CN105820239B - Bufo melanostictus serpin and its gene and application - Google Patents

Bufo melanostictus serpin and its gene and application Download PDF

Info

Publication number
CN105820239B
CN105820239B CN201610323050.2A CN201610323050A CN105820239B CN 105820239 B CN105820239 B CN 105820239B CN 201610323050 A CN201610323050 A CN 201610323050A CN 105820239 B CN105820239 B CN 105820239B
Authority
CN
China
Prior art keywords
primer
serpin
bufo melanostictus
bufo
melanostictus
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Fee Related
Application number
CN201610323050.2A
Other languages
Chinese (zh)
Other versions
CN105820239A (en
Inventor
宋玉竹
卢文成
刘锐
张阿梅
韩芹芹
刘娃
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Kunming University of Science and Technology
Original Assignee
Kunming University of Science and Technology
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Kunming University of Science and Technology filed Critical Kunming University of Science and Technology
Priority to CN201610323050.2A priority Critical patent/CN105820239B/en
Publication of CN105820239A publication Critical patent/CN105820239A/en
Application granted granted Critical
Publication of CN105820239B publication Critical patent/CN105820239B/en
Expired - Fee Related legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/81—Protease inhibitors
    • C07K14/8107—Endopeptidase (E.C. 3.4.21-99) inhibitors
    • C07K14/811—Serine protease (E.C. 3.4.21) inhibitors
    • C07K14/8121—Serpins
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/102—Mutagenizing nucleic acids
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Molecular Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biophysics (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Biomedical Technology (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Microbiology (AREA)
  • Medicinal Chemistry (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses a kind of Bufo melanostictus serpin and its genes, the amino acid sequence of the Bufo melanostictus serpin is as shown in SEQ ID NO:2, the gene nucleotide series of Bufo melanostictus serpin are encoded as shown in SEQ ID NO:1, the present invention has very strong trypsin inhibition activity by the Bufo melanostictus serpin that prokaryotic expression means obtain, and also has the characteristics that produced in vitro is convenient, inhibits tryptic activity powerful, can be used as trypsin inhibitor and applied.

Description

Bufo melanostictus serpin and its gene and application
Technical field
The present invention relates to Bufo melanostictus research field, in particular to a kind of Bufo melanostictus serpin and its Gene and application.
Background technique
Bufo melanostictus, Anura, Bufonidae, Bufo are one of the main sources of traditional Chinese medicine " dry toad ", generally in Summer, two season of autumn capture；It is acrid flavour, cool, it is toxic, return liver, spleen, lung channel, have effects that subdhing swelling and detoxicating, analgesic, diuresis, is usually used in slow Property the diseases treatment such as tracheitis, carbuncle boils boils, abscess of throat, oedema and difficult urination；It is civil also to have for cancer (especially mammary gland Cancer) etc. proved recipe, but it is less about the Study on Molecular Mechanism of its effect at present.
Serine protease (serine protease) is one kind using serine as the proteolytic enzyme in activated centre, Belong to proteolytic enzyme, is present in the various biologies of nature.Serine protease has a unique reactivity Serine residue, by the activation or inhibition to proproteinase to play the work of regulatory factor in biological organic body With, and during the biochemical reactions such as tissue reconstruction, cell differentiation, embryonic development, poisoning intrusion and angiogenesis It plays an important role.Serpin (serpin) is a kind of with inhibition serine protease hydrolysing activity Substance is widely present in the various organisms of nature.Serine protease is as biological homoiostasis Important regulatory factor plays an important role in many important physiological and biochemical activities in vivo, such as cellular matrix Building, protein folding, complement activation, blood clotting, cell differentiation, cell migration, immune and inflammatory reaction and tumor suppression etc.. There is not been reported for Bufo melanostictus serpin at present.
By Bufo melanostictus serpin overall amino acid sequence of the invention and its encoding gene respectively to egg White matter database and gene database have carried out comparing search, find no any identical sequence information.
Summary of the invention
To solve the above-mentioned problems of the prior art, the purpose of the present invention is to provide a kind of Bufo melanostictus serine eggs White enzyme inhibitor and its gene and application.
In order to achieve the above objectives, the technical solution of the present invention is as follows:
A kind of Bufo melanostictus serpin, the amino acid sequence of the Bufo melanostictus serpin Column are a kind of single chain polypeptide, molecular weight 11604.5Da dalton, isoelectric point 7.33 as shown in SEQ ID NO:2.
Another object of the present invention is to provide a kind of gene for encoding the Bufo melanostictus serpin, core Nucleotide sequence is as shown in SEQ ID NO:1.
The cloning process of Bufo melanostictus serpin gene is as follows:
Bufo melanostictus skin Total RNAs extraction, reverse transcription construction cDNA library, using Bufo melanostictus cDNA as template, according to guarantor Structural domain design degenerate primer is kept, nested PCR amplification serpin partial sequence, 5 ' PCR of primer are passed through The primer PCR primer primer of F2 and 3 ' of F1 and 5 ' R1.According to the partial sequence design primer (3 ' primer measured The primer of R2 and 3 ' R3), nest-type PRC is carried out again with 5 ' PCR primer II A with library is built, and correlated response condition is the same, most Bufo melanostictus serpin overall length ORF is obtained eventually.
1, primer:
5’PCR primer F1:5’-TGYGGNWSNGCNTGYCCN-3’
5’PCR primer F2:5’-CCNTGYGTNGARGGNTGYGTNTGY-3’
5’PCR primer II A:5’-AAGCAGTGGTATCAACGCAGAGT-3’
3’primer R1:5’-ATTGACTCGAGTCGACATCGA-3’
3’primer R2:5’-ATGGACATTCTTCCTTTGGGA-3’
3’primer R3:5’-AGGACCTATAACATATCC-3’
2, by 0.5 μ l rTaq, 10 μ l PCR buffers, 8 μ l dNTP mixtures (each 2.5 μM), 6 μ l MgCl2、2μl RNA, it 5 ' PCR primer F1 of primer, 5 ' the PCR primer primer of F2 and 3 ' R1: each 2 μ l, 65.5 μ l deionized waters, puts Enter in centrifuge tube and is reacted.
3, it is expanded in PCR instrument by following procedure:
1. 95 DEG C 5 minutes
2. 30 circulations:
95 DEG C 30 seconds
55 DEG C 30 seconds；
72 DEG C 30 seconds；
3. 72 DEG C extend 5 minutes.
4. continuing PCR by template of reaction product, reaction system and PCR reaction condition are same as above.
According to the serpin partial sequence design primer amplified above
Its sequence are as follows: 5 '-ATGCATCCTTGTTCTGGTTGTG-3 ',
Reversed amplimer sequence is 5 '-CTATTTCACCTTTGGACATTCCT-3 '；
Obtained positive monoclonal carries out gene nucleotide series measurement, and gene sequencing is the result shows that coding Bufo melanostictus silk ammonia The gene of pepsin inhibitor is made of 333 nucleotide, sequence as shown in SEQ ID NO:1,
Bufo melanostictus maturation serpin is made of 110 amino acid residues, and amino acid sequence is such as Shown in SEQ ID NO:2.
Prokaryotic expression, the purification process of Bufo melanostictus serpin are as follows:
Prokaryotic expression:
1. by the positive colony pET32a-Hyl strain inoculated selected into the LB liquid medium containing Amp resistance, 37 DEG C, 180rpm overnight incubation.
2. the bacterium solution after culture is transferred to 100ml by 1% inoculum concentration to contain in the LB culture medium of Amp resistance, 37 DEG C, 180rpm cultivates about 4h and takes out 10ml's until OD600 is between 0.4-0.6
Bacterium solution, which is put into sterile test tube, to be continued to cultivate, and is used as not inducing control.Final concentration is added in remaining bacterium solution For the isopropyl-β-D-thiogalactose (Isopropyl β-D-1-Thiogalactopyranoside of 0.4mM；IPTG), 30 DEG C, 160rpm carries out inducing expression.
3. continuing to cultivate 4-5h, the bacterium solution after taking out 10ml induction, 12000rpm is centrifuged 5min, discards supernatant liquid and collects bacterium Body precipitating.
4. determining that recombinant protein is present in host bacterial with soluble status or with inclusion body state.Specific inspection Survey method are as follows: the bacterial sediment of induction front and back is resuspended in the 20mM phosphate buffer (pH=7.4) of 15ml, is used Ultrasonic disruption instrument carries out clasmatosis to it, and power 200W, super 6s stop 4s, net cycle time 15min, in ice bath Thallus is crushed.4 DEG C, 12000g is centrifuged 20min.It is precipitated and dissolved in 8M urea and supernatant is placed in 4 DEG C of ice together Case saves.
5. the supernatant after taking clasmatosis carries out small peptide polyacrylamide gel electrophoresis with the precipitating after re-dissolving (tricine sodiμm dodecyl sμlfatepoly acrylamide gel electrophoresis；Tricine- SDS-PAGE), positioning of the observation recombinant protein in cell.
Purifying:
1. the 100ml bacterium solution 10000g after induction is centrifuged 5min, bacterial sediment is collected, the 20mM phosphate of 15ml is added Buffer (pH 7.4), the concussion that is vortexed mix well it, and 10000g is centrifuged 5min, is repeated twice.
2. the phosphate buffer (pH 7.4) of 15ml 20mM is added, the concussion that is vortexed mixes well it, ice bath 30min It is crushed thallus with ultrasonic cell disruption instrument afterwards, 4 DEG C, 12000g is centrifuged 20min, is repeated twice centrifugation, collects supernatant, will be upper Clear liquid is added to Ni2+On column, 30min is stood, the fusion protein with His label is enable to be integrated to Ni as far as possible2+Column On, in conjunction with removing filtrate after 30min.
3. to Ni2+Combination buffer (the Binging b μ ffer) cleaning of 5-6 times of column volume is slowly added into column.
4. the elution buffer (El μ tion b μ ffer, contain 200mM imidazoles) of 5-6 times of column volume is added, elution is collected Liquid.
5. the eluent of collection is added in 50ml super filter tube (3000MWCO), 4 DEG C, 4000rpm is centrifuged 40-50min, Then the filtrate in casing is outwelled, then the 20mM phosphate buffer of addition 12ml carries out changing liquid (repetition two into super filter tube It is secondary), finally collect the protein concentrated solution on filter membrane.
6. the concentration of Coomassie Brilliant Blue measurement protein concentrated solution.
Prokaryotic expression carrier pET32a-Hyl is constructed, BL21 competent cell is transformed into, is incubated at ampicillin In LB culture medium, after IPTG inducing expression, thalline were collected by centrifugation, ultrasonication centrifuging and taking supernatant, carries out affinity chromatography acquisition Merge Bufo melanostictus serpin；After being digested after ultrafiltration with enterokinase, purifies and recombinate black socket of the eye toad to obtain the final product Bufonid toad serpin, the serpin have strong inhibition tryptic activity.
The present invention is preparing trypsin inhibitor another object is that Bufo melanostictus serpin is applied In.
The Bufo melanostictus serpin is the Trypsin inhibitors object of active constituent.
The Bufo melanostictus serpin is in the application for preparing Trypsin inhibitors object space face.
Bufo melanostictus used derives from Xishuangbanna Prefecture, Yunnan Province in the present invention, buys from the market of farm produce.
Compared with the existing technology, the invention has the benefit that
The present invention derives its amino acid structure by Bufo melanostictus serpin encoding gene, and carries out protokaryon Expression, Bufo melanostictus serpin after purification have the activity of strong inhibition trypsase, the black socket of the eye toad Bufonid toad serpin has the characteristics that produced in vitro is convenient, inhibits tryptic activity powerful.
Bufo melanostictus serpin provided by the invention can inhibit 62% tryptose enzyme activity in 2 μM of concentration Property, 8 μM of concentration Bufo melanostictus serpins can inhibit about 80% tryptic activity.
Detailed description of the invention
Fig. 1 is Bufo melanostictus serpin to trypsin inhibition activity and reaction time relational graph.
Specific embodiment
Below by accompanying drawings and embodiments, invention is further described in detail, but the contents of the present invention are not limited to This, method operating according to a conventional method unless otherwise specified in the present embodiment, the use of agents useful for same unless otherwise specified is often Rule reagent or the reagent configured according to a conventional method.
Embodiment 1: the clone of Bufo melanostictus serpin gene
One, Bufo melanostictus skin Total RNAs extraction
A, living body Bufo melanostictus is washed with water completely, is put into liquid nitrogen quick-frozen 4 hours, takes skin histology, weighed, take 300mg skin histology is added 10ml Total RNAs extraction buffer (Trizol solution, U.S.'s Invitrogen Products), in It is homogenized 10 minutes in 20ml glass homogenizer；
B, isometric phenol/chloroformic solution is added, oscillation mixes, and is placed at room temperature for 10 minutes, and 4 DEG C, 12000rpm is centrifuged 10 points Clock draws upper strata aqueous phase liquid；
C, the isopropanol of 1/2 volume of supernatant is added in supernatant, is placed at room temperature for 10 minutes, 7500g centrifugation 10 at 4 DEG C Minute, precipitating is washed once with 75% ethyl alcohol, is dried, tube bottom sediment is Bufo melanostictus skin total serum IgE.
Two, Bufo melanostictus skin cDNA library synthesizes
Using CLONTECH company CreatorTM SMART TM cDNA Library Constr μ ction Kit plasmid CDNA library constructs kit, operates referring to kit specification method as follows:
A, the first chain of cDNA synthesis (mRNA reverse transcription), the specific steps are as follows:
1, the sterile centrifuge tube of 0.5ml be added 1 μ l Bufo melanostictus skin total serum IgE, 1 μ l SMART IV oligonucleotide, 1 μ l CDS III/3 ' PCR primer, adds 2 μ l deionized waters that total volume is made to reach 5 μ l；
2, reagent and the of short duration centrifugation in centrifuge tube are mixed, 72 DEG C keep the temperature 2 minutes；
3, centrifuge tube is incubated on ice 2 minutes；
4, following 2.0 μ l of reagent, 5 × the first chain buffering, 1.0 μ l 20mM dithiothreitol (DTT)s, 1.0 μ are added in centrifuge tube L 10mM dNTP mixture, 1.0 μ l PowerScript reverse transcriptase；
5, reagent and of short duration centrifugation in centrifuge tube are mixed, keeps the temperature 1 hour at 42 DEG C；
6, centrifuge tube is placed in the synthesis for stopping the first chain on ice；
7, take the first chain of cDNA synthesized by 2 μ l spare from centrifuge tube.
B, the second chain is expanded using long end polymeric enzyme chain reaction (LD-PCR) method, particular content is as follows:
1,95 DEG C of preheating PCR instruments；
2, by 2 the first chains of μ l cDNA (mRNA reverse transcription), 80 μ l deionized waters, 10 10 × Advantage of μ l, 2 PCR Buffering, 2 μ 50 × dNTP of l mixtures, 2 μ l, 5 ' PCR primer, 2 μ l CDS III/3 ' PCR primers and 2 μ l Escherichia coli are poly- Synthase centrifuge tube is reacted；
3, it is expanded in PCR instrument by following procedure:
1. 95 DEG C 20 seconds
2. 22 circulations:
95 DEG C 5 seconds
68 DEG C 6 minutes；
4, the cDNA double-strand synthesized in centrifuge tube after circulation terminates, is subjected to subsequent process.
Three, the amplification of Bufo melanostictus serpin encoding gene
1,95 DEG C of preheating PCR instruments；
2,2 μ l cDNA double-strands (above-mentioned product), 75.5 μ l deionized waters, 10 μ l PCR buffers, 8 μ l dNTP are mixed Object (each 2.5 μM), 2 μ l forward direction amplimers, the reversed amplimer of 2 μ l and 0.5 μ l e. coli dna polymerase are put into centrifugation It is reacted in pipe；Positive amplimer length is 23 nucleotide, 5 '-ATGCATCCTTGTTCTGGTTGTG- of sequence 3 ' (SEQ ID NO:3), reversed amplimer sequence are 5 '-CTATTTCACCTTTGGACATTCCT-3 ' (SEQ ID NO:4)；
3, it is expanded in PCR instrument by following procedure:
(1) initial denaturation
95 DEG C of 5 every minute and second clock
(2) 25 circulations:
95 DEG C 30 seconds
56 DEG C 40 seconds
72 DEG C 30 seconds
(3) it expands afterwards
72 DEG C 5 minutes
4, PCR product after circulation terminates, is stripped recycling with the DNA product purification kit of TIANGEN company, is walked It is rapid as follows:
(1) by PCR product, liquid is mixed by inversion in conjunction with isometric film, and mixed liquor is then transferred to centrifugal purification column, room Temperature stands 5 minutes, makes DNA sufficiently in conjunction with pellosil, and 12000rpm 1 clock of centrifugation point outwells the waste liquid in collecting pipe；
(2) rinsing liquid (containing ethyl alcohol) of 700 μ l is added in centrifugal purification column, 12000rpm is centrifuged 1 minute, outwells collection Waste liquid in pipe；
(3) step 2 is repeated；
(4) 12000rpm is centrifuged 3 minutes；
(5) centrifugal purification column is placed in new centrifuge tube；
(6) 30 μ l ultrapure waters are added, stand 5 minutes at room temperature；
(7) 12000rpm is centrifuged 1 minute, and tube bottom solution is that the Bufo melanostictus serpin purified is compiled Code gene PCR product.
Four, the preparation of bacillus coli DH 5 alpha competent cell
1, the single DH5 α bacterium colony of picking is inoculated in 3ml LB culture medium not with ampicillin, 37 DEG C of overnight incubations, Next day takes above-mentioned bacterium solution, and 1:100 is inoculated in 50ml LB culture medium in proportion, and 37 DEG C vibrate 2 hours.When OD600 value reaches When 0.35, bacterial cultures is harvested；
2, bacterium is transferred in the sterile polypropylene tube of 50ml pre-cooling, places 10min on ice, keeps culture cold But；
3,4100rpm is centrifuged 10min at 4 DEG C, culture solution is sucked out, and pipe is inverted 1min so that remaining culture base flow To the greatest extent；
4, the 0.1mol/L CaCl that every 50ml initial incubation liquid 30ml is pre-chilled2-MgCl2Solution (80mmol/L MgCl2, 20mmol/L CaCl2) cell precipitation is resuspended；
5,4100rpm is centrifuged 10min at 4 DEG C, supernatant is sucked out, and pipe is inverted 1min so that residual liquid stream To the greatest extent；
6, the 0.1mol/L CaCl that every 50ml initial incubation object 2ml is pre-chilled2Cell precipitation is resuspended in solution, dispenses standby With.
Five, connection and the conversion of connection product
1,1 μ l Takara pMD19-T simple carrier, 4 μ l Bufo melanostictus serine eggs are added in microcentrifugal tube The ligase buffer mixture of white enzyme inhibitor encoding gene PCR product and 5 μ l；
2, it reacts 3 hours for 16 DEG C；
3, full dose (10 μ l) is added into 100 μ l DH5 α competent cells, places 30 minutes in ice；
4,42 DEG C after heating 90 seconds, then place 1 minute in ice；
5, the LB culture medium 890 μ l for being added that 37 DEG C of warm bath cross, 37 DEG C slow oscillation culture 60 minutes；
6,200 μ l is taken to be coated on containing X-Gal (the chloro- 3- indoles-β-D- galactoside of the bromo- 4- of 5-), IPTG (isopropyl- β-D- Thiogalactopyranoside), on the LB culture medium of ampicillin, 37 DEG C culture 16 hours to form single colonie.
Six, Bufo melanostictus serpin gene cloning screening and identification
The above-mentioned single bacterium of picking is fallen in LB culture medium with ampicillin, 37 DEG C slow oscillation culture 4 hours, carry out The amplification condition of PCR amplification, amplimer and amplification condition with aforementioned Bufo melanostictus serpin encoding gene； After the positive colony confirmed through PCR is carried out plasmid extraction, with the full-automatic nucleotide of U.S. Applied Biosystems3730A The measurement of sequenator progress nucleotide sequence；Sequencing primer is BcaBESTTM Seq μ encing Primer M13-47 (5 ' CGCCAGGGTTTTCCCAGTCACGAC 3 '), sequence is as shown in SEQ ID NO:1
Bufo melanostictus serpin gene nucleotide series length is 333 bases, sequence type: core Acid, chain number: single-stranded, topology: straight-chain, sequence type: cDNA, source: Bufo melanostictus skin.
Coding Bufo melanostictus serpin be the 1st -333 nucleotide, encode 110 amino acid residues its Amino acid sequence is as shown in SEQ ID NO:2.
Embodiment 2: the prokaryotic expression of Bufo melanostictus serpin, purifying
One, the building of Bufo melanostictus serpin prokaryotic expression carrier
According to the gene design primer of coding Bufo melanostictus serpin, positive nested primers sequence two Item, is added Kpn I restriction enzyme restriction enzyme site and enterokinase cleavage site, and F1 sequence is 5 '- GGTACCGACGACGACGACAAGATGC-3 ' (SEQ ID NO:5)；F2 sequence is 5 '- ACAAGATGCATCCTTGTTCTGGTTG-3 ' (SEQ ID NO:6)；Reverse primer R sequence is 5 '- Hind III digestion site is added in AAGCTTCTATTTCACCTTTGGACATTC-3 ' (SEQ ID NO:7), recycles through PCR, glue Afterwards, double digestion is carried out；Step three in the same embodiment 1 of PCR, glue reclaimer operation step.
Following digestion system is prepared in PCR pipe:
37 DEG C digestion 10 hours, 6 × bromjophenol blue loading buffer, 20 μ l is added in reaction tube, in 1.0% fine jade after mixing Electrophoresis in sepharose recycles target fragment according to stripe size, the step three in the same embodiment 1 of operating procedure.
Following linked system is prepared in PCR pipe:
15 DEG C connect 18 hours, and connection product is transferred to e. coli bl21 competent cell and screening positive clone, operation Step three in the same embodiment 1 of step.
Two, the inducing expression of Bufo melanostictus serpin
1,37 DEG C of shaking table cultures are to OD600 to 0.4-1 (it is recommended that OD600 be 0.6)；
2,100mM IPTG liquid storage is added to final concentration 0.4mM, continues culture 2-3 hours；
3, shaking flask is placed in 5 minutes on ice, 4 DEG C of 5000g centrifugations, 5 minutes collection thallus；
4, it is resuspended the 20mM sodium phosphate that be pre-chilled in 0.25 times of volume of cell, in 20mM imidazoles (pH7.4), is centrifuged；
5, supernatant is removed, thallus is stored in -70 DEG C of refrigerators or continues to purify.
Three, the purifying of Bufo melanostictus serpin
1, albumen is extracted in ultrasonication
Ultrasonic disruption, power are carried out in ice bath after cell is resuspended in 20mM imidazoles (pH7.4) with 20mM sodium phosphate 100-200W, each ultrasound 3s, interval 7s, total time 15min, centrifuging and taking supernatant can be used to affinity chromatography；
2, the preparation of affinity column
After assembling chromatographic column, the bubble of end is removed with distilled water flushing, closes chromatographic column outflux, keeps chromatographic column Lower end is with the presence of part water, and after 6 Fast Flow filler of Ni Sepharose is resuspended, continuous single is loaded into chromatographic column, beats Layers apart analyses column outlet, after setting required flow velocity for constant flow pump, completes the elution, spare of at least three column volume；
3, affinity chromatography
With the combination buffers of 5 to 10 column volumes of the linear flow rate of 150cm/h (20mM sodium phosphate, 20mM imidazoles, PH7.4 chromatographic column) is balanced, aforementioned sample is added, washes pillar with combination buffer, is returned back at baseline until being absorbed at 280nm, Linear gradient elution is carried out with elution buffer (20mM sodium phosphate, 0.5M NaCl, 0.5M imidazoles, pH7.4), collects 60%- 100% elution fraction, as Bufo melanostictus serpin fusion albumen；
4, ultrafiltration
Ultrafiltration is carried out using the ultra-filtration centrifuge tube of molecular cut off 3kD, in the lower 4000 turns of centrifugations 30min of room temperature, be added etc. Volume ddH2Repeated centrifugation step twice, collects the liquid above centrifuge tube and carries out subsequent operation after O；
5, enterokinase cutting and purifying
Above-mentioned albumen 5mg is taken, 20 Μ of recombinant enterokinase, 10 × reaction buffer 100 μ l, total volume 1ml is added；25 DEG C anti- After answering 12 hours, affinity chromatography is carried out, collects the component that chromatographic column cannot combine, carrying out ultrafiltration again to get purity is more than 99% Bufo melanostictus serpin.
Embodiment 3: the application of Bufo melanostictus serpin
Detect the trypsin inhibition activity of Bufo melanostictus serpin.
It is reaction bottom with chromogenic substrate N α-Benzoyl-L-arginine 4-nitroanilide hydrochloride Object, by the Bufo melanostictus serpin of bovine trypsin (0.2ng/ reaction) and reaction buffer, various concentration (2-8 μM of final concentration), mixing are placed on room temperature 5min, and N α-Benzoyl-L-arginine 4-nitroanilide is added Hydrochloride to final concentration of 400 μM, detection 410nm locates absorbance (being denoted as Abo I) after 37 DEG C of incubation 30min, is arranged The conduct that recombination Bufo melanostictus serpin is added compares (being denoted as Abo C), calculates inhibiting rate, and calculation method is (Abo C-Abo I)/Abo C × 100%.
As a result as shown in Figure 1, Bufo melanostictus serpin has powerful trypsin inhibition activity, It can inhibit 62% tryptic activity when 2 μM of concentration, 8 μM of concentration Bufo melanostictus serpins can inhibit 78% Tryptic activity, and this inhibiting effect is very rapid, 2 μM of Bufo melanostictus serpins in 60 seconds It can inhibit 50% tryptic activity, experiments have shown that it can be used as serpin use.

Claims (5)

1. a kind of Bufo melanostictus serpin, it is characterised in that: the Bufo melanostictus serine protease inhibits The amino acid sequence of agent is as shown in SEQ ID NO:2.
2. a kind of gene of Bufo melanostictus serpin described in coding claim 1, it is characterised in that: its nucleosides Acid sequence is as shown in SEQ ID NO:1.
3. the cloning process of Bufo melanostictus serpin gene described in a kind of claim 2, which is characterized in that its Specific steps are as follows:
Bufo melanostictus skin Total RNAs extraction, reverse transcription construction cDNA library, using Bufo melanostictus cDNA as template, according to conservative knot Degenerate primer is designed in structure domain, passes through nested PCR amplification serpin partial sequence, 5 ' PCR primer of primer The PCR primer primer of F2 and 3 ' of F1 and 5 ' R1；According to the partial sequence design primer measured: 3 ' primer R2 and 3 ' Primer R3 carries out nest-type PRC with 5 ' PCR primer II A with library is built again, final to obtain Bufo melanostictus serine stretch protein Enzyme inhibitor overall length ORF；
Wherein, 5 ' PCR primer F1:5 '-TGYGGNWSNGCNTGYCCN-3 '
5’PCR primer F2:5’-CCNTGYGTNGARGGNTGYGTNTGY-3’
5’PCR primer II A:5’-AAGCAGTGGTATCAACGCAGAGT-3’
3’primer R1:5’-ATTGACTCGAGTCGACATCGA-3’
3’primer R2:5’-ATGGACATTCTTCCTTTGGGA-3’
3'primer R3:5'-AGGACCTATAACATATCC-3'；
The serpin partial sequence design primer that basis amplifies above later,
Wherein positive amplimer length is 22 nucleotide,
Its sequence are as follows: 5 '-ATGCATCCTTGTTCTGGTTGTG-3 ',
Reversed amplimer sequence is 5 '-CTATTTCACCTTTGGACATTCCT-3 '.
4. using Bufo melanostictus serpin described in claim 1 as the Trypsin inhibitors object of active constituent.
5. Bufo melanostictus serpin described in claim 1 is preparing answering for Trypsin inhibitors object space face With.
CN201610323050.2A 2016-05-16 2016-05-16 Bufo melanostictus serpin and its gene and application Expired - Fee Related CN105820239B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201610323050.2A CN105820239B (en) 2016-05-16 2016-05-16 Bufo melanostictus serpin and its gene and application

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201610323050.2A CN105820239B (en) 2016-05-16 2016-05-16 Bufo melanostictus serpin and its gene and application

Publications (2)

Publication Number Publication Date
CN105820239A CN105820239A (en) 2016-08-03
CN105820239B true CN105820239B (en) 2019-02-12

Family

ID=56529612

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201610323050.2A Expired - Fee Related CN105820239B (en) 2016-05-16 2016-05-16 Bufo melanostictus serpin and its gene and application

Country Status (1)

Country Link
CN (1) CN105820239B (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108840918B (en) * 2018-06-14 2021-07-23 浙江农林大学 Cloning method of PLA2 inhibitor encoding gene

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101121935A (en) * 2007-07-06 2008-02-13 中国科学院海洋研究所 Chlamys farreri serine protease inhibitor CfKZSPI gene and its coding protein and application

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101121935A (en) * 2007-07-06 2008-02-13 中国科学院海洋研究所 Chlamys farreri serine protease inhibitor CfKZSPI gene and its coding protein and application

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
黑眶蟾蜍皮肤丝氨酸蛋白酶抑制剂基因的克隆与序列分析;韦双双等;《安徽农业科学》;20121231;第40卷(第7期);4017-4019

Also Published As

Publication number Publication date
CN105820239A (en) 2016-08-03

Similar Documents

Publication Publication Date Title
Nara et al. Elastase inhibitor elafin is a new type of proteinase inhibitor which has a transglutaminase-mediated anchoring sequence termed “cementoin”
CN104561208B (en) A kind of three enzymolysis preparations of spirulina antitumor polypeptide
CN104561207B (en) The double enzymolysis preparation method of spirulina antitumor polypeptide
CN104789544B (en) Recombinant PAI-1 inhibitor, comprising its composition and its for treat and detection applications
Claeys et al. Multiple gene duplication in the evolution of plasminogen. Five regions of sequence homology with the two internally homologous structures in prothrombin
CN102373234A (en) Method for purifying recombinant proteins with intein-mediated elastin like proteins
Umasuthan et al. Heparin cofactor II (RbHCII) from rock bream (Oplegnathus fasciatus): molecular characterization, cloning and expression analysis
CN105820239B (en) Bufo melanostictus serpin and its gene and application
CN104387474B (en) A kind of tumor vessel infraction agent polypeptide, gene, expression vector and its application
Verma et al. Lumbrokinase-a potent and stable fibrin-specific plasminogen activator
CN103172730B (en) Bufo melanostictus schneider cystatin as well gene and application thereof
CN109134635A (en) A kind of antibacterial peptide and the preparation method and application thereof with composite bio-active
CN105400761A (en) Plasmin with low molecular weight and preparation method and application of plasmin
CN108586605A (en) TSM1 polypeptides and its application in preparing anticomplement medicament
CN105273072B (en) The anticoagulant protein B26 and its gene of tick and application
CN107523572B (en) Cotesia plutellae larvae teratocyte serpin CvT-SPI gene and application
CN104098690B (en) Dian Chi gold thread Guang presses down plain gene and application thereof
TWI710569B (en) Novel American house dust mite protein
JP2006510342A (en) Prothrombin activating protein
CN108101975A (en) A kind of forest mountain leech antithrombotic polypeptide Sylvestin and its vivoexpression preparation method and application
CN106496329B (en) Fusion protein containing collagen binding structure domain
CN101173003A (en) Hundred-paced pit viper toxin thrombinogen excitor, coded sequence and uses thereof
JP2008517585A (en) A method for obtaining recombinant prothrombin activated protease (rLOPAP) in monomeric form; recombinant prothrombin activated protease (rLOPAP) and its amino acid sequence; use of said protease as a defibrinogenase agent and Diagnostic kit for abnormal prothrombinemia
CN107098955A (en) It is a kind of to be used to diagnose recombinant antigen composition of toxoplasma antibody and preparation method thereof
CN105646702B (en) Hiruto Kazal type trypsin inhibitor Bdellin-HM and its encoding gene and application

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant
CF01 Termination of patent right due to non-payment of annual fee
CF01 Termination of patent right due to non-payment of annual fee

Granted publication date: 20190212

Termination date: 20200516