CN105821003A - Genetically engineered cell and application thereof - Google Patents

Abstract

The invention relates to a genetically engineered cell and its application. All alleles for coding carbohydrate chain modification related enzyme alpha-1,6-fucosyltransferase in a genome of the engineered cell are knocked-out. The engineered cell is used for expression of a fucose-free antibody. An antibody expressed by the engineered cell has higher ADCC activity than an antibody composition generated by parent cells, and the expressed CD20 antibody has higher antineoplastic activity.

Description

Genetically engineered cell and application thereof

Technical field

The present invention relates to a kind of genetically engineered cell and application thereof, be specifically related to engineering cell and the application thereof of a kind of genome mutation.

Background technology

Monoclonal antibody (mAbs) treatment cancer is utilized to achieve considerable success in recent years.Antibody drug coupling anticarcinogen becomes lymphoma and the strong new therapeutic choice of solid tumor, and immunoregulatory antibody the most also achieves the most clinical effect.

The mechanism that antibody causes tumor cytotoxicity mainly can be summarized as the following two kinds: 1. antibody directly acts on target spot, blocks receptor-mediated signal transduction thus inducing cell apoptosis；2. antibody is by immune-mediated cell killing mechanism, including such as antibody dependent cellular cytotoxicity (antibody-dependent cell-mediated cytotoxicity, and complement-dependent cytotoxicity (complement-dependent cytotoxicity, CDC) ADCC)；3. the antineoplastic immune function of regulatory T-cell；4. antibodies on tumor blood vessel and the specific effector of substrate.The antibody mainly playing antitumor action by terminating tumor cell signal transduction has Cetuximab (cetuximab) and Herceptin (trastuzumab) etc., and the main antibody being played antitumor action by ADCC has Rituximab (rituximab)；The anti-tumour antibody of regulatory T-cell immunologic function has easy Puli's nurse agate monoclonal antibody (ipilimumab) etc., is above most successful strategy, utilizes the antibody of these mechanisms play effects all to obtain approval.

ADCC refers to express natural killer cell (the natrual killer of antibody Fc receptor (such as Fc γ RIIIa/CD16), NK), macrophage or neutrophilic granulocyte etc., be combined with the Fc section of the IgG antibody having been incorporated into the target cells such as virus infected cell or tumor cell by Fc receptor, thus occur multiple cross-linked with target cell, and then activate and kill the effect of these target cells.IgG antibody can mediate the ADCC effect of these cells plays, and wherein NK cell is the main cell that can play ADCC effect.In the generating process of antibody-mediated ADCC effect, antibody can only be combined by the corresponding antigens epitope specificity on target cell, and the effector lymphocytes such as NK cell can kill any with the target cell of antibodies, therefore the antigen that antibody is on target cell to be combined be specific, NK cell etc. is nonspecific to the lethal effect of target cell.ADCC is the preferable mechanism utilizing antibody-mediated medicine to kill target cancerous cell.The NK cell of activation can discharge the cell toxicant matter direct killing target cell such as perforin, granzyme, it also is able to by Fas Yu FasL action pathway inducing cell apoptosis, it is also possible to secrete some cytokines such as inducing cell such as TNF-α or IFN-γ apoptosis, suppress cell proliferation and play immunoregulation effect.

Glycosylation is most important a kind of post translational modification, refers to be connected on protein glycosyl part.The secreting, expressing of post translational modification antagonist is very important, and glycosylation modified be most important of which one ring, monoclonal antibody glycosylation modified affects its function in vivo and stability, and the glycosylation modified of antibody is directly affected by expression host cell and antibody molecule nature.Immunogenicity and overall biological activity are had a significant impact by the change of glycosylation pattern.Oligonucleotide chain on the specific Asn of antibody molecule Fc section participates in the interaction of Fc and its receptor, and further research also finds that the type of oligonucleotide chain has a major impact for the affinity of Fc with its receptor.In the last few years, a lot of research reports show, remove or reduce the therapeutic antibodies of fucosylation and show higher usefulness (Biotechnol Bioeng.2006Jul 5 in vitro；94(4):680-8.).This mainly due to remove or reduce fucosylation therapeutic antibodies relative to the antibody of fucosylation, stronger ADCC effect (Mol Immunol.2007May can be shown by the high-affinity with Fc γ RIIIa at lower concentrations；44(12):3122-31.).Therefore, remove or reduce the application of defucosylated antibody and be expected to become the effective means improving therapeutic antibodies usefulness of future generation.Therefore, work out that to produce the engineering cell strain without defucosylated antibody be those skilled in the art's problem anxious to be resolved.

The synthesis that antibody molecule Fc section N-glucosides connects sugar chain is as described below: glycoprotein is modified with sugar chain in endoplasmic reticulum (hereinafter referred to as " ER ") chamber.In N-glucosides connects the biosynthesis step of sugar chain, relatively large sugar chain is transferred in ER chamber on the polypeptide chain of extension.In transition process, first sugar chain is added continuously on the phosphate group of long chain lipid carrier that is made up of about 20 α-isoprene units, referred to as dolichol phosphate (being hereafter sometimes referred to as " P-Dol ").That is, 2-Acetamido-2-deoxy-D-glucose is transferred to dolichol phosphate and forms GlcNAc-P-P-Dol, then shifts another GlcNAc, thus forms GlcNAc-GlcNAc-P-P-Dol.Next step, 5 mannose (mannose is referred to as " Man " the most sometimes) are transferred, therefore forming (Man) 5-(GlcNAc) 2-P-P-Dol, then four Man and three glucoses (hereafter glucose is sometimes referred to as " Glc ") are transferred.Therefore, define sugar chain precursor, (Glc) 3-(Man) 9-(GlcNAc) 2-P-P-Dol, it is referred to as defining core oligosaccharide.It is transferred in endoplasmic on the polypeptide containing asparagine-X-serine or asparagine-X-threonine sequence as a group containing 14 sugared sugar chain precursors.In the reaction, the dolichol phosphate (P-P-Dol) being bound on core oligosaccharide is released, but again becomes dolichol phosphate by the hydrolysis of pyrophosphatase, and is circulated again.The processing of sugar chain is immediately begun to polypeptide after sugar chain is combined.That is, three Glc and one or two Man are deleted in endoplasmic reticulum, it is known that α-1,2-glucosidase I, α-1,3-glucosidase II and α-1,2-mannosidase is relevant with deletion effect.Glycoprotein processed in endoplasmic reticulum is transferred on Golgi body, is carried out different modifications.In Gorky's body cavity cis part, there is the 2-Acetamido-2-deoxy-D-glucose phosphotransferase about adding mannose phosphoric acid, 2-Acetamido-2-deoxy-D-glucose 1-di-phosphate ester alpha-N-acetamino glucosidase and alpha-Mannosidase I, and Man residue is reduced to 5.Mid portion at Golgi body, there is the 2-Acetamido-2-deoxy-D-glucose transferase I (GnTI) of the interpolation relating to first GlcNAc in outside at complex N-glucosides connection sugar chain, relate to the alpha-Mannosidase II deleting two Man, relate to 2-Acetamido-2-deoxy-D-glucose transferase I I (GnTII) from second GlcNAc of outside interpolation and relate to fucose interpolation α-1 to the 2-Acetamido-2-deoxy-D-glucose of reduction end, 6-fucosyltransferase (encoding gene is FUT8).In the trans part of Golgi body, there is the galactosyl transferase relevant with the interpolation of galactose and sialyltransferase relevant with the interpolation of sialic acid such as N-acetyl-neuraminate or the like.It is to be formed by the effect of these different enzymes that known N-glucosides connects sugar chain.

TALENs technology is widely used for genome pointed decoration.But so far, either screening and the assembling process of ZNFs or TALENs all also exists higher technical difficulty, and the workload screened is the biggest.Additionally, the potential cytotoxicity problem of TALENs still needs people and carries out in-depth study.Clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR associated (Cas) system is Zinc finger nuclease (the zinc finger nucleases that continues, and the new technology that genome is carried out efficient pointed decoration of the latter of activating transcription factor sample effector nuclease (transcription activator like effector nucleases, TALENs) technology ZNFs).The system (Science 327,167 (2010)) with immunity and regulatory function of this system is antibacterial and archeobacteria is formed during evolution can degrade adventitious viruses or nucleic acid.Cas albumen in CRISPR/Cas system can carry out fixed point cutting (Science.2013Feb 15 under the guiding of gRNA (guide RNA) to DNA；339 (6121): 823-6 and Science.2013Feb 15；339 (6121): 819-23).The most easy high efficiency gene pointed decoration technology of exploitation that is found to be of CRISPR/Cas system provides brand-new platform.At this, we utilize CRISPR/Cas system fixed point to knock out FUT8 gene (the fucosyltransferase 8/alpha 1 being responsible for the fucosylated modification of albumen in Chinese hamster ovary celI, 6fucosyltransferase), and with the engineering cell strain of this gene knockout produced without fucosylated monoclonal antibody.

Summary of the invention

It is an object of the invention to, utilize CRISPR/Cas system that genes of interest group is carried out pointed decoration, obtain not express alpha-1, the mutant gene group of 6-fucosyltransferase, and producing without fucosylated antibody with the cell containing described mutant gene group, the antibody compositions that the antibody compositions that described cell produces produces than its parental cell has higher ADCC activity.

A first aspect of the present invention, it is provided that a kind of genetically engineered cell, encodes sugar chain modified relevant enzyme α-1 in the genome of described cell, all allele of 6-fucosyltransferase are knocked；In described sugar chain in 1 of the fucose sugar chain complex being connected with N-glucosides 6 of the 2-Acetamido-2-deoxy-D-glucose of reducing end by α-bonded.It is also preferred that the left possibly together with spCas9 gene in the genome of described cell；More preferably, possibly together with the gRNA gene of targeting FUT8 gene in the genome of described cell, the gene order of described gRNA is: the upstream of SEQ ID NO.1 targeting FUT8 gene, the middle reaches of SEQ ID NO.2 targeting FUT8 gene and the downstream of SEQ ID NO. 3 targeting FUT8 gene.

Further, described cell has a resistance at least one agglutinin following: LcA, pisum sativum agglutinin, bean lectin and Pericarpium Citri Reticulatae Auricularia agglutinin.

Further, described cell is: derives from the Chinese hamster ovary celI of Chinese hamster ovary tissue, rat myeloma cell system, YB2/3HL.P2.G11.16Ag.20 cell, mouse myeloma cell line NS0 cell, mouse myeloma cell line SP2/0-Agl4 cell, derive from the bhk cell of Syria hamster nephridial tissue or/and produce the hybridoma of antibody；The most described cell is Chinese hamster ovary celI.

Further, described cell contains the gene of encoding antibody molecule.It is also preferred that the left described antibody molecule is: people's antibody, humanized antibody, antibody fragment containing people's antibody or humanized antibody Fc district are or/and containing by people's antibody or the fusion protein of humanized antibody Fc.It is also preferred that the left described antibody molecule belongs to IgG type.

Further, the antibody compositions that the antibody compositions that described cell produces produces than its parental cell has higher ADCC activity.In the sugar chain of the antibody compositions that described cell produces, in the sugar chain complex that 1 of fucose is not connected with N-glucosides, 6 of the 2-Acetamido-2-deoxy-D-glucose of reducing end are passed through α-bonded.

A second aspect of the present invention, it is provided that a kind of without fucosylated antibody, described antibody is expressed by the cell described in first aspect present invention.

A third aspect of the present invention, it is provided that the purposes of cell described in first aspect present invention, it is for preparing without fucosylated antibody.

Said gene engineering cell strain disclosed by the invention obtains by the following method: the Cas albumen in CRISPR/Cas gene targeting system can carry out fixed point cutting under the guiding of gRNA to DNA, we devise the sequence of the gRNA of targeting Chinese hamster FUT8 gene, these sequences are synthesized by Suzhou Jin Weizhi Technology Service Co., Ltd, then we with this special targeting system by the FUT8 gene knockout in Chinese hamster ovary celI, then successful cell clone is knocked out with corresponding agglutinin screening-gene, the resisting cell limiting dilution assay monoclonal that finally we will obtain, obtain the cell strain that we are announced.

Applicant of the present invention has carried out the experiments such as affinity detection, ADCC test, pharmacokinetics, internal suppression tumor growth to antibody produced by said gene engineering cell strain.Test result indicate that, produced by genetic engineering Chinese hamster ovary celI strain disclosed by the invention, CD20 antibody is compared with the corresponding antibodies that parental cells produces, and can be combined with higher affinity with Fc γ RIIIa/CD16, and have higher ADCC effect.Additionally, the corresponding antibodies that CD20 antibody produced by genetic engineering Chinese hamster ovary celI strain disclosed by the invention and parental cells produce does not has notable difference in terms of pharmacokinetics.Finally experiment shows, under equal dose, CD20 antibody produced by genetically engineered cell strain disclosed by the invention has more preferable antitumous effect.Result above has all reached the purpose of the present invention.

Accompanying drawing explanation

Fig. 1 is the fucosylated detection of anti-CD 20 antibodies；

Fig. 2 is the affinity of anti-CD 20 antibodies and Fc γ RIIIa/CD16；

Fig. 3 is the ADCC effect of anti-CD 20 antibodies；

Fig. 4 is the pharmacokinetics of anti-CD 20 antibodies；

Fig. 5 is the anti-tumor in vivo activity of anti-CD 20 antibodies.

Detailed description of the invention

Following example, experimental example are to further illustrate the present invention, should not be construed as limitation of the present invention.Embodiment does not include the detailed description to conventional method, as those are for carrier construction and the method for plasmid, the gene of encoding proteins is inserted into such carrier and the method for plasmid or the method that plasmid introduces host cell.Such method is well-known to person having ordinary skill in the art, and all it is described in many publications, such as: Sambrook, J., Fritsch, E.F.and Maniais, T. (1989) Molecular Cloning:A Laboratory Manual, 2nd edition, Cold Spring Harbor Laboratory Press.

The structure of embodiment 1:FUT8 gene knockout carrier

Cas albumen in CRISPR/Cas system can carry out fixed point cutting under the guiding of gRNA (guide RNA) to DNA.We obtain CRISPR/Cas gene targeting carrier pX335-U6-Chimeric_BB-CBh-hSpCas9n (D10A) through optimizing (to buy from Addgene, article No. Plasmid 42335 at this；Science.2013Feb 15；339 (6121): 819-23), this vector expression codon through optimization thus be suitable in mammalian cell express Cas9 gene, additionally the targeted rna sequence designed can also be inserted U6 promoter downstream thus realize the expression of chimeric gRNA by this carrier, thus realizes the gene targeting function that CRISPR/Cas system is complete.The full-length gene order (XM_003501735.1) of the Chinese hamster FUT8 that the sequential design of the gRNA of targeting FUT8 gene and selection are announced with reference to American National Biotechnology Information center (National Center for Biotechnology Information, NCBI).We devise the upper, middle and lower reaches of three sections of gRNA targeting FUT8 genes respectively: TGCGGGCATGGACTGGTTCC, AAACAAGCTAGGAATGATCT, AGATGGAGCAGGTGAGTGGC.These fragments are synthesized by Suzhou Jin Weizhi Technology Service Co., Ltd, and the fragment after synthesis is inserted into the site that the restricted enzyme BbsI (New England Biolabs) in U6 promoter downstream identifies.Confirm after sequence verification to obtain correct clone.Above-mentioned plasmid transfection DH-5 α competent cell, shakes culture in glassware after picking monoclonal, takes out the plasmid used by test kit (the raw chemical product in Shanghai) acquisition transfected Chinese hamster cell CHO in business-like.

Embodiment 2:CRISPR/Cas/FUT8 gene knockout carrier transfection CHO cell

30ml density 5 × 10 is inoculated in 125ml cell cultivates shaking flask⁵CHO-S (the Life technologies Products) cell of individual/ml, within second day, cell density increases to 1 × 10⁶Transfect when individual/ml and Cell viability are higher than 95%: the CRISPR/Cas/FUT8 gene knockout carrier that 50 μ l concentration are 1 μ g/ μ l is diluted to 1.45mlOptiPRO^TMIn SFM (Life technologies product), mix gently；By 50 μ l transfection reagent FreeStyle^TMMAX (Life technologies product) is diluted to 1.45mlOptiPRO^TMIn SFM, mix gently；Immediately by the FreeStyle after dilution^TMMAX solution is slowly added in the DNA solution after dilution, adds fashionable rifle head and is dipped under liquid level and slowly drain；Turning upside down immediately and make solution mix for several times, incubated at room temperature about 10 minutes is so that DNA-liposome complex is formed；By 3mlDNA-FreeStyle^TMMAX complexes drop-wise joins in the shaking flask of above-mentioned cultivation cell, limit edged jog culture bottle；Cell culture after transfection be placed in 37 DEG C, 8%CO2, rotating speed 130rpm cell culture table on cultivate.

If FUT8 gene is by successful knockout or inactivation, FUT8 can reduce in intracellular activity, so the fucosylated of epicyte protein can reduce, thus this kind of cell has resistance to the agglutinin that can identify fucose (1 by α bond together in the sugar chain of N-acetyl-glucosamine 6).After transfecting 48 hours, centrifugal collecting cell.Culture fluid is changed into and (derives from the lens culinaris agglutinin of Lens culinaris containing 800 μ g/ml LcA LCA, fucose can be identified；Sigma product) the Selective agar medium stable resistance clone of screening；After about two weeks, when Cell viability and density recover, centrifugal collecting cell, limiting dilution assay seeds cells into (Corning product) in round bottom 96 orifice plate and makes cell monoclonal.Growth reaches a certain degree of cell and is inoculated into 12 holes or 6 holes further and is even transferred in culture bottle, continues thereafter with and cultivates in the culture medium containing phytohemagglutinin.

After monoclonal cell strain commercial kit (the raw chemical product in the Shanghai) extracted total RNA set up reverse transcription become cDNA, the catastrophe of wherein FUT8 gene is detected by PCR method, PCR forward primer sequence is: 5'-TATGGATCCATGCGGGCATGGACTGGTTCCTGG-3', and reverse primer sequences is: 5'-ATAGCGGCCGCATTTTTCAGCTTCAGGATATGTAGG-3'.PCR all use high-fidelity DNA polymerase (Takara companyHS DNA Polymerase).Amplification FUT8 gene reaction condition rationally arrange according to archaeal dna polymerase manufacturer's description: 95 DEG C 20 seconds；55 DEG C 10 seconds, 72 DEG C of 1 point/kb；30 circulations.PCR primer through agarose gel electrophoresis purification reclaim after again through restricted enzyme BamH I and Not I enzyme action, be then cloned into clonotype carrier pBluescript (+) in, the carrier after clone be used for check order.Filter out the monoclonal cell strain of gene reading frame generation frameshift mutation, be denoted as CHO-S-FUT8-/-, do next step analysis and checking.

Embodiment 3: anti-CD 20 antibodies is at CHO-S-FUT8^-/-In expression and purification

30ml density 5 × 10 is inoculated in 125ml cell cultivates shaking flask⁵CHO-S or CHO-S-FUT8^-/-Cell, within second day, cell density increases to 1 × 10⁶And Cell viability transfects when being higher than 95%, concrete transfection method is as described in example 2 above.After transfecting 48 hours, centrifugal collecting cell, culture fluid is changed into the Selective agar medium containing 20 μ g/ml puromycin (Puromycin) and 200nM methotrexate (MTX) and screens the resistance clone of stable transfection；After about two weeks, when Cell viability and density recover, centrifugal collecting cell, culture fluid is changed into containing 50 μ g/ml puromycin (Puromycin) and the Selective agar medium of 1000nM methotrexate (MTX)；After about one week, when Cell viability and density recover, centrifugal collecting cell, culture fluid is changed into the culture medium without antibiotic, be placed in 37 DEG C, 8%CO2, rotating speed 130rpm shaking table on suspension culture 10 days, period added glucose at the 3rd, 5,7,9 days with the final concentration of 4g/L；After 10 days, cell culture is after low-speed centrifugal 300g × 5min removes most cells and cell debris, the solid content still suspended is removed again through high speed centrifugation 10000g × 10min, then sucking filtration (filter sizes 0.45 μm), finally with Protein A affinity column (GE Products) isolated and purified anti-CD 20 antibodies from the supernatant liquid obtained.Purified product is dialysed through PBS, finally carries out quantitatively with human normal immunoglobulin for standard substance BCA (Bicinchoninic acid) method.

Embodiment 4: the fucosylated detection of anti-CD 20 antibodies

Sugar chain analysis uses ELISA method: LcA LCA 0.05mol/L carbonate buffer solution (pH 9.6) is diluted to 2 μ g/ml, and the protein solution after the 100 above-mentioned dilutions of μ l is added in the 96 every holes of hole ELISA Plate, 4 DEG C in wet box overnight；Next day, discard solution in hole, wash 3 times with lavation buffer solution (containing the phosphate buffer of 0.05%Tween-20), each 3 minutes；By different dilution comparison anti-CD 20 antibodies, at the anti-CD 20 antibodies of CHO-S-FUT8-/-middle expression, and be added in the most coated above-mentioned reacting hole with the comparison anti-CD 20 antibodies eliminating sugar chain through N-glycosidase F (Takara Products) digestion, put 37 DEG C and hatch 1 hour；Then wash with lavation buffer solution, add goat anti-human igg 1 antibody (Fab is special, Sigma Products) of horseradish peroxidase-labeled in each reacting hole, hatch 1 hour for 37 DEG C, washing；In each reacting hole, add the tmb substrate solution 0.1ml colour developing of Extemporaneous, place 10～30 minutes for 37 DEG C；In each reacting hole, add 2mol/L sulphuric acid 0.05ml terminate reaction；Put (SpectraMax i3Multi-Mode Platform, BIO-TEK company of the U.S.) in microplate reader and measure mensuration light absorption value at 450nm wavelength.

Test result indicate that: as it is shown in figure 1, the anti-CD 20 antibodies that described modification makes CHO-S-FUT8-/-expression does not exist fucosylated modification.

Embodiment 5: without the affinity test experience (ELISA method) of fucosylated anti-CD 20 antibodies Yu Fc γ RIIIa/CD16

Recombiant protein Fc γ RIIIa (R&D Products) of two kinds of variants of experimental procedure: V158 and F158 is diluted to 2 μ g/ml respectively with 0.05mol/L carbonate buffer solution (pH 9.6), the protein solution after the 100 above-mentioned dilutions of μ l is added in the 96 every holes of hole ELISA Plate, 4 DEG C in wet box overnight；Next day, discard solution in hole, wash 3 times with lavation buffer solution (containing the phosphate buffer of 0.05%Tween-20), each 3 minutes；Different dilution anti-CD 20 antibodies 100 μ l are added in the most coated above-mentioned reacting hole, put 37 DEG C and hatch 1 hour；Then wash with lavation buffer solution, add goat anti-human igg 1 antibody (Fab is special, Sigma Products) of horseradish peroxidase-labeled in each reacting hole, hatch 1 hour for 37 DEG C, washing；In each reacting hole, add the tmb substrate solution 0.1ml colour developing of Extemporaneous, place 10～30 minutes for 37 DEG C；In each reacting hole, add 2mol/L sulphuric acid 0.05ml terminate reaction；Put (SpectraMax i3 Multi-Mode Platform, BIO-TEK company of the U.S.) in microplate reader and measure mensuration light absorption value at 450nm wavelength.

Test result indicate that: as in figure 2 it is shown, compared with control antibodies, two variants of Fc γ RIIIa are respectively provided with higher affinity without fucosylated anti-CD 20 antibodies.

Embodiment 6: the ADCC effect without fucosylated anti-CD 20 antibodies is tested

Experimental procedure: people Burkitt's lymphoma cell line Daudi and Raji cell are purchased from American type culture collection (American type culture collection, ATCC), the target cell in testing as ADCC.Effector lymphocyte's PERIPHERAL BLOOD MONONUCLEAR CELL is isolatable from Fresh human peripheral's blood by Ficoll density gradient centrifugation, and with 3 × 10⁵The concentration in/hole adds to experimental port, and finally making effector lymphocyte is 50:1 with the ratio of target cell.37 DEG C hatch 4 hours after by lactate dehydrogenase L DH method (Sigma Products) detect killing situation.

Result shows: as it is shown on figure 3, have higher ADCC usefulness without fucosylated anti-CD 20 antibodies than fucosylated antibody.

Embodiment 7: without the pharmacokinetic studies of fucosylated anti-CD 20 antibodies

Experimental procedure: 10 week old, no-special pathogen (Specific-pathogen free, SPF) Thirty male rats, body weight 350-400g, it is randomly divided into eight groups, often group four, by subcutaneous injection (Subcutaneous, S.C.) or intravenous injection (Intravenous, I.V.) giving drug solvent respectively, compare anti-CD 20 antibodies and without fucosylated anti-CD 20 antibodies, the dosage of antibody is set to 4mg/kg.All rats are 0.5h, 1h, 2h, 6h, 12h, 24h after injection, 48h, 5d, 10d, 15d, 20d, 25d, taking blood (angular vein takes blood), every rat extracting blood about 100 μ l after 30d, the heparin adding 0.1% mixes, and 4000rpm is centrifuged 20min, takes supernatant, abandons precipitation.In detection blood plasma, the concentration of antibody uses ELISA method: recombinant protein c D20 (R&D Products) 0.05mol/L carbonate buffer solution (pH 9.6) is diluted to 2 μ g/ml, the protein solution after the 100 above-mentioned dilutions of μ l is added in the 96 every holes of hole ELISA Plate, 4 DEG C in wet box overnight；Next day, discard solution in hole, wash 3 times with lavation buffer solution (containing the phosphate buffer of 0.05%Tween-20), each 3 minutes；Different dilution rat plasmas are added in the most coated above-mentioned reacting hole, put 37 DEG C and hatch 1 hour；Then wash with lavation buffer solution, add rat anti-human's IgG1 antibody (Fc is special, Sigma Products) of horseradish peroxidase-labeled in each reacting hole, hatch 1 hour for 37 DEG C, washing；In each reacting hole, add the tmb substrate solution 0.1ml colour developing of Extemporaneous, place 10～30 minutes for 37 DEG C；In each reacting hole, add 2mol/L sulphuric acid 0.05ml terminate reaction；Put (SpectraMax i3Multi-Mode Platform, BIO-TEK company of the U.S.) in microplate reader and measure mensuration light absorption value at 450nm wavelength.

Result shows: as shown in Figure 4, compares anti-CD 20 antibodies and is not significantly different from without the metabolism in vivo of fucosylated anti-CD 20 antibodies.

Embodiment 8: the internal suppression tumor growth experiment of anti-CD 20 antibodies

For the anti-tumor in vivo activity of detection anti-CD 20 antibodies, use the people's Replanting model mice with Balb/c-nu/nu as host herein.First the Male athymic nude mice Balb/c-nu/nu (Shanghai Slac Experimental Animal Co., Ltd.) by tail vein injection, people's Burkitt's lymphoma cell line Daudi cell being inoculated in 5-6 week old is internal, every inoculation 1 × 10⁶Individual tumor cell；Inoculate second day mice random packet, often group 8, respectively by lumbar injection (Intraperitoneal, I.P.) give to compare anti-CD 20 antibodies and without fucosylated anti-CD 20 antibodies, and irrelevant protein control human IgG1 and drug solvent PBS, comparison anti-CD 20 antibodies dosage is set to 4mg/kg, arranges low middle high three dosage groups without fucosylated anti-CD 20 antibodies: 1,2,4mg/kg；Hereafter Per-Hop behavior twice, the mice to inoculation Daudi cell, add up the death condition of each group of mice every day, final data Kaplan-Meier survival curve is analyzed.

Result shows: as it is shown in figure 5, mouse survival rate is basically identical between irrelevant protein control human IgG1 and drug solvent PBS group；Compared with comparison anti-CD 20 antibodies, without the more significantly survival rate extending mice of fucosylated anti-CD 20 antibodies energy, illustrate that the latter is higher to the inhibitory action of growth of tumour cell.

Claims (7)

1. a genetically engineered cell, it is characterised in that: the genome of described cell encodes sugar chain modified relevant enzyme α-1,6-rock All allele of algae glycosyl transferase are knocked；In described sugar chain in 1 of the fucose sugar chain complex being connected with N-glucosides 6 of the 2-Acetamido-2-deoxy-D-glucose of reducing end are by α-bonded.

2. cell as claimed in claim 1, wherein, described cell has resistance at least one agglutinin following: Radix Crotalariae szemoensis coagulates Collection element, pisum sativum agglutinin, bean lectin and Pericarpium Citri Reticulatae Auricularia agglutinin.

3. cell as claimed in claim 2, wherein, described cell contains spCas9 gene.

4. cell as claimed in claim 3, wherein, contains the gRNA gene of targeting FUT8 gene in the genome of described cell, The gene order of described gRNA is: in the upstream of SEQ ID NO.1 targeting FUT8 gene, SEQ ID NO.2 targeting FUT8 gene Trip and the downstream of SEQ ID NO.3 targeting FUT8 gene.

5. cell as claimed in claim 4, wherein, described cell is: derive from Chinese hamster ovary tissue Chinese hamster ovary celI, Rat myeloma cell system, YB2/3HL.P2.G11.16Ag.20 cell, mouse myeloma cell line NS0 cell, mouse myeloma Cell line SP2/0-Agl4 cell, derive from Syria hamster nephridial tissue bhk cell or/and produce antibody hybridoma.

6. one kind without fucosylated antibody, it is characterised in that described antibody is expressed by the cell described in any one of claim 1-5.

7. the cell described in any one of claim 1-5 is being prepared without the application in fucosylated antibody.