environment is made moderate progress, in terms of crops Recent Progress in Study on Salt Tolerance and agricultural land salination improvement show Tempting prospect.The degeneration-resistant research of crop is always an important goal in crop breeding direction, therefore, excavates salt resistant function base Because of resource, the genetically modified crops kind of selection-breeding high-salt tolerance is particularly important.

Plant can accumulate the levels of reactive oxygen species of excess under adverse circumstance, such as H₂O₂Deng, destroy cell membrane and some macromole, to planting Thing damages.Accordingly, plant also can synthesize some antioxidases and antioxidant carry out purged body in unnecessary active oxygen thing Matter, antioxidase mainly include peroxidase (POD), superoxide dismutase (SOD), catalase (CAT), Ascorbate peroxidase enzyme (APX) and glutathion reductase (GR) etc.；Antioxidant is mainly reduced glutathion (GSH), ascorbic acid (AsA), carotenoid, 2-tocopherol (vitamin E) and cysteine etc..

Research finds, under salt stress, activities of antioxidant enzymes significantly raises, and shows that activities of antioxidant enzymes height exists phase with tolerance degree Closing property (Mittova V, Tal M, Volokita M, et al.Up-regulation of the leaf mitochondrial and peroxisomal antioxidative systems in response to salt-induced oxidative stress in the wild salt-tolerant tomato species Lycopersicon pennellii[J].Plant Cell and Environment[J],2003,26:845-856).Salt stress is induced Under, increase 3 times in the case of arabidopsis phosphatide compound food (PHGPX) expression compared with normal (Sugimoto M,Sakamoto W.Putative phospholipid hydroperoxide glutathione peroxidase gene from Arabidopsis thaliana induced by oxidative stress[J].Genes Genetic Systems,1997,72: 311-316)；Similar phosphatide compound food is have also discovered big by salt stress induction in citrus Scale reaches, meanwhile, and the activity of ascorbate peroxidase enzyme in superoxide dismutase, glutathion peroxidase and kytoplasm Also it is to rise (Gueta-Dahan Y, Yaniv Z, Zilinskas BA, et al.Salt and oxidative stress:similar and specific responses and their relation to salt tolerance in citrus[J].Planta,1997,203:460-469)。ROS Scavenger also can remove the malonaldehyde that peroxidation of membrane lipids produces, thus protecting film structure, alleviates the wound that causes of Stress on Plant Evil (Chen Yao, Zheng Hailei, Xiao Qiang, etc. the salinity impact [J] on Spartina alterniflora's silicosis oxidant and anti-oxidant system. Xiamen University's journal, 2005,44(4):576-579).In plant chloroplast, work is removed in the catalytic action mainly by ascorbate peroxidase Property oxygen species (Shi QH, Zhu ZJ, Khalid AA, et al.Effects of iso-osmotic salt stress on the activities of antioxidative enzymes,H⁺-ATPase and H⁺-PPase in tomato plants[J].Acta Photophysiologica Sinica, 2004,30:311-316), other enzymatic activitys also can participate in the removing of active oxygen, but there is certain difference between different cultivars Not.Japonica rice salt-enduring cultivars Folium Allii tuberosi green grass or young crops POD and CAT activity in root under salt stress is better than salt density value type kind Wuyunjing No.8, SOD and APX is then not significantly different from, and shows to there is different antioxidase salt stress response mechanism between rice varieties (old Potiria pectinifera (Mukller et Tro Sehel), Cui Xiangju, Chen Xi, etc. salt stress and La³⁺To antioxidase and plasma membrane H in different salt tolerance rice root⁺-ATPase's Impact [J]. Acta Agronomica Sinica, 2007,33 (7): 1086-1093).

Under salt stress, the levels of reactive oxygen species of intracellular accumulation excess, will cause enzyme inactivation, protein degradation and Lipid peroxidation metabolism Deng, thus plant is damaged.Antioxidant reductase material can be at abduction delivering under salt stress, scavenging capacity oxygen species, alleviates Stress damage, as in encoding chloroplast in Fructus Lycopersici esculenti, utricule film Ascorbate peroxidase gene (LetAPX) is induced by salt stress. Clones coding antioxidase gene by can significantly improve after genetic transformation overexpression transformed plant salt tolerance (Alscher RG, Erturk N,Heath LS.Role of superoxide dismutases(SODs)in controlling oxidative stress in plants[J].Journal of Experimental Botany,2002,53:1331-1341；Wang J,Zhang H,Allen RD. Overexpression of an Arabidopsis peroxisomal ascorbate peroxidase gene in tobacco increases protection against oxidative stress.Plant and Cell Physiology,1999,40:725-732)。

In Nicotiana tabacum L., process LAN Fructus Lycopersici esculenti LetAPX gene is favorably improved the salt resistance ability of Nicotiana tabacum L., transgene tobacco under salt stress Percentage of seedgermination, the dry weight and fresh weight of plant seedlings of plant, APX enzymatic activity and removing H₂O₂Ability is all significantly higher than comparison (Sun Weihong, Li Feng, bundle Moral peak, etc. turn Fructus Lycopersici esculenti justice Ascorbate peroxidase gene and improve Tobacco Salt ability [J]. Scientia Agricultura Sinica, 2009, 42(4):1165-1171).In Nicotiana tabacum L., the gene of coding for glutathion S transferring enzyme and glutathion peroxidase is in the feelings of process LAN Also can improve the salt tolerance of Nicotiana tabacum L. under condition, effectively remove peroxidating material, improve gst enzyme and ascorbinase metabolic activity, Reduce peroxide injury (Roxas VP, Smith RK Jr, Allen ER, et al.Overexpression of that salt damage produces glutathione S-transferase/glutathione peroxidase enhances the growth of transgenic tobacco seedlings during stress.Nature Biotechnology,1997,15:988-991；Roxas VP,Lodhi SA,Garrett DK, et al.Stress tolerance in transgenic tobacco seedings that overexpress glutathione S-transferase/glutathione peroxidase[J].Plant Cell Physiology,2000,41:1229-1234).From escherichia coli The katE gene of middle clone can strengthen transgenic paddy rice salt tolerance by genetic transformation, and the catalase activity of this gene code is relatively Compare high 1.5-2.5 times, and can blossom and bear fruit under 100mM NaCl coerces (Nagamiya K, Motohashi T, Nakao K, et al.Enhancement of salt tolerance in transgenic rice expressing an Escherichia coli catalase gene, katE[J].Plant Biotechnology Report,2007,1:49-55)。

At present, the existing more report of Rice Resistance oxidase system research in terms of salt tolerant Physiology and biochemistry, but antioxidant reductase is resistance to The research of salt Gene mining and antioxidase gene salt tolerant molecule mechanism and Signal Transduction approach is worth further deeply grinding Study carefully.

Summary of the invention

The invention provides the application in improving Salt Resistance of Rice of a kind of OsPEX11 gene and albumen thereof, this OsPEX11 base Because of can direct regulation and control Salt Resistance of Rice, albumen OsPEX11 with functional protein OsCYP2 interaction, and can improve Oryza sativa L. to salt The toleration coerced.

Present invention finds the application in improving Salt Resistance of Rice of the OsPEX11 gene, described OsPEX11 gene is Os03g0302000。

Specifically, described application, including: build the over-express vector comprising described OsPEX11 gene, be situated between by Agrobacterium Lead and OsPEX11 gene is proceeded to rice cell, cultivate and generate Rice Salt plant.

Described over-express vector is p1300-Ubi.

Described Agrobacterium is EHA105.

It has also been found that with the albumen OsPEX11 of Oryza sativa L. cyclophilin PROTEIN C YP2 interaction in improving Salt Resistance of Rice should With, the encoding gene of described albumen OsPEX11 is Os03g0302000, and the encoding gene of described cyclophilin PROTEIN C YP2 is Os02g0121300。

The present invention passes through yeast two-hybrid system, screens one and known salt resistant function albumen from rice cDNA library The downstream target proteins of OsCYP2 interaction, through sequence homology comparison, is accredited as Peroxidase In Rice composition-factor, described egg The encoding gene of white OsPEX11 is Os03g0302000, and the encoding gene of described cyclophilin PROTEIN C YP2 is Os02g0121300.

Then, interaction target protein is separated, extract the expression vector of yeast cells, convert bacillus coli DH 5 alpha, utilize The ampicillin resistance marker of pGADT7 carrier separates interaction expression vector in the culture medium of LB+Amp, send biotech firm Order-checking, then carry out sequence alignment, it is accredited as Peroxidase In Rice composition-factor (OsPEX11).

Then, being detected by external pull-down and western blot, there is true interaction in checking OsCYP2 and OsPEX11, OsCYP2 and OsPEX11 is cloned into respectively prokaryotic expression carrier pGEX-4T-1 and pET28a, forms two amalgamation and expressions Carrier (GST albumen and OsCYP2 protein fusion expression, His albumen and OsPEX11 egg in pET28a in pGEX-4T-1 White amalgamation and expression), extract GST-OsCYP2 fusion protein and His-OsPEX11 fusion protein through GST and His purification magnetic bead, Utilize MagneGST Pull-Down System and His label coupling HRP to carry out interactions between protein test, test through DAB dyeing Card GST-OsCYP2 fusion protein and His-OsPEX11 fusion protein interaction.

Then, the method utilizing reverse genetics, verify this gene regulation Rice Salt function.Specifically include: at 200mM chlorine Change under sodium solution process, observe process LAN transformed plant and disturb the transformed plant Salt Stress Tolerance relative to wild type；Result Showing, interference transformed plant shows the phenotype more sensitive to salt stress relative to wild type and process LAN transformed plant.Associated salts The expression of results of stress regulatory gene is consistent with phenotype, and its activities of antioxidant enzymes result also verifies this result.

Finally, process LAN transformed plant is carried out ultrastructure observation of experimental with interference transformed plant.Find, process at salt stress Under, the chloroplast morphosis of WT lines changes, and a small amount of grana lamella and thylakoid are stacked and irregular；Cross The interior utricule of expression plant all keeps relative normal morphology with chloroplast, and disturbs the organelles such as the mitochondrion of plant all to present different Often form.

The present invention by yeast two-hybrid system (in vivo) and GST pull-down (in vitro) technology screening and demonstrate and The downstream target proteins OsPEX11 of adjusting and controlling rice salt tolerant critical function albumen OsCYP2 interaction, it is intended to explore new adjusting and controlling rice resistance to Salt gene, abundant Rice Salt gene regulatory network and Signal Transduction approach, provide new for Rice Salt gene functional research Thinking；Meanwhile, to disclosing, Under Salt Stress in Rice is machine-processed and raising Rice Productivity has important meaning.

Accompanying drawing explanation

Fig. 1 is yeast two-hybrid screening interaction albumen；

A:SD/-Trp-Leu-Ade-His/X-α-gal/AbA solid medium screens；B:SD/-Trp-Leu/X-α-gal solid is trained Support base screening.

Fig. 2 is the yeast interaction one to one checking of OsCYP2 albumen and OsPEX11 albumen；

DDO/X:SD/-Trp-Leu/X-α-gal；QDO/X/A:SD/-Trp-Leu-Ade-His/X-α-gal/AbA；

AD-OsPEX11:pGADT7+OsPEX11；BD:pGBKT7；BD-OsCYP2:pGBKT7+OsCYP2.

Fig. 3 is PAGE gel electrophoresis (A) and DAB dyeing (B) checking GST-OsCYP2 amalgamation and expression albumen；

1:GST albumen；2:GST-OsCYP2 fusion protein；M: pre-dyed albumen marker.

Fig. 4 is GST (Glutathione-S-transferase) pull-down；

GST:pGEX-4T-1；GST-OsCYP2:pGEX-4T-1+OsCYP2；His-PBF11:pET28a+OsPEX11.

Fig. 5 is T₀For process LAN and interference transformation tissue culture plant hygromycin selectable marker PCR detection；

M:DNA Marker F；P:p1300-RNAi；WT: WT lines；1-4: process LAN turns transformed plant；5-8: Interference transformed plant.

Fig. 6 is OsPEX11 gene overexpression and the salt stress phenotype analytical result of interference plant；

A: wild type；B: salt stress processes wild type；C:OsPEX11 gene overexpression plant；D: salt stress processes OsPEX11 Gene overexpression plant；E:OsPEX11 gene interference plant；F: salt stress processes OsPEX11 gene interference plant.

Fig. 7 is process LAN and interference plant OsPEX11 expression conditions under comparison (water process) and salt stress process；

WT: wild type；OsPEX11-OE1, OE2:OsPEX11 gene overexpression plant；OsPEX11-RNAi1, RNAi2: OsPEX11 gene interference plant.

Fig. 8 is that salt stress processes the sodium potassium ion accumulation on process LAN and interference plant and the impact of Physiology and biochemistry；

A: sodium potassium ion ratio；B: superoxide dismutase activity；C: peroxidase activity；D: catalase activity； E: mda content；F: proline content.

Fig. 9 is process LAN and interference plant salt stress related regulatory genes expression；

A:OsHKt2；1；B:OsHKt1；5；C:OsLti6a；D:OsLti6b；E:OsSOS1；F:OsNHX1；G: OsAKT1。

Figure 10 is on process LAN and the interference Ultrastructural impact of plant cell under salt stress processes；PM: plasma membrane；CW: cell Wall；G: basal granule；PG: plastoglobulus；MTC: mitochondrion.

A: wild type (H₂O process)；B: process LAN plant (H₂O process)；C: interference plant (H₂O process)；D: Wild type (NaCl process)；E: process LAN plant (NaCl process)；F: interference plant (NaCl process).

Detailed description of the invention

Below in conjunction with specific embodiment, the present invention will be described in detail.

Wherein, the rice varieties in the following example ' love knows the rising sun ' is provided by Hangzhou City Agricultural Science Research Inst..

Embodiment 1

One, the preparation of yeast Y2H competent cell and cotransformation

Cotransformation Yeast expression carrier pGBKT7+OsCYP2 and Oryza sativa L. pGADT7+cDNA library expression vector are to yeast Strain Y2H, competent yeast cells preparation and conversion；

Specifically comprise the following steps that

1) draw 1 μ l yeast strain Y2H bacterium solution and coat YPDA culture medium, cultivate 3-5 days for 30 DEG C；

2), during picking 2-3mm monoclonal is inoculated in 3ml YPDA fluid medium, 30 DEG C, 250rpm cultivates 8-12hr；

3) taking 5 μ l to be forwarded in 50ml YPDA fluid medium, 30 DEG C, 250rpm cultivates to OD₆₀₀Reach 0.15-0.3；

4) 700g room temperature is centrifuged 5min, abandons supernatant, is resuspended in 100ml YPDA fluid medium, 30 DEG C, and 250rpm trains Support to OD₆₀₀Reach 0.4-0.5；

5) 700g room temperature is centrifuged 5min, abandons supernatant, is resuspended in 30ml sterilizing ddH₂O；

6) 700g room temperature is centrifuged 5min, abandons supernatant, is resuspended in 1.5ml 1.1 × TE/LiAc；

7) during bacterium solution is transferred to 1.5ml centrifuge tube, 10000rpm is centrifuged 15s, abandons supernatant, is resuspended in 600 μ l 1.1 × TE/LiAc To the most standby；

8) in the 50ml sterile centrifugation tube of pre-cooling, it is sequentially added into 5 μ g Yeast expression carrier pGBKT7+OsCYP2,15 μ g PGADT7+cDNA library expression vector, 200 μ g Yeastmaker Carrier DNA, 600 μ l yeast Y2H competent cells；

9) add 2.5ml PEG/LiAc, mix latter 30 DEG C and hatch 45min, shake up mixing once every 15min；

10) add 160 μ l DMSO mixings, 42 DEG C of water-bath 20min, shake up mixing once every 10min；

11) 4000rpm is centrifuged 5min, abandons supernatant, is resuspended in 3ml YPDA Plus Medium, and 30 DEG C, 150rpm cultivates 90min；

12) 4000rpm is centrifuged 5min, abandons supernatant, is resuspended in the sodium chloride solution of 15ml 0.9%；

13) 15ml bacterium solution is coated SD/-Trp/-Leu/X-α-gal/AbA solid medium by 250 μ l/ wares, cultivate 3-5 for 30 DEG C My god；

14) picking blueness monoclonal is inoculated in SD/-Trp/-Leu/-Ade/-His/X-α-gal/AbA solid medium, 30 DEG C of cultivations 3-5 days.

Solid screening culture medium can grow and in blue yeast colony, be and possible there is interaction with OsCYP2 albumen Target protein (as shown in Figure 1A).

Two, separate and identify positive interaction target protein (internal)

Blue monoclonal in picking above-mentioned SD/-Trp/-Leu/-Ade/-His/X-α-gal/AbA solid medium, streak inoculation is extremely SD/-Trp/-Leu/X-α-gal solid medium, repeats 2-3 time, separates blue yeast monoclonal (as shown in Figure 1B), uses Little mensuration extraction yeast plasmid (Easy Yeast Plasmid Isolation Kit, Clontech, 630467), specifically comprises the following steps that

1) picking yeast blueness monoclonal is resuspended in the EDTA, 11000g of 500 μ l 10mM and is centrifuged 1min, removes supernatant；

2) adding the 200 μ l resuspended thalline of ZYM solution, add 20 μ l enzymolysis solutions, slight vortex mixes, 30 DEG C of shaken cultivation 1hr；

3) 2000g is centrifuged 10min, removes supernatant；

4) the 250 μ l resuspended thalline of Y1Buffer/RNase Asolution are added；

5) adding 250 μ l Y2Lysis Buffer, slight reverse mixing, room temperature places 3min；

6) adding 300 μ l Y3Neutralization Buffer, slight reverse mixing, 11000g room temperature is centrifuged 5min；

7) transfer supernatant is in new centrifuge tube, and 11000g room temperature is centrifuged 5min；

8) supernatant is transferred to Yeast Plasmid Spin Column, and 11000g room temperature is centrifuged 1min, abandons waste liquid；

9) adding 450 μ l Y4Wash Buffer, 11000g room temperature is centrifuged 3min, abandons waste liquid；

10) sky centrifuge tube 11000g room temperature is centrifuged 3min；

11) during adsorption column is placed in new 1.5ml centrifuge tube, adding 50 μ l YE Elution Buffer, room temperature stands 1min, 11000g Room temperature is centrifuged 1min；

12) reclaim plasmid to be placed in-20 DEG C and save backup.

By the plasmid transformation escherichia coli DH5 α of said extracted, it is coated with and the LB solid medium containing ampicillin, utilizes The ampicillin resistance marker of Yeast expression carrier pGADT7 screens interaction expression vector, little mensuration extraction plasmid, send biology Company checks order.Utilize ncbi database to carry out sequence homology comparison, identify that the albumen of above-mentioned sequential coding is peroxidase Composition-factor (Peroxisomal biogenesis factor 11).

The pGADT7+OsPEX11 plasmid that will separate, with pGBKT7 or pGBKT7+OsCYP2 cotransformation yeast respectively Strain Y2H, competent yeast preparation and Plastid transformation are with step one.

Take 100 μ l to convert bacterium solution to coat SD/-Trp/-Leu/X-α-gal and SD/-Trp/-Leu/-Ade/-His/X-α-gal/AbA solid In body culture medium, cultivate 3 days for 30 DEG C；Result shows, cotransformation Yeast expression carrier pGBKT and pGADT7+OsPEX11 Y2H bacterial strain can only grow and without blue signal in SD/-Trp/-Leu/X-α-gal solid medium, and cotransformation yeast table Reach the Y2H bacterial strain of carrier pGBKT7+OsCYP2 Yu pGADT7+OsPEX11 at SD/-Trp/-Leu/X-α-gal and SD/-Trp/-Leu/-Ade/-His/X-α-gal/AbA solid medium all can grow and in blue colonies (as shown in Figure 2), table There is interaction in bright OsCYP2 albumen and OsZFP albumen.

Three, GST-OsCYP2 fusion protein separates and Western Blot

OsCYP2 gene is cloned into prokaryotic expression carrier pGEX-4T-1 multiple clone site, and primer sequence is respectively GST-OsCYP2-F:CGGAATTCATGTCGAACACGAGGGTGTT (SEQ ID NO.1) and GST-OsCYP2-R:CCGCTCGAGCTAGGAGAGCTGGCCGCAGT (SEQ ID NO.2)；Build Recombinant vector convert to e. coli bl21, utilize GST protein adsorption magnetic bead (MagneGST Pull-Down System, Promega, V8870) isolated and purified GST albumen and GST-OsCYP2 fusion protein, specifically comprise the following steps that

1) taking fresh bacterium solution 1ml of 37 DEG C of incubated overnight, 10000g is centrifuged 2min, and freezing 15min at-20 DEG C, under room temperature Melt；

2) 200 μ l Cell Lysis Reagent resuspended mixing thalline are added；

3) add 2 μ l RQ1RNase-Free Dnase, rotate under room temperature and hatch 30min；

4) taking 20 μ l GST magnetic beads in 1.5ml centrifuge tube, be positioned on magnetic frame absorption magnetic bead, Aspirate supernatant is also thrown aside；

5) take off centrifuge tube and add 250 μ l MagneGST Binding/Wash Buffer resuspended mixing GST magnetic beads；

6) it is repeated 2 times step 4) and 5)；

7) 100 μ l MagneGST Binding/Wash Buffer (containing 1%BSA) resuspended mixing magnetic beads are added；

8) 200 μ l bacterial lysates being added magnetic bead solution, under room temperature, slight oscillatory rotates and hatches 30min；

9) centrifuge tube is positioned on magnetic frame absorption magnetic bead, and Aspirate supernatant is also thrown aside；

10) taking off centrifuge tube and add the 250 μ l MagneGST resuspended mixings of Binding/Wash Buffer, room temperature rotates hatches 5 min；

11) centrifuge tube is positioned on magnetic frame absorption magnetic bead, and Aspirate supernatant is also thrown aside；

12) it is repeated 3 times step 10) and 11)；

13) the 20 μ l MagneGST resuspended mixings of Binding/Wash Buffer are added standby；

Take GST albumen and the GST-OsCYP2 fusion protein point sample of the 5 above-mentioned purification of μ l, through SDS-PGAE gel (concentration 12%) electrophoretic separation, at fixative (500ml methanol, 100ml acetic acid and 400ml ddH₂O) 1hr is fixed in；Discard solid Determine liquid, add coomassie brilliant blue staining liquid (450ml methanol, 100ml acetic acid, 450ml ddH₂O and 1.6g Coomassie brilliant blue R-250), dye under room temperature 2hr；Discard dyeing liquor, add destaining solution (50ml methanol, 70ml acetic acid and 880ml ddH₂O), Decolour under room temperature 30hr, and observation is taken pictures, and GST albumen and GST-OsCYP2 fusion protein purification result are as shown in Figure 3A.

By Bio-Rad electroporation albumen in PAGE gel gone to PDVF film (transferring film liquid: 3.03g Tris base, 14.4g glycine, 200ml methanol, 880ml ddH₂O), transferring film condition is 330mA 2hr；Pvdf membrane is placed in 10ml In confining liquid (100ml PBS Buffer, 5g defatted milk powder), close 2hr for 37 DEG C；Add the GST antibody of coupling HRP, Press with an anti-diluent (1g BSA, 100ml film washing liquid, pH 7.4) and hatch 1hr under 1:1000 dilution proportion, room temperature；With Film washing liquid (0.5ml Tween 20,1000ml PBS Buffer) washes film 3 times, each 10min.Finally, Radix Cochleariae officinalis peroxide is used Change the colour developing of hydrogen enzyme DAB colour reagent box, and observation is taken pictures, GST albumen and GST-OsCYP2 fusion protein Western Blot Result is as shown in Figure 3 B.

Four, His-PBF11 fusion protein separates and GST Pull-Down

OsPEX11 gene is cloned into prokaryotic expression carrier pET28a multiple clone site, and primer sequence is respectively His-OsPEX11-F:CGCGGATCCATGGCCGCCGCCGCCGCCGC (SEQ ID NO.3) and His-OsPEX11-R:CCGCTCGAGGCACGAATTCCAATTCTTGT (SEQ ID NO.4)；The weight built Group vector to e. coli bl21, utilize His protein adsorption magnetic bead (MagneGST Protein Purification System, Promega, V8500) isolated and purified His albumen and His-OsPEX11 fusion protein, specifically comprise the following steps that

1) taking fresh bacterium solution 1ml of 37 DEG C of incubated overnight in 1.5ml centrifuge tube, 10000g is centrifuged 2min, at-20 DEG C Freezing 15min, thaw at room temperature；

2) 100 μ l 1 × FastBreak Cell Lysis Reagent resuspended mixing thalline are added；

3) 1 μ l Dnase I, rotational oscillation 20min under room temperature are added；

4) adding the reverse mixing of 10 μ l 5M NaCl, 30 μ l MagneHis Ni-Particles 10 times, room temperature stands 2min；

5) centrifuge tube is positioned on magnetic frame absorption magnetic bead, and Aspirate supernatant is also thrown aside；

6) take off centrifuge tube and add 150 μ l MagneHis Binding/Wash Buffer and the 15 μ l resuspended mixings of 5M NaCl, Room temperature rotates hatches 5min；

7) centrifuge tube is positioned on magnetic frame absorption magnetic bead, and Aspirate supernatant is also thrown aside；

8) it is repeated 2 times step 6) and 7)；

9) the 100 μ l MagneHis resuspended mixings of Elution Buffer, incubated at room 2min are added；

10) centrifuge tube is positioned on magnetic frame absorption magnetic bead, standby in Aspirate supernatant to new 1.5ml centrifuge tube；

11) the His-OsPEX11 fusion protein of 20 μ l purification is taken respectively to 5 μ l GST albumen and GST-OsCYP2 fusion protein Solidification magnetic bead liquid in；

12) 155 μ l MagneGST are added^TMBinding/Wash Buffer and 20 μ l 10%BSA, rotates under room temperature and hatches 1hr；

13) centrifuge tube is positioned on magnetic frame absorption magnetic bead, and Aspirate supernatant is also thrown aside；

14) taking off centrifuge tube and add the 400 resuspended reverse vibration mixings of μ l MagneGST Binding/Wash Buffer, room temperature is quiet Put 5min；

15) it is repeated 4 times step 13) and 14)；

16) adding 20 μ l 1 × SDS resuspended mixings of loading buffer, room temperature stands 5min；

17) centrifuge tube is positioned on magnetic frame absorption magnetic bead, standby in Aspirate supernatant to new 1.5ml centrifuge tube.

Take 5 μ l above-mentioned eluent point sample, PAGE gel electrophoresis and the same step 3 of transferring film method, after closing, add coupling HRP His antibody, wash film and DAB chromogenic reaction method ibid, Western Blot testing result as shown in Figure 4, shows OsCYP2 There is interaction in albumen and OsPEX11 albumen.

Embodiment 2

One, OsPEX11 gene overexpression and the salt stress phenotype analytical of interference plant

In order to verify OsPEX11 gene salt resistant function, OsPEX11 gene is cloned into p1300-Ubi and p1300-RNAi, Successfully construct this gene overexpression and interference carrier；Genetic expression vector introduction Agrobacterium EHA105, rice transformation tries Proved recipe method reference literature (Hiei Y, Ohta S, Komari T, et al.Efficient transformation of rice (Oryza sativa L.) mediated by Agrobacterium and sequence analysis of the boundaries of the T-DNA[J].Plant Journal, 1994,6:271-282), transformation tissue culture plant hygromycin selectable marker is carried out PCR detection checking (as shown in Figure 5), it is thus achieved that Process LAN and interference positive transformants plant.

With wild type, OsPEX11 gene overexpression plant and interference plant 10 days seedling as test material, add 200mM Under the conditions of the water planting of NaCl, after processing 24 hours, the blade table of wild type and OsPEX11 gene interference plant reveals crispaturas Morphological characteristic, and disturb the blade of plant that the phenomenon of part chlorosis occurs；And the OsPEX11 gene overexpression under the same terms is planted Strain is then acted normally (as shown in Figure 6).

Meanwhile, the transcriptional level of the OsPEX11 gene of three kinds of genotype seedling plants is carried out quantitative fluorescent PCR analysis, interior Ginseng gene primer sequence and OsPEX11 gene primer sequence are as follows:

Actin-F:GACCTTGCTGGGCGTGAT (SEQ ID NO.5)

Actin-R:GTCATAGTCCAGGGCGATGT (SEQ ID NO.6)

QRT-OsPEX11-F:GCGTCTACTACTTCCTCG (SEQ ID NO.7)

QRT-OsPEX11-R:GACTCCAGTTTGCCGATC (SEQ ID NO.8)

Result shows, OsPEX11 gene is significantly higher than respectively in process LAN plant and interference plant and is less than wild type；At salt Under stress-inducing, in process LAN plant, the transcriptional level of OsPEX11 gene is significantly higher than wild type (as shown in Figure 7), shows OsPEX11 gene response salt stress, and this gene overexpression can improve the toleration of transformed plant salt stress.

Two, OsPEX11 gene overexpression and the physiological and biochemical analysis of interference plant

Seedling plants under processing with above-mentioned salt stress, as test material, carries out relevant physiological Biochemical Indexes, including Na⁺/K⁺ Ion ratio, malonaldehyde (MDA), activities of antioxidant enzymes (ROS) and proline (Proline).Main measuring methods is with reference to literary composition Offer (Munns R, Wallace PA, Teakle NL, et al.Measuring soluble ion concentrations (Na⁺,K⁺,Cl^-)in salt-treated plants.Plant Stress Tolerance,Humana Press,2010,371-382；Hodges DM,DeLong JM, Forney CF,et al.Improving the thiobarbituric acid-reactive-substances assay for estimating lipid peroxidation in plant tissues containing anthocyanin and other interfering compounds[J].Planta, 1999,207:604-611；Dhindsa SR and Matowe W.Drought tolerance in two mosses:correlated with enzymatic defence against lipid peroxidation[J].Journal of Experimental Botany,1981,32:79-91； Rao L,Perez D,White E.Lamin proteolysis facilitates nuclear events during apoptosis[J].Journal of Cell Biology,1996,135:1441-1455；Aebi H.Catalases[J].Journal of Clinical Pathology,1984,2: 673-684；Bates L,Waldren R,Teare I.Rapid determination of free proline for water stress studies[J]. Plant and Soil,1973,39:205-207)。

Under the conditions of comparison (water process), Na⁺/K⁺Ion ratio is in wild type, OsPEX11 gene overexpression and interference plant It is not significantly different from.But under 200mM NaCl Stress treatment, wild type, process LAN plant and interference plant sodium ion and Potassium content all raises, and process LAN plant Na⁺/K⁺Ratio is substantially less than wild type and interference plant (such as table 1 and Fig. 8 A Shown in).

Na in three kinds of genotype under the conditions of table 1 different disposal⁺And K⁺Content

Note: same letter represents in 5% level without significant difference.

The further mensuration of physiological and biochemical index under salt stress, as shown in Fig. 8 B-8F, amassing of two process LAN plant malonaldehyde Tired low relative to WT lines 15.39% (OE1) and 29.14% (OE2), and SOD, the enzymatic activity of POD, CAT Dramatically increase (OE1:5.00,1.35 and 1.78 times；OE2:6.88,1.39 and 1.85 times).Meanwhile, process LAN plant dried meat The accumulation of propylhomoserin is consistent with the variation tendency of activities of antioxidant enzymes, has been respectively increased 3.81 times (OE1) and 4.46 times (OE2).

Result above shows that from physiological-biochemical level OsPEX11 gene overexpression can increase activities of antioxidant enzymes and proline amasss Tired, thus reduce the levels of peroxide of film fat, improve the salt tolerance of transformed plant.

Three, the relevant resistant gene of salt expression of OsPEX11 gene overexpression and interference plant is analyzed

The salt stress 7 of three kinds of genotype seedling plants, as test material, is correlated with by the seedling plants under processing with above-mentioned salt stress The expression of gene is analyzed, and reference gene primer sequence is with SEQ ID NO.5 and SEQ ID NO.6, and other gene draws Thing sequence is as follows:

qRT-OsHKT2；1-F:TGCATTCATCACTGAGAGGAG (SEQ ID NO.9)

qRT-OsHKT2；1-R:GGTGCAGTTTCTGCAACCTC (SEQ ID NO.10)

qRT-OsHKT1；5-F:CCCATCAACTACAGCGTCCT (SEQ ID NO.11)

qRT-OsHKT1；5-R:AGCTGTACCCCGTGCTGA (SEQ ID NO.12)

QRT-OsLti6a-F:CCTTCCAAGGTGATGGTGAA (SEQ ID NO.13)

QRT-OsLti6a-R:CCGTCCAAAGAACCAGAAAA (SEQ ID NO.14)

QRT-OsLti6b-F:GCTCCAAACCGCTTCATCTA (SEQ ID NO.15)

QRT-OsLti6b-R:CAAGAATTGGAGCACTCAGGA (SEQ ID NO.16)

QRT-OsSOS1-F:ATACTGAGTGGGGTTGTTATTGC (SEQ ID NO.17)

QRT-OsSOS1-R:AAAGGTAAATTTCAAAAGGTACATGG (SEQ ID NO.18)

QRT-OsNHX1-F:AATGATCACCAGCACCATCA (SEQ ID NO.19)

QRT-OsNHX1-R:AAGGCTCAGAGGTGACAGGA (SEQ ID NO.20)

QRT-OsAKT1-F:GAAACGAGCAATGCGTCAG (SEQ ID NO.21)

QRT-OsAKT1-R:CTTCTCACACAGCGCTTCC (SEQ ID NO.22)

Result shows, relative to wild type, Sodium ransport gene (OsHKT2；1 and OsHKT1；5) transcriptional level is in mistake Express in plant and interference plant and on notable respectively, to be in harmonious proportion downward (as illustrated in figures 9a and 9b)；It addition, cellular sodium Ion efflux Gene (OsLti6a and OsLti6b), sodium hydrion antiport gene (OsSOS1), vacuole sodium potassium hydrion antiport base Because the transcriptional level of (OsNHX1) and kalium ion transport gene (OsAKT1) process LAN plant and disturbs in plant just phase Instead (as shown in Fig. 9 C-9G), result above shows that from molecular level OsPEX11 gene has the biological function of salt tolerant.

Four, process LAN plant and interference plant cell Ultrastructural observation

Under the conditions of comparison (water process), wild type is normal with the organelle form of process LAN plant, chloroplast ovalize, Basal granule and Medium Culture utricule ordered arrangement, layer structure is compact, and outer chloroplast membrane is complete and contains the starch grain of large volume (such as figure Shown in 10A and 10B)；The chloroplast of interference plant is rounded, mitochondrial swelling around (as illustrated in figure 10 c).

Under salt stress processes, the chloroplast morphosis of WT lines changes, and a small amount of grana lamella and thylakoid are heap Stacked and irregular (as shown in Figure 10 D)；The interior utricule of process LAN plant all keep with chloroplast relative normal morphology (as Shown in Figure 10 E), and disturb the organelles such as the mitochondrion of plant all to present abnormal morphology (as shown in figure 10f).

Claims (5)

1.OsPEX11 gene application in improving Salt Resistance of Rice, it is characterised in that the base of described OsPEX11 gene Sequence is Os03g0302000.

Apply the most as claimed in claim 1, it is characterised in that including: build the table excessively comprising described OsPEX11 gene Reach carrier, by agriculture bacillus mediated, OsPEX11 gene is proceeded to rice cell, cultivate and generate Rice Salt plant.

Apply the most as claimed in claim 2, it is characterised in that described over-express vector is p1300-Ubi.

Apply the most as claimed in claim 2, it is characterised in that described Agrobacterium is EHA105.

5. with application in improving Salt Resistance of Rice of the albumen OsPEX11 of Oryza sativa L. cyclophilin PROTEIN C YP2 interaction, its feature Being, the encoding gene of described albumen OsPEX11 is Os03g0302000, the encoding gene of described cyclophilin PROTEIN C YP2 For Os02g0121300.