CN105820965B - The Wine brewing yeast strain of one plant of artificial synthesized II chromosome - Google Patents
The Wine brewing yeast strain of one plant of artificial synthesized II chromosome Download PDFInfo
- Publication number
- CN105820965B CN105820965B CN201510008356.4A CN201510008356A CN105820965B CN 105820965 B CN105820965 B CN 105820965B CN 201510008356 A CN201510008356 A CN 201510008356A CN 105820965 B CN105820965 B CN 105820965B
- Authority
- CN
- China
- Prior art keywords
- bacterial strain
- wine brewing
- strain
- brewing yeast
- chromosome
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Abstract
The present invention provides artificial synthesized Wine brewing yeast strains and application thereof.More specifically, the present invention provides the Wine brewing yeast strain of one plant of artificial synthesized II chromosome, which was preserved in China typical culture collection center on September 19th, 2014, and deposit number is CCTCC NO:M 2014434.The Wine brewing yeast strain can be used for the optimization production of metabolite；Mutant library is generated by induction SCRaMbLE, for screening the bacterial strain with various characteristics；As screening implement, high flux screening is carried out to the metabolic pathway of addition.
Description
Technical field
The present invention relates to bioengineering fields, more particularly it relates to artificial chromosome and application thereof.
Background technique
An important research direction of the life as synthetic biology is synthesized, in recent years always scientist's research and discussion
Hot spot.2002, the artificial synthesized spinal cord ash of the EckardWimmer research group in the state university's small stream stone branch school in USA New York
The scorching viral full-length genome (about 7.5kb) of matter, has started the beginning [1] of artificial synthesized life.2003 and 2005,It bites
Thallus and spanish influenza viral genome are again respectively by artificial synthesized [2,3].2008, J.Craig Venter research institute
Daniel G.Gibson et al. completes genital tract mycoplasma (Mycoplasma genitalium) genome in yeast
It is artificial synthesized, composition length has reached 580kb [4].2010, Daniel G.Gibson et al. completed 1.08mb's again
Filamentous mycoplasma (Mycoplasma mycoides) genome it is artificial synthesized, and successfully the genome transplantation of synthesis is entered
Recipient cell simultaneously functions [5].
Saccharomyces cerevisiae (Saccharomyces cerevisiae) is a kind of unicellular fungi of Ascomycota, is and the mankind
One of most commonly used microorganism of relationship.Saccharomyces cerevisiae has important scientific research and application value as eukaryon model organism.It makes
Brewer yeast genome includes 16 chromosomes, and it is first completion that total length, which is about 12Mb, and genome sequencing is completed within 1996
The eucaryote of genome sequencing.2011, American scientist Jef D.Boeke proposed the full base of artificial synthesized saccharomyces cerevisiae
Because the Sc2.0 of group plans, i.e., using saccharomyces cerevisiae wild-type genomic sequence as source, by engineer, using chemical synthesis
Method, de novo formation whole S. cerevisiae chromosomal sequence.They have designed and synthesized IX chromosome right arm and No. VI dye
Colour solid left arm, for method test [6].2014, the laboratory Jef D.Boeke smoothly completed saccharomyces cerevisiae III dyeing
Artificial synthesized [7] of body.
Saccharomyces cerevisiae is the eucaryote of first man work synthesis genome.Saccharomyces cerevisiae genome it is artificial synthesized not only
It is of great significance in science, and will also be played an important role in production application.
Summary of the invention
The present invention provides the Wine brewing yeast strains of one plant of artificial synthesized II chromosome, are named as SynYII, the wine brewing
Yeast strain was preserved in China typical culture collection center (CCTCC, China, Wuhan, Wuhan University on September 19th, 2014
China typical culture collection center, 430072), deposit number is CCTCC NO:M 2014434, and classification naming is saccharomyces cerevisiae
SynYII(SaccharomycescerevisiaeSynYII)。
In one embodiment, the present invention describes the artificial synthesized and test method of S. cerevisiae chromosomal.
In one embodiment, the Wine brewing yeast strain induces SCRaMbLE plasmid by importing, such as
Induction variation occurs for pSCW11-CRE/EBD.
In one embodiment, SCRaMbLE occurs for the Wine brewing yeast strain induction.
In one embodiment, the Wine brewing yeast strain of artificial synthesized II chromosome of the invention may be used as preparing
Bacterial strain with different characteristics.For example, the bacterial strain can be recombinated by the site loxP with itself, it can also be with alien gene
It is recombinated.It can according to need design recombination, and then obtain a variety of bacterial strains with different characteristics, such as have and more simplify gene
The bacterial strain of group, pressure tolerance bacterial strain, metabolite superior strain etc. (description for being specifically shown in bacterial strain advantage).Artificial conjunction of the invention
At II chromosome Wine brewing yeast strain be used as preparation the bacterial strain with different characteristics purposes and these with different spies
The bacterial strain of property is within the scope of the present invention.
The optimization that the Wine brewing yeast strain of artificial synthesized II chromosome of the invention can be used for the metabolites such as alcohol is raw
It produces；Mutant library can be generated by induction SCRaMbLE, for screening the bacterial strain with various characteristics；It can be used as screening implement,
High flux screening is carried out to the metabolic pathway of addition.
Artificial synthesized saccharomyces cerevisiae of the invention has the advantage that
Firstly, artificial synthesized S. cerevisiae chromosomal sequence is by engineer and to simplify, synthesis bacterial strain is used for
Production will be physically easier to perform and control than wild-type strain, have bigger application potential.
Secondly, artificial synthesized Wine brewing yeast strain introduces derivable SCRaMbLE (synthetic
Chromosome rearrangement and modification by loxP-mediated evolution, loxP mediation
Synthesis chromosomal rearrangement) system (and the DNA sequence dna between the site loxP can occur under the action of Cre recombinase insertion, delete,
The variation such as reverse, repetition, transposition；Multiple sites loxP, inducing expression Cre recombination are inserted on artificial synthesized yeast chromosomal
After enzyme, the rearrangement of whole synthesis chromosome sequence will be caused, generate mass mutation body, this induction variation system is known as
SCRaMbLE system), it is one of the important feature of artificial synthesized Wine brewing yeast strain.Bacterial strain is synthesized by induction
SCRaMbLE, by controlling screening conditions, available a variety of bacterial strains with different characteristics, as having and more simplified genome
Bacterial strain, pressure tolerance bacterial strain (high temperature resistant, high sugar, high ethano concentration bacterial strain etc.), metabolite superior strain etc. has in production
There is huge application value.
Again, artificial synthesized Wine brewing yeast strain deletes terminator codon TAG, subsequent to introduce a kind of new amino
Acid, especially artificial synthesized amino acid all have important application in terms of the quality-improving and metabolite of yeast
Value.
Detailed description of the invention
Fig. 1 saccharomyces cerevisiae II chromosome design diagram.
The artificial synthesized II chromosome design drawing of Fig. 2A and 2B saccharomyces cerevisiae.
Fig. 3 chromosome synthesizes schematic diagram.
Fig. 4 chunkF plasmid, digestion result and homologous connector.
Fig. 5 chunkF replaces PCR the selection result.
Fig. 6 chunkF replaces PCR qualification result.
Fig. 7 SynYII bacterial strain PCR qualification result.
Fig. 8 synthesizes the growth curve of bacterial strain in different medium.
Fig. 9 synthesizes phenotype of the bacterial strain in different condition of culture.
The growth curve of Figure 10 SCRaMbLE bacterial strain.
The minichunk sequence used that Figure 11 present invention designs.
Specific embodiment
The present invention provides the Wine brewing yeast strains of one plant of artificial synthesized II chromosome, are named as SynYII.It synthesizes
Beginning bacterial strain is Wine brewing yeast strain BY4741 (MATa his3 Δ 1leu2 Δ 0LYS2met15 Δ 0ura3 Δ 0；ATCC
201388).Steps are as follows for the specific experiment of bacterial strain synthesis.
The design of 1 chromosome
The design of 1.1 chromosome sequences
The artificial synthesized S. cerevisiae chromosomal design principle of Sc2.0 project includes: 1. harmless, i.e., artificial synthesized saccharomycete
Strain does not at least have notable difference with wild type in phenotype；2. stable: i.e. artificial synthesized chromosome can be stable in the cell
In the presence of；3. can be changed: i.e. artificial synthesized chromosome increases the operability of heredity.Under above principle, pass through computer
Software has carried out following operation to wild type Saccharomyces cerevisiae genome: removing retrotransposon, subtelomeric structure and does not have
The introne of function；TRNA gene is removed, is uniformly put on same chromosome；It is inserted into the site LoxP；By terminator codon TAG
Replace with TAA；And some codon same sense mutations etc. (document that sees reference [6]).
The design of II chromosome of the invention follows design principle as defined in Sc2.0 project, and specific design includes: to remove
Telomere and subtelomeric, replace with engineer simplify telomere；Remove 22 intrones, 31 retrotransposons, 13
A tRNA gene；Insert 367 sites loxP (SEQ ID NO.1:ATAACTTCGTATAATGTACATTATACGAAGTT
AT)；90 TAG terminator codons are replaced with into TAA；And 532 groups of identification primers (synthesis and open country are devised by same sense mutation
Raw each 532 pairs of primer of identification).Design diagram is shown in Fig. 1.II chromosome design drawing is shown in Fig. 2.
1.2 chromosome cuttings design
The saccharomyces cerevisiae II chromosome total length of engineer is about 770kb, and cutting is the segment of 25 30kb or so,
Each segment is known as a megachunk, is respectively designated as megachunkA-megachunkY；Each megachunk cutting again
For the segment of 3-5 10kb or so, referred to as chunk, designed between chunk homologous connector (800-1200bp) for synthesize dyeing
The replacement of body；Each chunk segment that cutting is 2-7 2kb or so again, referred to as minichunk.Used in the present invention
The sequence of minichunk is shown in Figure 11.
2 artificial synthesized dyeing body methods
The step of artificial synthesized yeast chromosomal are as follows: the double chain DNA fragment and sequence verification of synthesis 2kb or so first are protected
It is identical as implementation sequence 100% to demonstrate,prove DNA sequence dna；Then by the DNA fragmentation of 2kb or so be spliced into 10kb or so DNA fragmentation (see
Fig. 3 A)；The DNA fragmentation of 3-5 10kb or so is used together Li-acetate method transformed saccharomyces cerevisiae with homologous connector again, is passed through
The mode of homologous recombination is integrated into wild-type yeast body (see Fig. 3 B).Each end megachunk is lacked with a nutrition
Swaged selection markers, and the selection markers of a megachunk are override, it replaces paragraph by paragraph, two selection markers are screened in turn,
Until replacing all wild type chromosomal all DNA sequences (see Fig. 3 C).After the completion of each megachunk replacement, using more
PCR identification is carried out to designed synthesis and wild type identification primer, wild is drawn when all synthetic primers have a target stripe
Object without band when (only synthesis chromosome sequence, without wild chromosome sequence), that is, think that synthesis is correct.
Embodiment
Experimental implementation mentioned in embodiment is unless otherwise specified routine experiment method；Mentioned reagent consumption
Material is unless otherwise specified conventional reagent consumptive material.
Embodiment one: chromosome synthesis
The synthesis of 1DNA segment
1.12kb segment synthesizes
2kb DNA fragmentation by Beijing six directions Hua Da Gene Tech. Company Limited, Invitrogen (Shanghai) Trading Co., Ltd.,
The synthesis of Jin Sirui Biotechnology Co., Ltd.
1.210kb segment synthesizes
2kb DNA fragmentation is spliced into 10kb DNA fragmentation using the method for Gibson assembling, specific synthetic method referring to
Patent application: Gibson assembles carrier and its preparation method and application (201310085313.7).
2 synthesis chromosome replacements
Illustrate to synthesize chromosome replacement process by taking megachunkF as an example.MegachunkF length is about 31kb, is divided into 4
Chunk, respectively chunkF1, chunkF2, chunkF3, chunkF4；Selection markers are Ura, synthesis and wild identification primer
Each 23 pairs.
2.1DNA preparation
10kb DNA fragmentation plasmid is extracted using kit (the small extraction reagent kit of plasmid, Tiangeng), uses Nanodrop
(Nanodrop 2000, Thermo) measures DNA concentration, electrophoresis detection (see Fig. 4 A).With the corresponding restriction enzyme of design
(NEB) 10kb segment, electrophoresis detection are cut from plasmid (see Fig. 4 B, arrow meaning is target fragment band).Digestion system point
Not are as follows: chunkF1 (1.5 2 0.2 4 μ g of μ L, DNA of μ L, BSA of μ L, NEBuffer4 of SfiI, moisturizing to 20 μ L)；chunkF2
(0.75 0.75 2 0.2 4 μ g of μ L, DNA of μ L, BSA of μ L, NEBuffer4 of μ L, EcoO109I of SfiI, moisturizing to 20 μ L)；
ChunkF3 (0.75 0.75 2 0.2 4 μ g of μ L, DNA of μ L, BSA of μ L, NEBuffer4 of μ L, RsrII of EcoO109I, moisturizing to 20
μL)；ChunkF4 (RsrII 0.5 μ L, BaeI 1 μ L, NEBuffer4 2 μ L, BSA 0.2 μ L, 1/10SAM 0.25 μ L, DNA
4 μ g, moisturizing to 20 μ L).ChunkF1-chunkF3 distinguishes 37 DEG C of digestions 3h, chunkF4,25 DEG C of digestion 5h.
Glue purification digestion products target stripe is cut using kit (AxyPrep DNA gel QIAquick Gel Extraction Kit, healthy and free from worry),
Nanodrop measures DNA concentration.4 10kb segments take the DNA of equimolar amounts with DNA ligase (T4 DNA ligase,
TAKARA it) connects.Linked system are as follows: 0.5 μ L, 10 × T4 DNA ligase buffer of T4 DNA ligase, 1 μ L, 4 10kb pieces
Each 50ng of section, adds water to supply 10 μ L.16 DEG C of connections are overnight.
2.2 homologous connector preparations
10kb DNA fragmentation connection product is diluted with water 10 times, is used as connector PCR template.PCR system are as follows: Phusion
4 1.6 μ L of μ L, dNTPs of archaeal dna polymerase (Phusion DNA Polymerase, NEB) 0.2 μ L, 5 × HF buffer,
MgCl20.6 μ L, template DNA 1 μ L, forward primer Pf 1 μ L, reverse primer Pr 1 μ L, 10.6 μ L of sterile water.PCR program are as follows:
98℃30sec；98 DEG C of 10sec, 55 DEG C of 30sec, 72 DEG C of 1min, 35 circulations；72℃ 5min；12 DEG C of holdings.Electrophoresis inspection
It surveys PCR product (see Fig. 4 C).Use kit (AxyPrep PCR cleaning agents box, healthy and free from worry) purified pcr product, Nanodrop
Measure DNA concentration.
The screening of 2.3 yeast conversions
Transformed cells preparation: choosing chunkE and synthesize successful Wine brewing yeast strain monoclonal, is seeded to the training of 3mL YPD liquid
It supports in base, 30 DEG C of 200rpm shake training overnight.1mL bacterium solution is taken to be connected in 40mL YPD fluid nutrient medium, 30 DEG C of 200rpm shake training
It is centrifuged 5min to OD600=0.6-1.0,3000rpm and collects thallus, use 40mL sterile water and 20mL 0.1mol/L acetic acid respectively
Lithium washing precipitating is each primary, is resuspended and is precipitated with 1mL 0.1mol/L lithium acetate.
Yeast conversion: above-mentioned 100 μ L of bacterium solution is taken, is sequentially added into each 300ng of 10kb DNA fragmentation respectively, homologous connector is each
200ng is denaturalized ssDNA (Deoxyribonucleic acid from herring sperm, Sigma) 25 μ L, 1mol/L vinegar
41 312 μ L of μ L, 50%PEG3350 of sour lithium, is vortexed and mixes, and 30oC stands 30min；Add 50 μ L DMSO, is vortexed and mixes, 42 DEG C quiet
Set 15min；3000rpm is centrifuged 1.5min, abandons supernatant, adds 1mL 5mm CaCl2, it mixing, 3000rpm is centrifuged 1min, supernatant is abandoned,
Add 100 μ L 5mm CaCl2Precipitating is resuspended, appropriate conversion fluid is taken to apply SC-Ura culture medium flat plate, 30 DEG C of culture 3d.
Transformant screening: plate will be converted above and distinguishes photocopy to SC-Leu and SC-Ura culture medium flat plate, 30 DEG C of cultures
1d；Choose Ura+Leu-(growing on SC-Ura culture medium, do not grow on SC-Leu culture medium) clone, is coated on SC-Ura
Plate 1cm2In range, 30 DEG C of culture 1d；Spread plate is distinguished to photocopy again to SC-Leu and SC-Ura culture medium flat plate, 30 DEG C
Cultivate 1d.
2.4PCR screening and identification
The preparation of PCR template: Ura is selected on the SC-Ura culture medium flat plate of previous step photocopy+Leu-Clone, scrapes appropriate bacterium
Body is vortexed and mixes into 500 μ L water, and 12000rpm is centrifuged 1min, abandons supernatant；Add 100 μ L resuspension thallus of lysate, acid adding is washed
200 μ L of bead (0.5mm) 0.2g, PCI, vortex instrument are adjusted to maximum (top) speed oscillation 3min；100 μ L water are added, are mixed,
12000rpm is centrifuged 10min, takes 150 μ L supernatant liquids as PCR template.
PCR screening: respectively take 1 group of identification primer (synthesis and each 1 pair of wild identification primer) to turning respectively from 4 chunk
Beggar carries out PCR screening.PCR system are as follows: 0.1 μ L, 10 × PCR buffer of rTaq (TAKARA), 1.25 1 μ L of μ L, dNTPs, mould
1 μ L, forward and reverse mix primer 1 μ L, ddH of version2O 8.15μL.PCR program are as follows: 94 DEG C of 5min；94 DEG C of 30sec, 55 DEG C
30sec, 72 DEG C of 30sec, 30 circulations；72℃ 5min；12 DEG C of holdings.Electrophoresis detection: PCR product adds 1.5 μ 10 × loadings of L
Buffer mixes, takes 3 μ L point samples；3 μ L DL2000DNA Marker (TAKARA) of point, 2% Ago-Gel, electrophoretic voltage
120V, electrophoresis time 40min, EB dye 10min, and gel imager is taken a picture (see Fig. 5；Successively 2 adjacent swimming lanes draw for 1 group
Object, respectively synthesis and wild primer；Meeting synthetic primer simultaneously has target stripe, wild primer then thinking synthesis just without band
Really；It is the correct clone of PCR screening shown in frame).
PCR identification: PCR screening correctly clone's (taking #2 and No. #5 clone) is selected from upper step, takes chunkF all 23
Group primer carries out PCR identification.PCR system, program, electrophoretic detection are same as above that (qualification result is shown in Fig. 6；Each 23 groups of 2 bacterial strains
Primer qualification result is that synthetic primer has target stripe, and wild primer is without band, so being the correct clone of synthesis).
Artificial synthesized II chromosome Wine brewing yeast strain SynYII whole primer PCR qualification result is shown in Fig. 7.
Artificial synthesized II chromosome Wine brewing yeast strain SynYII was preserved in Chinese Typical Representative culture on September 19th, 2014
Object collection (CCTCC, Wuhan City, Hubei Province Hongshan District Bayi Road Wuhan University China typical culture collection center), preservation
Number be CCTCC NO:M 2014434.
Embodiment two: synthesis strain culturing test
The measurement of 1 growth curve
Wild-type strain BY4741 is measured in YPD culture medium and SC culture medium respectively and synthesizes the growth of bacterial strain SynYII
Curve compares the difference of synthesis bacterial strain SynYII and wild-type strain BY4741.
The preparation of 1.1 bacterium solutions
Saccharomyces cerevisiae wild-type strain BY4741 and synthesis bacterial strain SynYII pick them separately monoclonal, are seeded to 3mL YPD
Or in SC fluid nutrient medium, 30 DEG C of 200rpm shake training overnight.
The measurement of 1.2 growth curves
Using the OD600 value of visible spectrophotometer measurement bacterium solution, 300 μ L YPD or SC liquid are added in honeycomb plate hole
Body culture medium is inoculated with YPD or SC fluid nutrient medium respectively and shakes BY4741 the and SynYII bacterial strain bacterium solution of training to OD600=0.1, often
3 repetitions of a bacterial strain.Using Biosceen C MBR sigmoid growth curve analysis-e/or determining is wild and synthetic yeast bacterial strain in YPD or
Growth curve in SC fluid nutrient medium.Growth curve analyzer parameter are as follows: 30 DEG C, moderate rotation, oscillating medium intensity, detection
Wavelength 600nm, detection in 30 minutes are primary.Growth curve is shown in that (Fig. 8 A is life of the BY4741 and SynYII in YPD culture medium to Fig. 8
Long curve, Fig. 8 B are growth curve of the BY4741 and SynYII in SC culture medium).
It can be seen that artificial synthesized yeast strain SynYII in YPD and SC culture medium from growth curve measurement result
Growing state and the equal no significant difference of wild-type strain BY4741, meet design requirement.
The experiment of 2 phenotypes
Respectively at YPD solid medium (pH7), SC is solid by saccharomyces cerevisiae wild-type strain BY4741 and synthesis bacterial strain SynYII
Body culture medium, the YPD solid medium of different pH value (pH 4.0 or pH 9.0), YPD dosing product (methyl methylsulfonate (MMS),
Benomyl (Benomyl), various concentration sorbierite (Sorbitol)) solid medium, SC dosing product 6- azauracil (6-AU)
Contact plate on solid medium and YPEG solid medium compares the phenotypic difference of synthesis bacterial strain and wild-type strain.
The preparation of 2.1 bacterium solutions
Saccharomyces cerevisiae wild-type strain BY4741 and synthesis bacterial strain SynYII pick them separately monoclonal, are seeded to 3mL YPD
In culture medium, 30 DEG C of 200rpm shake training overnight.
2.2 contact plate
500 μ L bacterium solutions are taken, thalline were collected by centrifugation by 12000rpm, with 500 μ L ddH2Thallus is resuspended in O, then uses ddH2O successively 10
Bacterial concentration is diluted again to 100, 10-1, 10-2, 10-3, 10-4, 5 μ L bacterium solutions contact plate on YPD culture medium flat plate is taken respectively；Take 7 μ L
Bacterium solution contact plate on SC culture medium.
2.3 condition of culture
YPD or SC culture medium: each 25 DEG C, 30 DEG C, 37 DEG C of culture 2d respectively；PH4.0, pH9.0 culture medium: each 30 DEG C of cultures
2d；Methyl methylsulfonate culture medium: 30 DEG C of culture 2d；Benomyl culture medium: 30 DEG C of culture 2d；Sorbierite culture medium: 30 DEG C of trainings
Support 3d；6- azauracil culture medium: 30 DEG C of culture 2d；YPEG solid medium: 30 DEG C of culture 4d.Experimental result is shown in Fig. 9 for phenotype.
It can be seen that artificial synthesized yeast strain SynYII on a variety of culture mediums and different cultures from phenotype test result
Under the conditions of growing state and the equal no significant difference of wild-type strain BY4741, meet design requirement.
Embodiment three: induction SCRaMbLE test
1 inducible vectors import
SCRaMbLE plasmid pSCW11-CRE/EBD will be induced (suddenly by U.S. John using Li-acetate method (see embodiment one)
Pu Jinsi university Jef professor D.Boeke provides) it imports in synthetic yeast bacterial strain SynYII, apply the screening of SC-His culture medium flat plate
Transformant.
2 induction SCRaMbLE
Monoclonal (being named as SynYII+HIS) is chosen on SC-His culture medium flat plate, is seeded to the training of 3mL SC-His liquid
It supports in base, 30 DEG C of 200rpm shake training overnight, and thalline were collected by centrifugation by 12000rpm；It is hanged again with 3mL SC-His fluid nutrient medium
Floating thallus adds estradiol (β-Estradiol) extremely final concentration of 1 μm of ol/L, 37 DEG C of 200rpm to induce SCRaMbLE for 24 hours,
Thalline were collected by centrifugation by 12000rpm；With sterile water again suspension thalline, SC-His culture medium flat plate is applied after gradient dilution respectively, 30
DEG C culture 3d select monoclonal.
The test of 3SCRaMbLE bacterial strain
6 monoclonals (being respectively designated as Scb-1~6) are chosen from SC-His culture medium flat plate, are respectively seeded to 3mL respectively
In SC-His fluid nutrient medium, 30 DEG C of 200rpm shake training overnight, and growth curve (growth curve measurement side is surveyed under the conditions of 37 DEG C
Method is shown in embodiment two).SCRaMbLE bacterial strain is shown in Figure 10 in 37 DEG C of growth curve measurement result.
From growth curve measurement result can be seen that artificial synthesized Wine brewing yeast strain induction occur SCRaMbLE with
Afterwards, there is diversity abundant in the growing state of the mutant obtained；By screening, available some targets resistant to high temperature
Bacterial strain, such as bacterial strain Scb-1, the higher bacterial strain Scb-2 of stationary phase OD value that the doubling time is shorter.So carry out more wheel inductions and
Screening, can be obtained the stronger bacterial strain of high temperature tolerance ability.
Annex:
Lysate: NaCl 0.1mol/L, Tris-HCl (pH 8.0) 10mmol/L, EDTA (pH 8.0) 1mmol/L,
Triton x-100 2%, SDS 1%.
PCI:Tris- saturated phenol 250mL, chloroform 240mL, isoamyl alcohol 10mL.
YPD culture medium: yeast powder 10g/L, peptone 20g/L, glucose 20g/L；Solid medium adds 2% agar powder.
SC culture medium: -5 amino acid mixed-powder 2g/L, yeast basic nitrogen source (being free of amino acid, ammonium sulfate) 1.7g/L,
Ammonium sulfate 5g/L, glucose 20g/L, 100 × Ura10mL/L, 50 × Leu20mL/L, 100 × Met10mL/L, 100 ×
Lys10mL/L, 333 × His 3mL/L；Solid medium adds 3% agar powder.
SC-Ura culture medium: -5 amino acid mixed-powder 2g/L, yeast basic nitrogen source (are free of amino acid, ammonium sulfate)
1.7g/L, ammonium sulfate 5g/L, glucose 20g/L, 50 × Leu20mL/L, 100 × Met10mL/L, 100 × Lys10mL/L, 333
× His 3mL/L, agar powder 3%.
SC-Leu culture medium: -5 amino acid mixed-powder 2g/L, yeast basic nitrogen source (are free of amino acid, ammonium sulfate)
1.7g/L, ammonium sulfate 5g/L, glucose 20g/L, 100 × Ura10mL/L, 100 × Met10mL/L, 100 × Lys10mL/L,
333 × His3mL/L, agar powder 3%.
- 5 amino acid mixed-powders: adenine 1.5g, alanine 6g, arginine 6g, aspartic acid 6g, asparagine 6g,
Cysteine 6g, glutamic acid 6g, glutamine 6g, glycine 6g, isoleucine 6g, phenylalanine 6g, proline 6g, serine
6g, threonine 6g, tryptophan 6g, tyrosine 6g, valine 6g.
100 × Ura: uracil 2.24g/L.
50 × Leu: leucine 13g/L.
100 × Met: methionine 7.5g/L.
100 × Lys: lysine 18.3g/L.
333 × His: histidine 21g/L.
PH4.0, pH9.0 culture medium: YPD solid medium adds HCl and NaOH tune pH value to 4.0 or 9.0 respectively.
Methyl methylsulfonate (MMS) culture medium: YPD solid medium methylate methylmesylate 0.05%.
Benomyl culture medium: YPD solid medium adds 15 μ g/mL of benomyl.
Sorbierite culture medium: YPD solid medium adds sorbierite to distinguish 0.5mol/L, 1.0mol/L, 1.5mol/L,
2.0mol/L。
6- azauracil culture medium: SC solid medium adds 100 μ g/mL of 6- azauracil.
YPEG culture medium: yeast powder 10g/L, peptone 20g/L, glycerol 2%, ethyl alcohol 2%, agar powder 2%.
Bibliography:
[1]Jeronimo Cello,Aniko V.Paul,EckardWimmer.Chemical synthesis of
poliovirus cDNA:generation of infectious virus in the absence of natural
template.Science.2002,297:1016-1018.
[2]Hamilton O.Smith,Clyde A.Hutchison III,Cynthia Pfannkoch,and
J.Craig Venter.Generating a synthetic genome by whole genome assembly:
bacteriophage from synthetic oligonucleotides.PNAS.2003,100:15440-15445.
[3]Terrence M.Tumpey,Christopher F.Basler,Patricia V.Aguilar,et
al.Characterization of the reconstructed 1918spanish influenza pandemic
virus.Science.2005,310:77-80.
[4]Daniel G.Gibson,Gwynedd A.Benders,Cynthia Andrews-Pfannkoch,et
al.Complete Chemical Synthesis,Assembly,and Cloning of a Mycoplasma
genitalium Genome.Science.2008,319:1215-1220.
[5]Daniel G.Gibson,John I.Glass,Carole Lartigue,et al.Creation of a
bacterial cell controlled by a chemically synthesized genome.Science.2010,
329:52-56.
[6]Jessica S.Dymond,Sarah M.Richardson,Candice E.Coombes,Timothy
Babatz,Heloise Muller,et al.Synthetic chromosome arms function in yeast and
generate phenotypic diversity by design.Nature.2011,477:471–476.
[7]NarayanaAnnaluru,Heloise Muller,Leslie A.Mitchell,
SivaprakashRamalingam,Giovanni Stracquadanio,et al.Total Synthesis of a
Functional Designer Eukaryotic Chromosome.Science.2014,344:55-58。
Claims (7)
1. the Wine brewing yeast strain of one plant of artificial synthesized II chromosome, the Wine brewing yeast strain is in the preservation on the 19th of September in 2014
In China typical culture collection center, deposit number is CCTCC NO:M 2014434.
2. the Wine brewing yeast strain of claim 1 is used as purposes below: generating mutant library by induction SCRaMbLE, be used for
Screen the bacterial strain with different characteristics.
3. the purposes of claim 2, wherein being used as the bacterial strain that preparation has different characteristics are as follows: the Wine brewing yeast strain passes through
The site loxP is recombinated itself, or is recombinated with alien gene.
4. the purposes of claim 3, the sequence in the site loxP is SEQ ID NO.1.
5. the bacterial strain with different characteristics that the purposes of any one of claim 2-4 obtains.
6. the bacterial strain of claim 5, the bacterial strain is with the bacterial strain or bacterial strain resistant to high temperature for more simplifying genome.
7. the following purposes of the Wine brewing yeast strain of claim 1: the optimization for metabolite produces；As screening implement,
High flux screening is carried out to the metabolic pathway of addition.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510008356.4A CN105820965B (en) | 2015-01-08 | 2015-01-08 | The Wine brewing yeast strain of one plant of artificial synthesized II chromosome |
| HK16112207.6A HK1223973A1 (en) | 2015-01-08 | 2016-10-25 | Saccharomyces cerevisiae strain with synthetic chromosome ii ii |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510008356.4A CN105820965B (en) | 2015-01-08 | 2015-01-08 | The Wine brewing yeast strain of one plant of artificial synthesized II chromosome |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105820965A CN105820965A (en) | 2016-08-03 |
| CN105820965B true CN105820965B (en) | 2019-08-13 |
Family
ID=56514888
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510008356.4A Active CN105820965B (en) | 2015-01-08 | 2015-01-08 | The Wine brewing yeast strain of one plant of artificial synthesized II chromosome |
Country Status (2)
| Country | Link |
|---|---|
| CN (1) | CN105820965B (en) |
| HK (1) | HK1223973A1 (en) |
Families Citing this family (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107641606A (en) * | 2017-08-31 | 2018-01-30 | 天津大学 | A kind of method that DNA long fragment is reset in vitro |
| CN107574128B (en) * | 2017-08-31 | 2020-10-30 | 天津大学 | Method for rapidly optimizing metabolic pathway of strain in vitro |
| CN108342408B (en) * | 2018-02-14 | 2020-07-14 | 天津大学 | Gene element for accurately controlling gene rearrangement, recombinant plasmid and application thereof |
| CN109266787B (en) * | 2018-11-29 | 2022-02-11 | 成都海关技术中心 | Nucleic acid combination and kit for detecting type 5 bovine adenovirus, application and detection method |
| CN114592000B (en) * | 2020-12-03 | 2023-07-21 | 上海市农业科学院 | Application of six-gene combination in improving VB2 content in rice seeds and method |
| CN113046255B (en) * | 2021-03-09 | 2023-08-01 | 天津大学 | Large-scale gene rearranged saccharomycete and construction method thereof |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2001046453A1 (en) * | 1999-12-22 | 2001-06-28 | Novo Nordisk A/S | Method for extractive refolding of scrambled single-chain polypeptides |
| WO2005021714A2 (en) * | 2003-08-11 | 2005-03-10 | Diversa Corporation | Laccases, nucleic acids encoding them and methods for making and using them |
| AU2006220772A1 (en) * | 2005-03-04 | 2006-09-14 | Verenium Corporation | Nucleic acids and proteins and methods for making and using them |
| WO2006118550A2 (en) * | 2005-05-05 | 2006-11-09 | Kemijski Institut | Highly productive recombinant yeast strains with modified galactose-regulated transcription |
| CN102186983A (en) * | 2008-09-29 | 2011-09-14 | 布特马斯先进生物燃料有限责任公司 | Increased heterologous Fe-S enzyme actiivty in yeast |
-
2015
- 2015-01-08 CN CN201510008356.4A patent/CN105820965B/en active Active
-
2016
- 2016-10-25 HK HK16112207.6A patent/HK1223973A1/en unknown
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2001046453A1 (en) * | 1999-12-22 | 2001-06-28 | Novo Nordisk A/S | Method for extractive refolding of scrambled single-chain polypeptides |
| WO2005021714A2 (en) * | 2003-08-11 | 2005-03-10 | Diversa Corporation | Laccases, nucleic acids encoding them and methods for making and using them |
| AU2006220772A1 (en) * | 2005-03-04 | 2006-09-14 | Verenium Corporation | Nucleic acids and proteins and methods for making and using them |
| WO2006096527A3 (en) * | 2005-03-04 | 2007-11-22 | Diversa Corp | Nucleic acids and proteins and methods for making and using them |
| WO2006118550A2 (en) * | 2005-05-05 | 2006-11-09 | Kemijski Institut | Highly productive recombinant yeast strains with modified galactose-regulated transcription |
| CN102186983A (en) * | 2008-09-29 | 2011-09-14 | 布特马斯先进生物燃料有限责任公司 | Increased heterologous Fe-S enzyme actiivty in yeast |
Non-Patent Citations (5)
| Title |
|---|
| "Synthetic chromosome arms function in yeast and generate;Jessica S. Dymond 等;《Nature》;20130916;第477卷(第7365期);摘要，第2页第4段 * |
| "Synthetic construct chromosome SynIII, complete sequence";Annaluru,N. 等;《GenBank Database》;20140410;GenBank Accession No. KC880027.1 * |
| "Total Synthesis of a Functional Designer Eukaryotic Chromosome";Annaluru 等;《Science》;20140404;第344卷(第6179期);摘要，第1页第1段，第2页第2段，第4页第3段 * |
| Annaluru 等."Total Synthesis of a Functional Designer Eukaryotic Chromosome".《Science》.2014,第344卷(第6179期),摘要，第1页第1段，第2页第2段，第4页第3段. * |
| DNA合成技术及应用;王霞 等;《生命科学》;20131015;第25卷(第10期);第993-999页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| HK1223973A1 (en) | 2017-08-11 |
| CN105820965A (en) | 2016-08-03 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105820965B (en) | The Wine brewing yeast strain of one plant of artificial synthesized II chromosome | |
| CN113699135B (en) | Adenine base editor fusion protein without PAM limitation and application thereof | |
| CN108434450A (en) | Vaccine and preparation method thereof based on ferritin nano particle | |
| CN105695485A (en) | Cas9 encoding gene used for mycelial fungus Crispr-Cas system, and application thereof | |
| CN109136248A (en) | Multiple target point editor carrier and its construction method and application | |
| CN109825532A (en) | Application of the CRISPR/Cas12a gene editing system in small liwan moss gene editing | |
| CN104725517A (en) | Method for enhancing target protein display quantity on yeast cell surface | |
| CN104619852A (en) | L-lysine generation method by fermenting bacteria having modified aconitase gene and/or regulatory element | |
| CN113652440A (en) | 3-ketoacyl-coenzyme A thiolase gene RKACAA1-2 and application thereof | |
| CN102839157A (en) | MDCK cell system capable of stably coexpressing Hst3GIIV and beta1-4GalT1 and establishing method and application thereof | |
| DE112010006063B4 (en) | Generation of antigens, virus-like particles via protein-protein bonds | |
| CN104673760B (en) | A kind of purification process of procaryotic cell expression viruslike particle | |
| Song et al. | Phylogenic diversity and taxonomic problems of the Dictyosphaerium morphotype within the Parachlorella clade (Chlorellaceae, Trebouxiophyceae) | |
| CN109439636A (en) | A kind of D. radiodurans dnmt rna | |
| CN102850444B (en) | A pair of transcription activator like effector nucleases of L3 and R1 and a coding gene and an application thereof | |
| Aguirre Sourrouille et al. | The viral susceptibility of the Haloferax species | |
| CN104212787A (en) | Panax japonicas beta-amyrin synthase gene and application thereof | |
| CN103540587B (en) | Targeted integration exogenous DNA array is to the method in rat and mouse Rosa26 site and application thereof | |
| CN102702331B (en) | Pair of transcription activator-like effector nucleases (TALEN), encoding gene and application thereof | |
| Kang et al. | Enhancing maize transformation and targeted mutagenesis through the assistance of non-integrating Wus2 Vector | |
| Hesp et al. | CRISPR/Cas12a-mediated gene editing in Geodia barretti sponge cell culture | |
| Soppa et al. | The TATA‐Box‐Binding Protein (TBP) of Halobacterium Salinarum: Cloning of the tbp Gene, Heterologous Production of TBP and Folding of TBP into a Native Conformation | |
| CN103642831A (en) | Method for constructing marine coccolithophorid eukaryotic expression vector | |
| Hilzinger et al. | Acetaminophen production in the edible, filamentous cyanobacterium Arthrospira platensis | |
| CN103396975A (en) | Vector pSVK based hepatitis B therapeutic plasmid DNA vaccine fermentation production method, and special engineering bacterium and high-yield fermentation culture medium therefor |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| REG | Reference to a national code |
Ref country code: HK Ref legal event code: DE Ref document number: 1223973 Country of ref document: HK |
|
| GR01 | Patent grant | ||
| GR01 | Patent grant |