CN105816863A - Immunogenic anti-inflammatory compositions - Google Patents

Abstract

The invention provides methods of formulating an anti-inflammatory composition for treating inflammatory conditions in a specific organ or tissue. The method involves selecting at least one pathogen that is pathogenic in the specific organ or tissue; producing an antigenic composition comprising antigenic determinants that together are specific for the pathogen; and formulating the antigenic composition for administration as an anti-inflammatory composition capable of eliciting an anti-inflammatory response in the specific organ or tissue, wherein the condition characterized by inflammation is not a cancer. In embodiments of the invention, a cancer is situated in the specific organ or tissue.

Description

Immunogenicity anti-inflammatory composition

Invention field

In all fields, the present invention relates to the immunologic treatments of the morbid state characterized for treatment by inflammation.Can replace For in embodiment, the invention provides the method being formulated for treating the antigen composition of inflammatory condition.

Background of invention

In developed country, the crowd more than 1/3rd is diagnosed with cancer.People more than 1/4th is dead because of it Die.Therapy for cancer depends on such as surgical operation, chemotherapy and the treatment of radiation.But, although these sides Method is useful to the cancer of some type and stage, but has proven to have limited effect in many common types and the cancer in stage Energy.Such as, the surgical operation therapy of tumor needs to completely remove cancerous tissue to prevent recurrence.Equally, radiation therapy needs completely Destroy cancerous cell.This is difficult, because in theory, single malignant cell can be bred, it is sufficient to causes cancer return.Additionally, Surgical operation therapy and radiation therapy relate to the regional area of cancer, and the relative nullity when cancer metastasis.Generally, surgery hands Art or radiation or both of which use in combination with the most chemotherapeutic systemic manner.But, chemotherapy has non-specific Problem, the coexistence problems of harmful side effect, and cancerous cell develops into the probability to drug resistance.

Chemotherapeutic inherent defect has caused different attempt immune to recovery each side to treat cancer.This work The subset made is directed to use with the immunity of microorganism vaccine.Although the method has longer history, but such as institute the most in further detail below Discussing, this field is the most chaotic hybrid state, and this hybrid state is sometimes for the note that induces one unsuccessfully mixed with many Purpose success, these successes do not produce together with failure and withstand extensive clinic and adopt the comprehensive therapy method of inspection.

Include relating to strengthening the therapy of function of immune system for treating the alternative method of cancer, such as cell because of Sub-therapy (such as, for recombinant interleukin2 and the IFN-γ of renal carcinoma), dendritic cell therapy, autologous tumor vaccine therapy, Genetic modification vaccine therapy, lymphocyte therapy and microorganism vaccine therapy, the latter is considered to make with non specific manner For host system.Microorganism vaccine has been used to inoculate individuality for the pathogen relevant to cancer, described cause of disease style Such as human papillomavirus.The immunostimulating microorganism vaccine of the organism of non-targeting induction cancer, i.e. nonspecific immunity Zest vaccine, such as pyrogenicity vaccine, have permanent clinical history, and it is included in the success and failure treated in various cancers Report.Such as, Coley vaccine (streptococcus pyogenes (Streptococcus pyogenes) and serratia marcescens have been reported The combination of (Serratia marcescens)) contribute to treating sarcoma and lymphoma and (see, e.g. Nauts HC, Fowler GAA,Bogato FH.A review of the influence of bacterial infection and of bacterial products[Coley’s toxins]on malignant tumors in man.Acta Med Scand 1953；145[Suppl.276]:5-103).It is reported, clinical trial shows that Coley vaccine therapy is to lymphoma and melanoma Benefit (see, e.g., Kempin S, Cirrincone C, Myers J et al:Combined modality therapy of advanced nodular lymphomas:the role of nonspecific immunotherapy [MBV]as an important determinant of response and survival.Proc Am Soc Clin Oncol 1983；24:56；Kolmel KF,Vehmeyer K.Treatment of advanced malignant melanoma by a pyrogenic bacterial lysate:a pilot study.Onkologie 1991；14:411- 17)。

It has been shown that the usefulness of some non-specific antibacterial cancer vaccine is owing to the component of specific bacteria or product, example Such as DNA or the endotoxin (LPS) of antibacterial, or due to the expression of they induction specificity factors, such as tumor necrosis factor Or IL-12 (TNF).Relatively wide physiological mechanisms has been attributed to such treatment, from the broad sense effect of fever to anti- Angiogenesis mechanism.According to these various principles, many microorganism vaccines are tested as the generality for treating cancer Immunologic stimulant.Although major part has shown negative findings, but minority to show some the most in some cases noticeable Positive findings, as discussed below.

Report that intradermal BCG (mycobacterium tuberculosis var bovis (Mycobacterium bovis)) vaccine therapy is under treatment Row cancer is effective: gastric cancer (see, e.g. Ochiai T, Sato J, Hayashi R, et al:Postoperative adjuvant immunotherapy of gastric cancer with BCG-cell wall endoskeleton.Three-to six-year follow-up of a randomized clinical trial.Cancer Immunol Immunother 1983；14:167-171) and colon cancer (Smith RE, Colangelo L,Wieand HS,Begovic M,Wolmark N.Randomized trial of adjuvant therapy in colon carcinoma:10-Year results of NSABP protocol C-01.J.NCI 2004；96[15]:1128-32； Uyl-de Groot CA,Vermorken JB,Hanna MG,Verboon P,Groot MT,Bonsel GJ,Meijer CJ, Pinedo HM.Immunotherapy with autologous tumor cell-BCG vaccine in patients with colon cancer:a prospective study of medical and economic benefits Vaccine 2005；23[17-18]:2379-87).

Find suffering from lung with mycobacteria w (Mycobacterium w) vaccine therapy of chemotherapy and radiating composite The patient of cancer significantly improves quality of life and the response to treatment (see for example Sur P, Dastidar A.Role of Mycobacterium w as adjuvant treatment of lung cancer[non-small cell lung cancer].J Indian Med Assoc 2003Feb；101[2]:118-120).Similarly, mycobacterium vaccae is found (Mycobacterium vaccae) vaccine improves quality of life in patients with lung cancer and (see for example O ' Brien M, Anderson H,Kaukel E,et al.SRL172[killed Mycobacterium vaccae]in addition to standard chemotherapy improves quality of life without affecting survival,in patients with advanced non-small-cell lung cancer:phase III results.Ann Oncol 2004Jun； 15[6]；906-14) and symptom control (Harper-Wynne C, Sumpter K, Ryan C, et al.Addition of SRL 172to standard chemotherapy in small cell lung cancer[SCLC]improves symptom control.Lung Cancer 2005Feb；47[2]:289-90).

For treatment melanoma, coryne bacterium parvum (Corynebacterium parvum) vaccine with tend to improve The trend of survival is relevant (see for example Balch CM, Smalley RV, Bartolucci AA, et al.A randomized prospective trial of adjuvant C.parvum immunotherapy in 260patients with clinically localized melanoma[stage I].Cancer 1982Mar 15；49[6]:1079-84).

Find that intradermal streptococcus pyogenes vaccine therapy is effectively (to see for example Hanaue H, Kim to treatment gastric cancer DY,Machimura T,et al.Hemolytic streptococcus preparation OK-432；beneficial adjuvant therapy in recurrent gastric carcinoma.Tokai J Exp Clin Med 1987Nov； 12[4]:209-14)。

Find nocardia rubra (Nocardia rubra) to treatment pulmonary carcinoma be effective (see for example Yasumoto K, Yamamura Y.Randomized clinical trial of non-specific immunotherapy with cell- wall skeleton of Nocardia rubra.Biomed Pharmacother 1984；38[1]:48-54；Ogura T.Immunotherapy of respectable lung cancer using Nocardia rubra cell wall skeleton.Gan To Kagaku Ryoho 1983Feb；10 [2Pt 2]: 366-72), and for treatment acute myeloid Leukemia, itself and relevant (Ohno R, Nakamura H, Kodera Y, the et al.Randomized of trend of survival improved controlled study of chemoimmunotherapy of acute myelogenous leukemia[AML]in adults with Nocardia rubra cell-wall skeleton and irradiated allogeneic AML cells.Cancer 1986Apr 15；57[8]:1483-8).

Find that lactobacillus casei (Lactobacillus casei) vaccine therapy with radiating composite is to treatment cervical cancer ratio Only with radiation more effectively.(see, e.g. Okawa T, Kita M, Arai T, et al.Phase II randomized clinical trial of LC9018concurrently used with radiation in the treatment of carcinoma of the uterine cervix.Its effect on tumor reduction and histology.Cancer 1989Nov 1；64[9]:1769-76).

Find that Pseudomonas aeruginosa (Pseudomonas aeruginosa) vaccine therapy is in treatment lymphoma and pulmonary carcinoma Add chemotherapeutic usefulness and (see for example Li Z, Hao D, Zhang H, Ren L, et al.A clinical study on PA_MSHA vaccine used for adjuvant therapy of lymphoma and lung cancer.Hua Xi Yi Ke Da Xue Xue Bao 2000Sep；31[3]:334-7).

Find that the childhood vaccine inoculation using antismallpox vaccine (that is, virus vaccinicum vaccine) is relevant with following: afterwards The risk reducing melanoma in life (see, e.g. Pfahlberg A, Kolmel KF, Grange JM.et al.Inverse association between melanoma and previous vaccinations against tuberculosis and smallpox:results of the FEBIM study.J Invest Dermatol 2002 [119]: 570-575 reduce) and in those patients do not develop melanoma mortality rate (see, e.g. Kolmel KF, Grange JM,Krone B,et al.Prior immunization of patients with malignant melanoma with vaccinia or BCG is associated with better survival.European Organization for Research and Treatment of Cancer cohort study on 542patients.Eur J Cancer 41[2005]:118-125)。

Finding to use the treatment of hydrophobia to cause in 30 patients suffer from melanoma, 8 patients' is temporary Short alleviation (see, e.g. Higgins G, Pack G.Virus therapy in the treatment of tumors.Bull Hosp Joint Dis 1951；12:379-382；Pack G.Note on the experimental use of rabies vaccine for melanomatosis.Arch Dermatol 1950；62:694-695).

Although making immune system participate in anticancer has been carried out greatly to using nonspecific immunostimulatory microorganism vaccine Great majority during amount is attempted, but these are attempted are failed, and only exist minority in the survival improve cancer patient crowd Pervasive successful clinic and research evidence.Although have realized that immunostimulating microorganism vaccine method has hope, but also Have recognized that the feature that huge challenge is this area (see, e.g. Ralf Kleef, Mary Ann Richardson, Nancy Russell,Cristina Ramirez."Endotoxin and Exotoxin Induced Tumor Regression with Special Reference to Coley Toxins:A Survey of the Literature and Possible Immunological Mechanisms."Report to the National Cancer Institute Office of Alternative and Complementary Medicine August 1997；DL Mager. “Bacteria and Cancer:Cause,Coincidence or Cure？A Review.”Journal of Translational Medicine 28March 2006 4[14]:doi:10.1186/1479-5876-4-14)。

Inflammatory bowel disease (IBD) is the title of the one group of inflammatory condition often giving colon and small intestinal, generally special Levy as similar symptom and the uncertain cause of disease.The main subtype of IBD is considered as Crohn disease and exedens knot clinically Enteritis.Except Crohn disease and ulcerative colitis, IBD can also include being considered as any one morbid state following: glue Originality colitis, lymphatic colitis, ischemic colitis, diversion colitis, behcet syndrome or uncertain Property colitis.Difference between these morbid states relates generally to position and the character of the inflammatory activity between gastrointestinal tract (GIT). Such as, Crohn disease is typically considered to affect gastrointestinal any part, from oral cavity to anus, and majority of case table Now for terminal ileum and colon recurring and alleviating gastral granulomatous inflammation.On the contrary, ulcerative colitis generally quilt It is considered limited to colon and rectum.Wherein these inflammatory condition can show the gastrointestinal various region bag of symptom Include: intestinal (bowel) or intestinal (intestine), including small intestinal (its have three parts: duodenum, jejunum and ileum)；Large intestine (it has three parts, caecum；Colon, it includes ascending colon, transverse colon, descending colon and second sigmoid；And rectum)；And Anus.

Understanding to inflammatory bowel disease develops, but also not exclusively (see, e.g. Baumgart in many aspects DC,Carding SR(2007)"Inflammatory bowel disease:cause and immunobiology"The Lancet 369(9573):1627–40；Baumgart DC,Sandborn WJ(2007)"Inflammatory bowel disease:clinical aspects and established and evolving therapies"The Lancet 369(9573):1641–57；Xavier RJ,Podolsky DK(2007)"Unravelling the pathogenesis of inflammatory bowel disease"Nature 448(7152):427–34；J.H.Cho(2008)"The genetics and immunopathogenesis of inflammatory bowel disease"Nature Reviews Immunology 8,458-466)。

Anti-inflammatory medicaments and immune system suppressants, such as sulfasalazine can be used in treatment IBD (Azulfidine^TM), mesalazine (Asacol^TM、Rowasa^TM), corticosteroid (such as, prednisone), azathioprine (Imuran^TM), mercaptopurine (Purinethol^TM), English husband interest (Remicade^TM), adalimumab (Humira^TM), match appropriate pearl Monoclonal antibody (Cimzia^TM), methotrexate (Rheumatrex^TM), ciclosporin (Gengraf^TM、Neoral^TM、Sandimmune^TM) Or natalizumab (Tysabri^TM)。

It has been proposed that for the alternative treatment of IBD, including using various biological preparation or it is said regulation natural intestine Interior flora, it is sometimes referred to as the treatment (US 2007/0258953 of probiotics agents treatment；US 2008/0003207；WO 2007/ 076534；WO 2007/136719；WO 2010/099824).For example, it has been reported that can come with the premeditated infection of parasite Treatment IBD, such as by consuming ovum alive (Summers et al. (2003) " the Trichuris suis of Penis et testis sus domestica helminth seems to be safe and possibly effective in the treatment of inflammatory bowel disease".Am.J.Gastroenterol.98(9):2034–41；Büning et al.,(2008)" Helminths as governors of inflammatory bowel disease"Gut 57:1182-1183； Weinstock and Elliott(2009)"Helminths and the IBD hygiene hypothesis"Inflamm Bowel Dis.2009Jan；15(1):128-33).

Invention summary

On the one hand, it is provided that be formulated for treating morbid state anti-being characterized as inflammation in certain organs or tissue The method of scorching compositions.Described method includes selecting in described certain organs or tissue as at least one pathogenic cause of disease Body；Preparation comprises the antigen composition of antigenic determinant, and described antigenic determinant is specific to pathogen together；And The antigen composition being used for being administered is formulated as to induce in described certain organs or tissue the antiinflammatory combination of anti-inflammatory response Thing, the wherein said morbid state being characterized as inflammation is not cancer.

Described method is additionally may included in before preparing described antigen composition, determines the specific device that wherein inflammation is disease Official or the diagnosis algorithm of tissue.Optionally, tumor or proliferative disease state may be located at certain organs or tissue.

It is optionally possible to antigen composition is formulated as subcutaneous injection or intradermal.It is optionally possible to will be anti- Former compositions is formulated as injecting, thus produces localized skin immune response at site of administration.Optionally, it is provided that the most in detail The method stated, in order to when particular organization or organ are X, pathogen is selected from Y.More specifically, it is believed that following combination is in the method In the range of:

Further it is provided that method detailed in this article, in order to when particular organization or organ are X, pathogen is selected from Y.More Body ground, it is believed that following combination is in the range of the method:

It is optionally possible to antigen composition to be formulated as the subcutaneous or intradermal administration for repeating.Optionally, antigen group Compound may be formulated for being administered by parenteral route.Optionally, pathogen detailed in this article is antibacterial, virus, former Lively thing, fungus or parasite.Additionally, described method can include killing pathogen to be formulated as antigen composition entirely killing (whole killed) pathogen compositions.Additionally, pathogen can be for certain organs or the thing of the endogenous flora of tissue The a member planted.Additionally, pathogen can be xenobiotics's kind.

On the other hand, it is provided that the side of the morbid state being characterized as inflammation in certain organs or tissue that treatment is individual Method.Described method includes the anti-inflammatory composition comprising antigenic determinant to described individuality.Select or prepare described antigen certainly Stator, in order to they together to described certain organs or tissue in at least one pathogenic pathogen be specificity 's.It is optionally possible within the administration persistent period at least two weeks, with the dosing interval of a hour to month give continuous Dosage, gives described anti-inflammatory composition at site of administration.

On the other hand, disclose anti-inflammatory composition for treat individuality certain organs or tissue in be characterized as inflammation The purposes of morbid state.Described anti-inflammatory composition comprises antigenic determinant, selects or prepares described antigenic determinant, in order to it Together to certain organs or tissue in at least one pathogenic microbial pathogens be specific.

On the other hand, anti-inflammatory composition is disclosed for preparing individual being characterized as in certain organs or tissue for the treatment of The purposes of the medicine of the morbid state of inflammation.Described anti-inflammatory composition comprises antigenic determinant, selects or prepares described antigen certainly Stator, in order to they together to certain organs or tissue in at least one pathogenic microbial pathogens be specificity 's.

Optionally, purposes disclosed herein includes wherein individual those use suffering from the cancer being positioned at described organ or tissue On the way.In addition and it is optionally possible within the administration persistent period at least two weeks, give with the dosing interval of a hour to month The successive doses given, gives described anti-inflammatory composition at site of administration.

On the one hand, it is provided that the method for relative immunity response.Described method includes to the animal with organ or tissue There is the medicine of antigen composition containing antigenic determinant, select or prepare described antigenic determinant so as described antigen certainly Stator together in organ or tissue at least one pathogenic microbial pathogens be specific, from described organ Or tissue extraction can quantify immunity sample, can quantify described in measurement after giving medicine in the organ or tissue in immunity sample The feature of immunne response, and by the feature of the described immunne response quantifying immunity sample with from corresponding organ or tissue The individual features of the immunne response of the reference immunity sample obtained compares.Optionally, can give with reference to immunity sample Before the step of medicine, the corresponding organ from animal or tissue obtain.Optionally, can be from the second animal with reference to immunity sample In corresponding organ or tissue obtain.Optionally, animal can have the cancer being positioned at organ or tissue.

The feature of relative immunity response can be included in and can quantify and compare appointing in following cell with reference in immunity sample The digital indication of one or more: struvite mononuclear cell, macrophage, CD11b+Gr-1+ cell, dendritic cell, CD11c + MHC II+ class cell, CD4+T cell, CD8+T cell or NK cell.Optionally, macrophage can include following in appoint One or more: M1-sample macrophage or M2-sample macrophage.Additionally, the feature of relative immunity response can include that comparison is huge The change of phagocyte activated state.Optionally, macrophage can be changed to M1-sample macrophage from M2-sample macrophage.In addition And optionally, macrophage can be changed to M2-sample macrophage from M1-sample macrophage.

Optionally, the feature of relative immunity response can be included in can quantify and with reference to immunity sample in determine following carefully Cell marking in any one or more in born of the same parents: struvite mononuclear cell, macrophage, CD11b+Gr-1+ cell, dendron shape Cell, CD11c+MHC II+ class cell, CD4+T cell, CD8+T cell or NK cell.Macrophage can include following in Any one or more: M1-sample macrophage or M2-sample macrophage.

Optionally, the feature of relative immunity response can be included in can quantify and with reference to immunity sample in determine by following carefully The cytokine that any one or more in born of the same parents produces: struvite mononuclear cell, macrophage, CD11b+Gr-1+ cell, dendron Shape cell, CD11c+MHC II+ class cell, CD4+T cell, CD8+T cell or NK cell.As described in text, macrophage can With include following in any one or more: M1-sample macrophage or M2-sample macrophage.Optionally, due to macrophage Change in activated state and produce cytokine.Optionally, macrophage from M2-sample macrophage be changed to M1-sample huge bite thin Born of the same parents.In addition and optionally, macrophage is changed to M2-sample macrophage from M1-sample macrophage.

Optionally, the feature of relative immunity response can be included in can quantify and with reference to immunity sample in determine by following carefully In born of the same parents any one or more produce differential gene expression: struvite mononuclear cell, macrophage, CD11b+Gr-1+ cell, Dendritic cell, CD11c+MHC II+ class cell, CD4+T cell, CD8+T cell or NK cell.Under macrophage can include Any one or more in row: M1-sample macrophage or M2-sample macrophage.Optionally, due in the activated state of macrophage Change and produce differential gene expression.Optionally, macrophage can from M2-sample macrophage be changed to M1-sample huge bite thin Born of the same parents.In addition and optionally, macrophage is changed to M2-sample macrophage from M1-sample macrophage.

It is optionally possible within the administration persistent period at least one week, give with the dosing interval of a hour to month Successive doses, give described medicine at site of administration.It is optionally possible to Intradermal or subcutaneous give described medicine.Optionally, may be used Effectively to induce the dosage of obvious local inflammation immunne response to give described medicine with every dose at site of administration.Appoint Selection of land, can give described medicine, in order to obvious local inflammation occurred at site of administration in 1 to 48 hour.In addition and appoint Selection of land, animal can be mammal.Optionally, animal can be the mankind or mice.

On the other hand, it is provided that the treatment preparation of the cancer in selecting the certain organs being suitable to treat individuality or organizing Method.Described method includes providing the animal suffering from the cancer being positioned at certain organs or tissue；It is micro-that offer has one or more The test formulation of the antigenic determinant of bio-pathogen, described microbial pathogens is in the respective specific organ of healthy individuals or group For pathogenic in knitting；Measure the spy with reference to the immunne response immunity sample that the organ or tissue from described animal obtains Levy；Test formulation is given to described animal；Measure the quantified immunity sample that corresponding organ or tissue from described animal obtain The feature of immunne response；The feature of the immunne response comparing reference and can quantify in immunity sample；And process with reference exempt from The feature of the increase of the immunne response of the quantified immunity sample that epidemic disease sample is compared, using as the test formulation as treatment preparation Suitability indication.Optionally, before acquisition can quantify immunity sample, described animal is put to death.

Optionally, the feature of relative immunity response can be included in and can quantify and compare following cell in immunity sample In the digital indication of any one or more: struvite mononuclear cell, macrophage, CD11b+Gr-1+ cell, dendron shape are thin Born of the same parents, CD11c+MHC II+ class cell, CD4+T cell, CD8+T cell or NK cell.Optionally, under macrophage can include Any one or more in row: M1-sample macrophage or M2-sample macrophage.Optionally, the feature of relative immunity response is permissible Including the change comparing macrophage activation state.Optionally, can be changed to M1-sample from M2-sample macrophage huge for macrophage Phagocyte.In addition and optionally, macrophage can be changed to M2-sample macrophage from M1-sample macrophage.

Optionally, the feature of relative immunity response can be included in can quantify and with reference to immunity sample in determine following carefully Cell marking in any one or more in born of the same parents: struvite mononuclear cell, macrophage, CD11b+Gr-1+ cell, dendron shape Cell, CD11c+MHC II+ class cell, CD4+T cell, CD8+T cell or NK cell.Optionally, macrophage can include Any one or more in following: M1-sample macrophage or M2-sample macrophage.

Optionally, the feature of relative immunity response can be included in can quantify and with reference to immunity sample in determine by following carefully The cytokine that any one or more in born of the same parents produces: struvite mononuclear cell, macrophage, CD11b+Gr-1+ cell, dendron Shape cell, CD11c+MHC II+ class cell, CD4+T cell, CD8+T cell or NK cell.Macrophage can include following In any one or more: M1-sample macrophage or M2-sample macrophage.Optionally, due to the change of activated state of macrophage Change and produce cytokine.Optionally, macrophage can be changed to M1-sample macrophage from M2-sample macrophage.Additionally, Macrophage can be changed to M2-sample macrophage from M1-sample macrophage.

In addition and optionally, the feature of relative immunity response can be included in can quantify and with reference to immunity sample determines by The differential gene expression that any one or more in following cell produces: struvite mononuclear cell, macrophage, CD11b+Gr-1 + cell, dendritic cell, CD11c+MHC II+ class cell, CD4+T cell, CD8+T cell or NK cell.Optionally, huge bite Cell can include following in any one or more: M1-sample macrophage or M2-sample macrophage.Optionally, bite due to huge The change of the activated state of cell and differential gene expression can be produced.Optionally, macrophage can become from M2-sample macrophage Turn to M1-sample macrophage.In addition and optionally, macrophage can from M1-sample macrophage be changed to M2-sample huge bite thin Born of the same parents.

On the other hand, it is provided that in human individual, selectivity targeting is to cancerous tissue or the side of the immunne response of organ Method.Described method includes the medicine to described individuality with the microbial pathogens antigen composition of effective dose, Qi Zhongsuo Stating microbial pathogens can be pathogenic in the particular cancer organ or tissue of described individuality, and described antigen composition Included in together is specific antigenic determinant to microbial pathogens.Optionally, antigen composition can comprise entirely go out thin Bacterium cell composition.It is optionally possible to described individuality effectively to raise immunne response in individual cancer organ or tissue Dosage and persistent period give described medicine.Optionally, described method can also include the feature measuring immunne response.Described Method also includes that the treatment of precancerous lesion, described precancerous lesion include but not limited to the atypical increasing of actinic keratosis, cervix uteri Life and adenoma of colon.

On the other hand, it is provided that for the method treating the cancer being positioned at tissue or organ of human individual.Described side Method includes the microbial pathogens antigen comprising the bacterial cell composition that entirely the goes out combination to described individuality with effective dose For pathogenic in the medicine of thing, individual certain organs that wherein said microbial pathogens is positioned in described cancer or tissue 's.Described medicine can be given with amount and the persistent period of effectively regulation immunne response to described individuality.Optionally, immunity should The regulation answered can include the change of macrophage activation state.Optionally, the regulation of immunne response can include biting from M2-sample is huge Cell response is to the change of M-1 sample macrophage response.The regulation of immunne response can include from M1-sample macrophage to M2- The change of sample macrophage, term as defined below.Optionally and without limitation, described method can also include measuring immunity The feature of response.

Optionally, the feature of relative immunity response can be included in and can quantify and compare following cell in immunity sample In the digital indication of any one or more: struvite mononuclear cell, macrophage, CD11b+Gr-1+ cell, dendron shape are thin Born of the same parents, CD11c+MHC II+ class cell, CD4+T cell, CD8+T cell or NK cell.Optionally, under macrophage can include Any one or more in row: M1-sample macrophage or M2-sample macrophage.Optionally, the feature of relative immunity response is permissible Including the change comparing macrophage activation state.In addition and optionally, macrophage can be changed to from M2-sample macrophage M1-sample macrophage.Optionally, macrophage can be changed to M2-sample macrophage from M1-sample macrophage.

In addition and without limitation, the feature of relative immunity response can be included in and can quantify and determine in immunity sample Cell marking in any one or more in following cell: struvite mononuclear cell, macrophage, CD11b+Gr-1+ are thin Born of the same parents, dendritic cell, CD11c+MHC II+ class cell, CD4+T cell, CD8+T cell or NK cell.Macrophage can wrap Include following in any one or more: M1-sample macrophage or M2-sample macrophage.Optionally, the feature of relative immunity response Can be included in and can quantify and with reference to immunity sample determines the cytokine produced by any one or more in following cell: Struvite mononuclear cell, macrophage, CD11b+Gr-1+ cell, dendritic cell, CD11c+MHC II+ class cell, CD4+T Cell, CD8+T cell or NK cell.Optionally, macrophage can include following in any one or more: M1-sample is huge to be bitten Cell or M2-sample macrophage.Additionally, due to the change of the activated state of macrophage and cytokine can be produced.Huge bite thin Born of the same parents can be changed to M1-sample macrophage from M2-sample macrophage.Optionally, macrophage can become from M1-sample macrophage Turn to M2-sample macrophage.

In addition and optionally, the feature of relative immunity response can be included in can quantify and with reference to immunity sample determines by The differential gene expression that any one or more in following cell produces: struvite mononuclear cell, macrophage, CD11b+Gr-1 + cell, dendritic cell, CD11c+MHC II+ class cell, CD4+T cell, CD8+T cell or NK cell.Macrophage is permissible Including any one or more in following: M1-sample macrophage or M2-sample macrophage.Optionally, swashing due to macrophage Live the change of state and differential gene expression can be produced.In addition and optionally, macrophage can become from M2-sample macrophage Turn to M1-sample macrophage.Macrophage can be changed to M2-sample macrophage from M1-sample macrophage.

On the other hand, it is provided that monitoring therapeutic scheme is in being just treated the individuality of cancer of certain organs or tissue The method of usefulness.Described method is measured from certain organs or tissue after being included in the individual therapeutic scheme having carried out a period of time The feature of immunne response of the rear treatment immunity sample obtained, wherein should with the immunity not carried out desired by the individuality of therapeutic scheme Answer feature to compare, the indication of the usefulness existing for therapeutic scheme of immunne response feature bigger in magnitude；Control described in and Treatment scheme includes that the preparation of one or more antigenic determinants comprising microbial pathogens, described microbial pathogens exist The respective specific organ or tissue of healthy individuals is pathogenic.

Method detailed in this article also includes the feature measuring pre-treatment with reference to the immunne response of sample, wherein said pre-treatment With reference to sample before therapeutic scheme starts, simultaneously or after but after acquisition before treatment immunity sample from certain organs or group Knit acquisition, and the feature of the immunne response of relatively more pre-treatment and rear treatment sample, wherein with pre-treatment with reference to compared with sample, after The indication of the usefulness increasing to therapeutic scheme of the magnitude of the immunne response for the treatment of immunity sample.Optionally, immunne response is measured Feature can include measuring the indication of struvite amount of mononuclear cells in the sample of organ or tissue.Optionally, immunity is measured The feature of response can include measuring the indication of macrophage quantity in the sample of organ or tissue.Under macrophage can include Any one or more in row: M1-sample macrophage or M2-sample macrophage.

Optionally, the feature of measurement immunne response can include the CD11b+Gr-1+ measuring in the sample of organ or tissue The indication of the dendritic cell quantity in the indication of cell quantity, or the sample of mensuration organ or tissue.In addition and optionally, The feature measuring immunne response can include measuring the finger of CD11c+MHC II+ class cell quantity in the sample of organ or tissue Levy, or measure the indication of CD4+T cell quantity in the sample of organ or tissue, or measure the sample in organ or tissue The indication of middle CD8+T cell quantity.

Optionally, measure the magnitude of immunne response and can include measuring the finger of NK cell quantity in the sample of organ or tissue Levy.In addition and optionally, the feature of relative immunity response determines in following cell in can being included in reference and immunity sample Any one or more on cell marking: struvite mononuclear cell, macrophage, CD11b+Gr-1+ cell, dendron shape are thin Born of the same parents, CD11c+MHC II+ class cell, CD4+T cell, CD8+T cell or NK cell.Optionally, under macrophage can include Any one or more in row: M1-sample macrophage or M2-sample macrophage.

In addition and optionally, the feature of relative immunity response determine in can being included in reference and immunity sample by following carefully The cytokine that any one or more in born of the same parents produces: struvite mononuclear cell, macrophage, CD11b+Gr-1+ cell, dendron Shape cell, CD11c+MHC II+ class cell, CD4+T cell, CD8+T cell or NK cell.Macrophage can include following in Any one or more: M1-sample macrophage or M2-sample macrophage.Optionally, due to the change of activated state of macrophage And cytokine can be produced.Macrophage can be changed to M1-sample macrophage from M2-sample macrophage.In addition the most optionally Ground, macrophage can be changed to M2-sample macrophage from M1-sample macrophage.

Optionally, the feature of relative immunity response determines by following cell in can being included in reference and immunity sample Any one or more differential gene expression produced: struvite mononuclear cell, macrophage, CD11b+Gr-1+ cell, dendron shape Cell, CD11c+MHC II+ class cell, CD4+T cell, CD8+T cell or NK cell.Macrophage can include following in Any one or more: M1-sample macrophage or M2-sample macrophage.Can produce due to the change of activated state of macrophage Raw differential gene expression.Macrophage can be changed to M1-sample macrophage from M2-sample macrophage.Optionally, macrophage M2-sample macrophage can be changed to from M1-sample macrophage.

As the most in greater detail herein, present invention provide for preparation treatment mammal, the such as mankind The method being positioned at the immunogenic composition of the cancer of certain organs or tissue in patient.Described method can include selecting at least For the microbial pathogens of native pathogenic in the organ or tissue of a kind of mammal being positioned in cancer.Can prepare anti- Former compositions, it is included the feature to microbial pathogens is specific antigenic determinant.

Diagnosis algorithm can be used for, before producing the antigen composition in target on cancer site, determining that cancer is positioned at specific Organ or tissue.The site of described cancer can be primary site or the secondary site of transfer.Antigen composition can be enough Specific, in order to it can induce the immunne response of mammal specific to microbial pathogens.Antigen composition is permissible For bacteria composition, the flora for example originating from bacterial species or to patient be endogenic species or from exogenous species or Kind.In alternative embodiment, antigen composition can come from a kind of viral or multiple virus.Therefore, from antigen The microbial pathogens of compositions can be virus.Microbial pathogens can be killed.In alternative embodiment, Microbial pathogens is lived or decays.Anti-inflammatory application method, such as NSAID can also be used to prepare or give The immunogenic composition of the present invention.Site of administration can be the site away from cancer site, such as, be not positioned at by cancer Organ or tissue organ or tissue in, such as skin or subcutaneous tissue.

Such as can prepare described antigen composition for subcutaneous injection, intradermal or oral administration.It is being used for In the subcutaneous or embodiment of intradermal, the dosage of antigen composition or preparation can be regulated thus at the skin of site of administration Skin produces obvious local immune response, the most a diameter of 2mm's to 100mm occurred for 2 to 48 hours the most upon administration Struvite region, and continue such as 2 to 72 hours or more long.Can prepare described antigen composition for repeat subcutaneous or Intradermal administration, such as in continuous site alternately.

In some embodiments, the method that the present invention relates to treat the cancer being positioned at tissue or organ of mammal. In alternative embodiment, described treatment it is expected to cancer development in the tissue, if such as primary tumor Site shows the probability to particular organization or organ metastasis, then can treat described patient to prevent or to alleviate to this in pre-defense sector Tissue or the transfer of organ.Described method can include the antigen the comprising antigenic determinant combination giving effective dose to individuality Thing, described antigenic determinant is specific at least one microbial pathogens together.An aspect of of the present present invention includes making It is used in the certain organs of the mammal that cancer is positioned at or tissue as pathogenic microbial pathogens.Antigen can be given Compositions, such as by for example, at least 1 week, 2 weeks, 2 months, 6 months, the administration persistent period of 1,2,3,4 or 5 years or more long In, with the successive doses given under such as a hour to the dosing interval of month, note the subcutaneous of site of administration or intradermal Penetrate.Such as can measure per injection dosage, in order to the most effectively cause after injection 1 to 48 hour occur at site of administration Obvious local inflammation.

Invent at another, it is provided that for by giving one or more antigens of one or more microbial pathogenses The method treating the cancer of certain organs or tissue in individuality, described microbial pathogens is such as in described certain organs or group For pathogenic antibacterial or viral species in knitting.

In alternative embodiment, invasive organism species can be in the certain organs of healthy individuals or tissue Induce infection (i.e. unmanned for interfering) natively, or induction can infect in the certain organs of healthy individuals or tissue.Can In the embodiment substituted, antigen can be given by giving full microbial species.In alternative embodiment, described Method can such as include giving at least two or multiple-microorganism species or giving at least three kinds or more kind microbial species, And described microorganism can be antibacterial or virus.In alternative embodiment, described method can also include mending Fill agent or adjuvant.An aspect of of the present present invention relates to giving antigen composition to cause immunne response in described individuality.

In alternative embodiment, the microbial pathogens of antigen composition can be killed, and thus gives non-sense Metachromia.In some embodiments, give antigen composition in the site away from cancer site, and in selected this kind of reality Execute in scheme, the method for the present invention can be carried out so that they do not produce infection in cancer site.

As described herein, various aspects of the invention include treating cancer.In this article, can carry out treating to carry For various results.Such as, treatment can: excite effectively suppress or alleviate cancer growth or propagation immunne response；Suppression cancer Cell or the growth of tumor or propagation；Cause the alleviation of cancer；Improve quality of life；Reduce the risk of cancer return；Suppression cancer The transfer of disease；Or improve the patient survival in patients.In this article, patient or the expection longevity of patients are extended Life refers to survive the quantity of patient of given period after particular diagnosis.In some embodiments, treatment can relate to Do not have the patient of response to other treatment, such as chemotherapy or surgical operation are not the patient of effectively treatment.Alternatively Treatment in embodiment can be such as before or after cancer starts.Such as, prophylactic treatment can be to being such as diagnosed Carry out for being in the patient of particular cancers risk.It is, for example possible to use be included in certain organ or tissue as pathogenic cause of disease The immunogenic composition of the antigenic determinant of body is treated the cancer to this organ or tissue and is had genetic predisposition or life The patient of mode susceptibility (lifestyle predisposition).It is also possible to carry out the prophylactic treatment shifted, in order to The immunogenic composition being included in certain organs or tissue the antigenic determinant being pathogenic pathogen can be used Treatment suffers from shifts the patient having aptitudinal preinvasive cancer to this tissue or organ.

On the other hand, it is provided that treatment is positioned at the method for the cancer of the pulmonary of individuality.Described method includes to described What body gave effective dose is the antigen of one or more pathogenic microbial species in pulmonary, and gives to described individuality The chemotherapeutant of the platiniferous of effective dose.Microbial species can be viral pathogen or bacterial pathogens or fungal pathogens.

Viral pathogen can be but be not limited to: influenza virus, adenovirus, respiratory syncytial virus or parainfluenza virus Poison.Bacterial pathogens can be but be not limited to: streptococcus pneumoniae (Streptococcus pneumoniae), moraxelle catarrhalis (Moraxella catarrhalis), mycoplasma pneumoniae (Mycoplasma pneumoniae), Klebsiella pneumonia (Klebsiella pneumoniae), hemophilus influenza (Haemophilus influenza), staphylococcus aureus (Staphylococcus aureus), Chlamydia pneumoniae (Chlamydia pneumoniae) or bacillus legionnaires,pneumophila (Legionella pneumophila).Fungal pathogens can be but be not limited to: Aspergillus fumigatus (Aspergillus Fumigatus), blastomyces (Blastomyces sp.), coccidioides immitis (Coccidiodes immitis), Coccidiodes Posadasii, Cryptococcus histolyticus (Cryptococcus neoformans), lattice spy cryptococcus (Cryptococcus Gattii), Fusarium spp. (Fusarium sp.), Histoplasma capsulatum (Histoplasma capsulatum), Paecilomyces varioti (Paecilomyces sp.), Paracoccidioides brasiliensis (Paracoccidiodes brasiliensis), Penicillium marneffei Bacterium (Penicillium marneffei), Ye Shi lung pityrosporion ovale (Pneumocystis jiroveci), the pseudo-mould sample of Bo Yide are true Bacterium (Pseudallescheria boydii), Scedosporium apiospermum (Scedosporium apiospermum), rhizopus (Rhizopus sp.), mucormycosis (Mucor sp.), colter mould (Absidia sp.), Cunninghamella sp Many spores (Scedosporium prolificans), stachybotrys chartarum are matched in (Cunninghamella sp.), many births (Stachybotrys chartarum), long shoot Trichoderma spp. (Trichoderma longibrachiatium) or many pityrosporion ovales (Trichosporon sp.).Additionally, the chemotherapeutant of platiniferous can be but be not limited to: cisplatin, carboplatin or oxaliplatin.

On the other hand, it is provided that the making at the antigen that pulmonary is one or more pathogenic microbial species of effective dose With, thus the medicine that the chemotherapeutant with platiniferous being formulated for the individual pulmonary carcinoma for the treatment of is used together.On the other hand, carry For effective dose at the antigen that pulmonary is one or more pathogenic microbial species, with the chemotherapy with platiniferous Agent is used together the pulmonary carcinoma treating individuality.Microbial species can be viral pathogen or bacterial pathogens or fungal pathogen Body.

Viral pathogen can be but be not limited to: influenza virus, adenovirus, respiratory syncytial virus or parainfluenza virus Poison.The pathogen of antibacterial can be but be not limited to: streptococcus pneumoniae, moraxelle catarrhalis, mycoplasma pneumoniae, e coil k 1 pneumonia Bacterium, hemophilus influenza, staphylococcus aureus, Chlamydia pneumoniae or bacillus legionnaires,pneumophila.Fungal pathogens can be but not It is limited to: Aspergillus fumigatus, blastomyces, coccidioides immitis, Coccidiodes posadasii, Cryptococcus histolyticus, lattice spy cryptococcus, reaping hook Bacterium, Histoplasma capsulatum, Paecilomyces varioti, Paracoccidioides brasiliensis, penicillium Marneffei, Ye Shi lung pityrosporion ovale, Bo Yide puppet Allescheriasis, Scedosporium apiospermum, rhizopus, mucormycosis, colter are mould, Cunninghamella sp, many births match many spores, cardboard grape ear Mould, long shoot Trichoderma spp. or many pityrosporion ovales.Additionally, the chemotherapeutant of platiniferous can be but be not limited to: cisplatin, carboplatin or Ao Shali Platinum.

On the other hand, it is provided that effective dose at the antigen that pulmonary is one or more pathogenic microbial species, from And the medicine that the chemotherapeutant with platiniferous being formulated for the individual pulmonary carcinoma for the treatment of is used together.On the other hand, it is provided that have Effect amount at the antigen that pulmonary is one or more pathogenic microbial species, be used together with the chemotherapeutant with platiniferous Treat the pulmonary carcinoma of individuality.Microbial species can be viral pathogen or bacterial pathogens or fungal pathogens.

Viral pathogen can be but be not limited to: influenza virus, adenovirus, respiratory syncytial virus or parainfluenza virus Poison.The pathogen of antibacterial can be but be not limited to: streptococcus pneumoniae, moraxelle catarrhalis, mycoplasma pneumoniae, e coil k 1 pneumonia Bacterium, hemophilus influenza, staphylococcus aureus, Chlamydia pneumoniae or bacillus legionnaires,pneumophila.Fungal pathogens can be but not It is limited to: Aspergillus fumigatus, blastomyces, coccidioides immitis, Coccidiodes posadasii, Cryptococcus histolyticus, lattice spy cryptococcus, reaping hook Bacterium, Histoplasma capsulatum, Paecilomyces varioti, Paracoccidioides brasiliensis, penicillium Marneffei, Ye Shi lung pityrosporion ovale, Bo Yide puppet Allescheriasis, Scedosporium apiospermum, rhizopus, mucormycosis, colter are mould, Cunninghamella sp, many births match many spores, cardboard grape ear Mould, long shoot Trichoderma spp. or many pityrosporion ovales.Additionally, the chemotherapeutant of platiniferous can be but be not limited to: cisplatin, carboplatin or Ao Shali Platinum.

On the other hand, it is provided that test kit.Described test kit is included in pulmonary as one or more pathogenic micro-lifes The antigen of thing species, the chemotherapeutant of platiniferous；And the chemotherapeutant of this antigen and platiniferous is provided to patient in need Description.Microbial species can be viral pathogen or bacterial pathogens or fungal pathogens.

Viral pathogen can be but be not limited to aforesaid: influenza virus, adenovirus, respiratory syncytial virus or sidestream Influenza Virus.The pathogen of antibacterial can be but be not limited to: streptococcus pneumoniae, moraxelle catarrhalis, mycoplasma pneumoniae, kerekou pneumonia primary Salmonella, hemophilus influenza, staphylococcus aureus, Chlamydia pneumoniae or bacillus legionnaires,pneumophila.Fungal pathogens can be but It is not limited to: Aspergillus fumigatus, blastomyces, coccidioides immitis, Coccidiodes posadasii, Cryptococcus histolyticus, lattice spy cryptococcus, sickle Cutter bacterium, Histoplasma capsulatum, Paecilomyces varioti, Paracoccidioides brasiliensis, penicillium Marneffei, Ye Shi lung pityrosporion ovale, Bo Yide Pseudo-Allescheriasis, Scedosporium apiospermum, rhizopus, mucormycosis, colter are mould, Cunninghamella sp, many births match many spores, cardboard Fructus Vitis viniferae Fringe is mould, long shoot Trichoderma spp. or many pityrosporion ovales.Additionally, the chemotherapeutant of platiniferous can be but be not limited to: cisplatin, carboplatin or Ao Shali Platinum.

In all fields, present invention provide for preparation and use the immunogenic composition for the treatment of IBD.IBD can With for example, IBD as disease in one or more regions of the GIT of human patients, such as Crohn disease, ulcerative colitis Inflammation, collagenous colitis, lymphatic colitis, ischemic colitis, diversion colitis, behcet syndrome or not Definitiveness colitis.The treatment of patient can include determining that the diagnosis algorithm in the region of the GIT that IBD is disease.Described preparation can To comprise containing together to the antigen composition that at least one pathogen is specific antigenic determinant, described pathogen is being subject to The GIT region infected is pathogenic, such as antibacterial, virus, protozoacide or parasite.Can prepare said preparation for It is administered as the immunogenic composition that can induce immunne response, thus treats IBD.Such as can with compositions formulated with In parenteral route, such as subcutaneous injection or intradermal, such as thus produce localized skin immune response at site of administration, The most struvite response.

Accompanying drawing is sketched

Fig. 1 illustrates that some diagnosis accumulated suffer from the patient's (all patients) of 3B or 4 phases inoperable pulmonary carcinoma Survival curve, compares the patient with MRV treatment, the patient of unused MRV treatment and standard SEER survival curve.Fig. 1: the 3B or The survival of 4 phase lung & bronchogenic carcinomas.

Fig. 2 illustrates that some diagnosis accumulated suffer from the patient of 3B or 4 phases inoperable pulmonary carcinoma (with MRV treatment extremely The patient of few 2 months) survival curve, compare the patient with MRV treatment, the patient of unused MRV treatment and standard SEER and deposit Curve alive.Fig. 2: the 3B or the survival of 4 phase lung & bronchogenic carcinomas.

Fig. 3 illustrates that some diagnosis accumulated suffer from the survival curve of the patient of 3B or 4 phase pulmonary carcinoma, it is shown that use the present invention The benefit of MRV compositions treatment, compares the patient with MRV treatment, the patient of unused MRV treatment and standard SEER survival song Line.Fig. 3: combinative analysis (MRV is to non-MRV lung 2).

Fig. 4 illustrates that some diagnosis accumulated suffer from the survival curve of the patient of 3B or 4 phase pulmonary carcinoma, it is shown that at least 2 months The effect for the treatment of, compare the patient with MRV treatment, the patient of unused MRV treatment and standard SEER survival curve.Fig. 4: group Close and analyze (MRV more than 2 months is to non-MRV lung 2).

Fig. 5 illustrates that some diagnosis accumulated suffer from the survival curve of the patient of 3B or 4 phase pulmonary carcinoma, it is shown that at least 6 months The effect of the treatment of persistent period, compares the patient with MRV treatment, the patient of unused MRV treatment and standard SEER survival song Line.Fig. 5: combinative analysis (MRV more than 6 months is to non-MRV lung 2).

Fig. 6 illustrates some survival curves with 52 patient with breast cancers shifted to bone and/or pulmonary accumulated, and compares With the patient of MRV treatment, the patient of unused MRV treatment and standard SEER survival curve.Fig. 6: for the 4th of bone/Lung metastases the Primary breast cancer survival curve.

Fig. 7 is surgical operations or its prostate of radiation destruction (therefore, for preinvasive cancer) and can examining of some accumulations The cancer surveyed is limited to the comparison of survival of the metastatic prostate cancer patient of Bone tumour, compares the patient with MRV treatment, unused The patient of MRV treatment and standard SEER survival curve.Fig. 7: the survival suffering from the 4th phase patients with prostate cancer of Bone tumour is (outer Section's operation or radiation destruction prostate).

Fig. 8 illustrates that some tentative diagnosis accumulated suffer from the survival curve of the patient of the 4th phase colorectal carcinoma, compares use The patient of PVF treatment, the patient treated with the patient of MRV treatment, unused antigen composition and standard SEER survival curve.Figure 8: the 4 phase treatment of colorectal cancers compare.

Fig. 9 illustrates that some tentative diagnosis accumulated suffer from the survival curve of the patient of the 4th phase colorectal carcinoma, and data Come from and meet subject patient in 3 months of diagnosis, compare the patient with PVF treatment, patient, not with MRV treatment With patient and the standard SEER survival curve of antigen composition treatment.In Fig. 9: the 4 phase colorectal cancer transfer 3 months of day and Visit for the first time.

Figure 10 illustrates some the are accumulated use oral cavity antigenotherapy compared with patient that is that do not use antigen composition (i.e. The survival curve of the 3B phase patients with lung cancer Respivax) treated.The comparison of the Figure 10: the 3B phase patients with lung cancer lung 2 is survived (without epidemic disease Seedling is to Respivax).

Figure 11 illustrates that some diagnosis accumulated suffer from the survival curve of the patient of 3B phase pulmonary carcinoma, it is shown that with the present invention's The benefit of MRV compositions treatment, compares the patient with MRV treatment, the patient of unused MRV treatment and standard SEER survival song Line.The survival of the diagnosed SARS case that the Figure 11: the 3B&4 phase pulmonary carcinoma includes at 1992-2000.

Figure 12 illustrates suffer from depositing of DATA REASONING that the patient of 3B phase pulmonary carcinoma visits for the first time from the diagnosis accumulating some Curve alive, it is shown that by the benefit of the MRV compositions treatment of the present invention, compare the patient with MRV treatment, unused MRV treats Patient and standard SEER survival curve.Figure 12: the 3B&4 phase pulmonary carcinoma survival visited for the first time from CIH.

The diagnosis that what Figure 13 illustrated that some accumulate visit for the first time within diagnosis 3 months suffers from the survival of the patient of 3B phase pulmonary carcinoma Curve, it is shown that by the benefit of the early treatment of the MRV compositions of the present invention, compare the patient with MRV treatment and unused MRV controls The patient treated.Figure 13: the CIH of 3B phase pulmonary carcinoma follows up a case by regular visits in diagnosis has 3B after date 3 months.

Figure 14 illustrates that comfortable Lewis lung cancer cell only uses Klebsiella pneumonia vaccine therapy the (the 1st after attempting OK) and the photo of pulmonary of mice of its treatment (the 2nd row) unused, as described in embodiment hereof 4A.Bottom row (unnumbered) describes Pulmonary from the mice that is not exposed to mice model of lung cancer.

Figure 15 is shown in after attempting by B16 melanoma cell and controls with bacterial vaccine treatment [AB1-AB6] and unused its Treat the mean tumour volume of the mice of [AB-7], as described in embodiment hereof 4B.

Figure 16 illustrates the survival curve of the model of colon cancer mice group using various bacteria vaccine therapy or its treatment unused, as Described in embodiment hereof 4C.Figure 16: with the survival curve of the model of colon cancer mice group that the various bacterial vaccinees killed process.

Figure 17 be shown in Klebsiella pneumonia antigen composition or PBS treatment after draining lymph node, pulmonary and Struvite mononuclear cell in spleen and the quantity of dendritic cell, as described in embodiment hereof 5A.

Figure 18 is shown in after treating with Klebsiella pneumonia antigen composition, bacillus coli antigen compositions or PBS Mononuclear cell in pulmonary, peritoneum and the spleen of mice and the total amount of dendritic cell, as described in embodiment hereof 5B.

Figure 19 illustrates comfortable Klebsiella pneumonia antigen composition, bacillus coli antigen compositions or PBS treatment The CD4+T cell of mice afterwards, CD8+T cell and the total amount of NK cell, as described in embodiment hereof 5B.

Figure 20 illustrates that heat inactivation Klebsiella pneumonia antigen composition of using by oneself, phenol inactivation Klebsiella pneumonia resists The mice of former compositions or PBS treatment at (A) struvite mononuclear cell of the 9th or 16 day and (B) CD4+T cell, CD8+T Cell and the total amount of NK cell, as described in embodiment hereof 5C.

Figure 21 illustrates that heat inactivation Klebsiella pneumonia antigen composition of using by oneself, phenol inactivation Klebsiella pneumonia resists Former compositions or (A) struvite mononuclear cell of mice of PBS treatment and dendritic cell and (B) CD4+T cell, CD8+T Cell and the total amount of NK cell, as described in embodiment hereof 5D.

Figure 22 illustrate with the Klebsiella pneumonia antigen composition as described herein of PBS or various dose treat little The total amount of the tumor nodule of Mus.

Figure 23 illustrates the Klebsiella pneumonia antigen composition as described herein treatment of use by oneself PBS or various dose Pulmonary's photo of mice.

Figure 24 illustrate with the Klebsiella pneumonia antigen composition as described herein of PBS or various dose treat little The total amount of the tumor nodule of Mus.

Figure 25 illustrates the as described herein and pneumonia gram of cisplatin combination (or the most in combination) with PBS or various dose The total amount of the tumor nodule of the mice of thunder primary Salmonella antigen composition treatment.

Figure 26 illustrates with Lewis lung cancer cell infusion and with (i) vehicle control；(ii) cisplatin；(iii) antigen composition Or the survival curve of the mice of (iv) antigen composition and plus cisplatin in treatment.

Figure 27 is shown in the 13rd day of related experiment detailed in this article, the percentage ratio of the CD11b+ myeloid cell in blood.

Figure 28 illustrates that (left figure) uses by oneself the Klebsiella pneumonia antigen composition of various dosage or treat with PBS control The CD11b+NK1.1-cell frequencies of pulmonary of mice, or (right figure) use by oneself Klebsiella pneumonia of various dosage resists Former compositions or the frequency of the CD11b+NK1.1+ cell with the pulmonary of the mice of PBS control treatment.

Figure 29 illustrate various dosage of always using by oneself Klebsiella pneumonia antigen composition or with PBS control treatment little The lung tissue of Mus measures the amount of all multiple cytokines of (in terms of pg/g).

Figure 30 illustrate various dosage of always using by oneself Klebsiella pneumonia antigen composition or with PBS control treatment little The BAL liquid of Mus measures the amount of all multiple cytokines of (in terms of pg/ml).

Figure 31 illustrate various dosage of using by oneself Klebsiella pneumonia antigen composition or with PBS control treatment mice The Relative gene expression ratio of NOS2 Yu Arg1.

Figure 32 illustrate various dosage of using by oneself Klebsiella pneumonia antigen composition or with PBS control treatment little The relative frequency that the CD206 of pulmonary's macrophage of Mus expresses.

Figure 33 illustrate various dosage of using by oneself Klebsiella pneumonia antigen composition or with PBS control treatment mice Pulmonary's macrophage F4/80 express relative frequency.

Figure 34 illustrates from by Klebsiella pneumonia or bacillus coli antigen compositions or with the mice of PBS control treatment The relative frequency of the CD11b+Gr-1+ cell that colon measures.

Figure 35 illustrates from by Klebsiella pneumonia or bacillus coli antigen compositions or with the mice of PBS control treatment The relative frequency of the CD11b+Gr-1+ cell that pulmonary measures.

Figure 36 is shown as the relative frequency (left figure) of the CD11b+ cell of the M1 sample from the separation of subQ 4T1 tumor and is Relative frequency (right figure) from the CD11b+ cell of the M2 sample of subQ 4T1 tumor separation.

Figure 37 illustrates use by oneself indomethacin and PBS；Or indomethacin and staphylococcus aureus antigen composition；Or EtOH and PBS；Or the gross tumor volume (mm of the mice of EtOH and the treatment of staphylococcus aureus antigen composition³) [left figure].Should The relative frequency of CD11b cell and composition in the tumor of the right figure of figure be also shown in related experiment described herein the 11st day.

The relative frequency of CD11b+ cell and composition in the tumor of Figure 38 be shown in related experiment described herein the 22nd day.

Figure 39 illustrates with indomethacin, indomethacin+antigen composition, only by vehicle or only treats with antigen composition Gross tumor volume in group same period of animal.

Figure 40 illustrates with indomethacin, indomethacin+antigen composition, only by vehicle or only treats with antigen composition Animal tumor in the percentage ratio (data of the 11st day) of CD11b+ cell.

Figure 41 illustrates with indomethacin, indomethacin+antigen composition, only by vehicle or only treats with antigen composition Animal tumor in the percentage ratio (data of the 22nd day) of CD11b+ cell.Figure 41: the CD11b+ cell in tumor.

Figure 42 illustrates with indomethacin, indomethacin+antigen composition, only by vehicle or only treats with antigen composition Animal tumor in the percentage ratio (data of the 22nd day) of CD11b+CD94+ cell.

The relative expression of (A) Fizz1 that Figure 43 is shown in cut tumor as herein described and (B) Ym1.

Figure 44 illustrates from tumor described herein relative with (B) Fizz1 with (A) Arg1 in spleen [(C) and (D)] Express.

Figure 45 illustrates from tumor as herein described and the relative expression of Nos2 and Ym1 of spleen.

Figure 46 is shown in be suffered from or not to suffer from tumor and use or does not use antigen composition as herein described to treat The amount of the IFN-γ produced in the pulmonary of mice.

Figure 47 illustrates by only biting with the bone marrow of Klebsiella pneumonia antigen composition, LPS and culture medium incubated overnight is huge The amount of the IL-10 that cell produces.

Figure 48 be shown in described herein under conditions of, the relative expression of IL-10 produced in the tumor of mice.

Detailed Description Of The Invention

In all fields, embodiment of the present invention relate to it has surprisingly been found that the most such as in the site away from cancer Give to be pathogenic microbial pathogens in particular organization or organ, the microbial pathogens such as killed, effectively control Treat the cancer being positioned at this particular organization or organ.Therefore, present invention provide for treating the thin from including entirely killing of cancer Bacterium or viral species or their component are at the antigen composition of these interior microbial pathogenses and this antigen composition Using method.

Based on from connecing the observation of subject patient, find to include that many typically results in the antibacterial thing of pulmonary infection Kind astonishing in the interior compositions killing antibacterial and be effectively improved the clinical course of lung cancer unexpectedly.Equally, Find to comprise the golden yellow pyogenesis Fructus Vitis viniferae ball killed (bone, mammary gland, skin, perineum and Lymphod infection and septicemia One of most common inducement) compositions astonishing and be effectively improved osteocarcinoma, breast carcinoma, skin carcinoma, carcinoma of vulva unexpectedly With lymphoma (cancer of lymph gland) and the clinical course of multiple myeloma (a type of hematologic cancer).Equally, Astonishing and it was unexpectedly found that, comprise escherichia coli (its for colon, kidney, peritoneum, liver, abdominal part, pancreas and Ovary infect common inducement) compositions be effectively improved at colon, kidney, peritoneum, liver, abdominal lymph node, pancreas and ovum The clinical course of the cancer in nest.

These results show to be included in the group of the invasive organism species antigen inducing infection in particular organization or organ Compound is by for being used for treating effective preparation of the cancer in this tissue or organ.Such as, with comprising usual induction pulmonary infection The microbial composite of one or more pathogenic species effectively treats the cancer of pulmonary, and with comprising generally induction colon sense The compositions of the invasive organism species of dye effectively treats the cancer of colon.

Can prepare the antigen composition of the present invention, it is included the feature to microbial pathogens is specific Antigenic determinant.In this article, " specificity " refers to that antigenic determinant be enough to the feature into pathogen, if to have that effect Appropriate ways give antigenic determinant, then they can be used for producing the immunne response of pathogen for patient, such as, adapt to Property immunne response.It is appreciated that antigenic determinant is without for following specific, i.e. they to be only the one of pathogen specific Bacterial strain or the feature of species, because the specific immune response for special pathogen can also be with the tissue being positioned in cancer Or organ and preparation or select to be that other of native pathogenic is closely-related in the tissue of antigen composition institute targeting or organ Organism intersection response.

In some embodiments, the compositions of pathogen microorganism may be used for treat preinvasive cancer site and/or Transfer site.It is therefoie, for example, microbial composite may be used for treating in the cancer of specific site, no matter whether this cancer is Preinvasive cancer or transfer.Compositions can relate to the treatment in each cancer site, can be maybe the compositions that combines for Preinvasive cancer and transfer site.Such as, have been transferred to the renal carcinoma of pulmonary and bone for treatment, can include being known as kidney cause of disease One or more species of body, it is known as one or more species of lung pathogen and is known as the one of osteopathia substance or many Plant three kinds of different compositionss or their binding compositions of species.In some embodiments, can simultaneously or different time Described compositions is given at diverse location.

Such as, for having the pulmonary carcinoma to Bone tumour, in alternative embodiment, it is possible to use comprise generally induction The microbial composite of one or more bacterial species of pulmonary infection (or virus) and comprise the one generally inducing infection of bone Or the microbial composite of various bacteria species (or virus).Equally, for having the colon cancer to pulmonary's transfer, it is possible to use Comprise generally induction colon infections one or more bacterial species (or virus) pathogenic bacteria (or virus) compositions with And comprise the microbial composite of one or more bacterial species (or virus) of generally induction pulmonary infection；For having to bone The carcinoma of prostate of transfer, it is possible to use comprise the cause of one or more bacterial species (or virus) that generally induction prostate infects Characteristic of disease antibacterial (or virus) compositions and comprise the cause of one or more bacterial species (or virus) of generally induction infection of bone Characteristic of disease antibacterial (or virus) compositions.

List below provides preinvasive cancer and their secondary sends out common site non-limiting of (transfer) Example:

Preinvasive cancer is for the common site of transfer

In some embodiments, antigen composition may be used for treatment or the prevention cancer in primary site or for controlling Treat or prevention transfer.Such as, in long-term smoker, antigen composition specific to pulmonary carcinoma (such as comprises and generally induces lung Portion infect one or more bacterial species or the antigenic determinant of virus) may be used for suitably stimulating immune system with defence Cancer development in lung tissue.As another example, the antigen composition of Breast Cancer-Specific (is such as comprised and typically results in The antigenic determinant of one or more bacterial species of intramammary infection) can be used for that there is the strong family history of breast carcinoma or hereditary easy Breast Cancer Prevention in the women of perception.In alternative embodiment, one or more comprising generally induction infection of bone are thin The antigen composition of fungus kind may be used for preventing or treat the Bone tumour in the patient suffering from carcinoma of prostate.Other embodiment party In case, comprise generally one or more bacterial species of induction pulmonary infection or the antigen composition of virus may be used for prevention or Treatment suffers from the pulmonary's transfer in the patient of malignant melanoma.

This document describes various alternative embodiment and the example of the present invention.These embodiments and example are for illustrating , and should not be construed as restriction the scope of the present invention.

Cancer

Major part cancer belongs to three kinds of broad sense histologic classification: cancer (carcinomas), it is main cancer and is upper Chrotoplast or covering organ, body of gland or other body structure (such as, skin, uterus, pulmonary, mammary gland, prostate, stomach, intestinal) Outer surface or the cancer of cell of inner surface, and it tends to transfer；Sarcoma, it is derived from connective tissue or supporting tissue (such as, bone, cartilage, tendon, ligament, fat, muscle)；And haematological tumours, it is derived from bone marrow and lymphoid tissue.Cancer can be Adenocarcinoma (it generally develops in the organ that can secrete or body of gland, such as mammary gland, pulmonary, colon, prostate or bladder), or Can be squamous cell carcinoma (it occurs in squamous epithelial cancer and generally develops in most of region of health).Sarcoma can be Osteosarcoma or osteogenic sarcoma (bone), chondrosarcoma (cartilage), leiomyosarcoma (smooth muscle), rhabdomyosarcoma (skeletal muscle), Mesothelial sarcoma or mesothelioma (the membranaceous internal layer (membranous lining) of body cavity), fibrosarcoma (fibrous tissue), blood vessel Sarcoma or hemangioendothelioma (blood vessel), liposarcoma (fatty tissue), glioma or astrocytoma (find in brain Nerve connective tissue), in myxosarcoma (primary embryonic connective tissue) or chromic fibrous (mesenchymous) or Combination Germinal layer tumor (mixed type connective tissue type).Haematological tumours can be myeloma, and it occurs in the plasma cell of bone marrow；In vain Disorders of blood, it can be " liquid cancers " and the cancer for bone marrow, and can be myelomatosis or myelocytic leukemia (myeloide and granulocytic leukocyte), lymphoid leukemia, Lymphocytic leukemia or lymphoblastic leukemia (lymph sample and lymphatic hemocyte) or polycythemia vera or erythrocytosis (various blood cell products, but red carefully Born of the same parents account for leading)；Or lymphoma, it can be entity tumor and can develop in lymphoid body of gland or tuberosity, and And its Ke Yi is Huo Jinqi or Fei Huojinqi lymphoma.Additionally, there is also mixed type cancer, such as embryo in adenosquamous carcinoma, mixed type Leaf tumor, carcinosarcoma or umbilicus tire cancer.

The cancer named based on primary site can be relevant to histologic classification.Such as, pulmonary carcinoma is usually minicell lung Cancer or nonsmall-cell lung cancer, it can be squamous cell carcinoma, adenocarcinoma or large cell carcinoma；Skin carcinoma is usually basal cell carcinoma, squama Shape cell carcinoma or melanoma.Lymphoma can in the lymph node relevant with head, neck and chest and at abdominal lymph node or Axil or inguinal lymph node occurs.Can use such as by the monitoring of National Cancer Institute, epidemiology and Termination fruit (SEER) information that provided of plan to the determination of the type and stage that carry out cancer and classification, described plan be about The cancer morbidity of the U.S. and the authoritative information source of survival and be recognized in the whole world.SEER plan is collected at present and announces From 14 kinds of cancer registry based on crowd and 3 kinds of cancer morbidities supplementing registration and survival data, cover about 26% American population.Plan is generally collected based on patient demographics data, primary tumor site, histology, diagnostic phases, just Step therapeutic process and the data that important state is followed up a case by regular visits to, and be that the unique aggregate of information based on crowd comes in the U.S. Source, carcinoma stage and the survival rate in each stage when being included in diagnosis.Based on more than the original position of 3,000,000 examples and invasive cancer The information of case is included in SEER data base, and increases by about 170,000 example new case in SEER coverage every year. The sickness rate of SEER plan and survival data may be used for assessing particular cancers site and the survival of the standard in stage.Such as, in order to Guaranteeing optimal comparable group, specific criteria can be selected from data base, including the data diagnosed with precise stage (such as, this paper's In the case of pulmonary carcinoma example, select the time to mate with time limit period with Retrospective review, and select 3B and 4 phase pulmonary carcinoma； And herein by colon cancer example in the case of, same select the time to mate with the time limit in time limit with Retrospective review, and And select the 4th phase colon cancer).

Cancer can also be named based on the organ that it is occurred, i.e. " primary site ", such as breast carcinoma, the brain cancer, pulmonary carcinoma, Hepatocarcinoma, skin carcinoma, carcinoma of prostate, carcinoma of testis, bladder cancer, colorectal carcinoma, cervical cancer, uterus carcinoma etc..Keep this name, even if The another part of the health that cancer metastasis is the most different from primary site.For the present invention, treatment relates to cancer site, is not related to cancer Disease type, in order to be such as positioned at pulmonary any kind of cancer can this localization based on pulmonary and treat.

" cancer " or " tumor " is any less desirable cell growth being not used in physiological function.Generally, cancerous cell is from it just Discharge during often cell division controls, i.e. growth is not affected by the Common biochemical in cellular environment and physics and regulated Cell.Therefore, " cancer " is the upperseat concept of the disease characterized by abnormal uncontrolled cell growth.In most of the cases, Cancer cell multiplication is to be formed as pernicious clone cell.Lump or cell mass, i.e. " tumor " or " tumor " generally can be invaded and broken Bad normal structure around.As used herein, " malignant tumor " refers to have harmful work in having excrescent organism Any cell type or the misgrowth of tissue.Term " malignant tumor " or " cancer " are included in technically for optimum but tool The cell having the risk becoming pernicious grows.Cancerous cell can pass through from their initial site during being referred to as " transfer " Lymphsystem or flow propagation are to the other parts of health.Many cancers are refractory for treatment and prove fatal.Cancer Or the example of tumor includes but not limited to: the conversion in various organ described herein or well known by persons skilled in the art and tissue With the cell of immortalization, tumor, cancer.

" cell " is basic structure and the functional unit of live organism.In higher organisms, such as animal, have similar The cell of 26S Proteasome Structure and Function is generally collected as carrying out " tissue " of specific function.Therefore, tissue includes that similar cell and surrounding are thin The set of intercellular substance, such as epithelial tissue, connective tissue, muscle, nerve." organ " is can be by different types of tissue group The 26S Proteasome Structure and Function unit broken up completely in the higher organisms become, and it is specifically designed for some specific function, such as kidney, the heart Dirty, brain, liver etc..Therefore, " certain organs, tissue or cell " herein is intended to include any specific organ, and wraps Include the cell and tissue found in this organ.

" pathogenic " actor is such as microorganism, such as antibacterial or the actor of virus, and it is known natural in host Induction is infected, and under this implication, " pathogenic " that use in the present invention refers to " native pathogenic ".Although many micro-lifes Thing can induce infection under artificial condition, such as microorganism to the artificial vaccination of tissue, but the microorganism of natural induction infection Scope must be limited and completely set up by medical practice.

" infect " be wherein pathogenic roles thing (such as microorganism, such as antibacterial) invasion health or part thereof of state or Morbid state, described pathogenic roles thing breed under advantage and produce harmful effect (Taber ' s Cyclopedic Medical Dictionary,14th Ed.,C.L.Thomas,Ed.,F.A.Davis Company,PA,USA).Infect generally Can not be clinical dominant, and local cells damage can be only resulted in.If the defense mechanism of health is effective, then feel Dye can keep subclinical and temporary transient.Infection can locally send out to infect or disease as acute, subacute or chronic clinical Diseased state and become clinical dominant.When pathogenic roles thing increases to the entrance of lymph or vascular system, local infection is also (On-Line Medical Dictionary, the http://cancerweb.ncl.ac.uk/omd/) of general can be become. Infect and be generally attended by inflammation, but inflammation can occur in the case of not infecting.

" inflammation " is the typical organization's response (being represented by swelling, rubescent, heating and pain) to damage, and includes working as The consecutive variations within it occurred when hepatic tissue is impaired.Infect and inflammation is different morbid state, although one can be by separately One cause (Taber ' s Cyclopedic Medical Dictionary, ibid).Therefore, inflammation can not infect In the case of occur, and infect can occur in the case of there is no inflammation (although inflammation is generally by pathogenic bacteria or disease The infection of poison causes).Inflammation is characterised by following symptoms: rubescent (rubescent (rubor)), heating (scorching hot), swelling (lump), Pain (bitterly).From the compositions of these symptoms, particularly at the rubescent of site of administration this it appears that local on skin Visible inflammation.

Various individuality can be treated according to the alternative aspect of the present invention.As used herein, " individual " is can be to it Give the specific pathogenic bacteria of the present invention, bacterial antigens, virus, virus antigen or the animal of a combination thereof thing, such as suckling dynamic Thing.Therefore, individuality can be stand cancer or doubtful suffer from cancer or be in the risk of developing cancer under patient, such as people Class.Individuality can be the animal model of laboratory animal, such as cancer, as described in Example 5.In some embodiments, term " individual " and " patient " can alternately use, and can comprise the mankind, non-human mammal, non-human primates move Thing, rat, mice, Canis familiaris L. etc..Healthy individuality can be without by cancer or the most doubtful mankind suffering from cancer or do not stand Chronic disease or the mankind of morbid state." healthy individuals " can also be immunoincompetent individuality.Immunologic inadequacy is Refer to that wherein immune system is with abnormal or that mode plays a role by halves any morbid state.Immune system the most entirely can be with attribution In disease, some drugs or the morbid state existed at birth.Baby, old people with carry out high amount of drug or radiation therapy Individuality in more frequently find immunoincompetent individuality.

" immunne response " includes but not limited in mammal following response one or more: antibody, neutral grain are thin Born of the same parents, mononuclear cell, macrophage (including M1-sample macrophage as herein described and M2-sample macrophage), B cell, T cell The induction of (including helper T cell, natural killer cell, cytotoxic T cell, gamma delta T cells) or activation, such as by giving After giving compositions or vaccine, induced by the antigen in compositions or vaccine or activated.Thus, compositions or vaccine are exempted from Epidemic disease response is typically included in host animal the cell of development and/or antibody-mediated to objective composition or the response of vaccine. In certain embodiments, immunne response is as follows: its will also cause cancer in animal progress slowly or stop.Immunity should Answer and include cellullar immunologic response and humoral immunoresponse(HI), as understood by those skilled in the art.

Antibacterial and bacteria planting and infection

By generally with other organism existed with host animal symbiosis or commensalism, such as antibacterial, in certain journey Field planting major part animal on degree.Therefore, healthy animal finds the antibacterial that many kinds are the most harmless, and is usually located at specific Organ and the surface of tissue.Generally, these antibacterials contribute to the properly functioning of health.Such as, in the mankind, can look in intestinal To the escherichia coli of symbiosis, wherein they promote immunity and reduce the risk of pathogenic infection by bigger toxicity.

The most harmless antibacterial, such as escherichia coli can induce infection in healthy individuals, and result is from slightly To the infection of severe to dead.(that is, induction is infected) that whether antibacterial is pathogenic is somewhat dependent upon following factors, Such as enter and arrive the approach of particular host cell, tissue or organ；The intrinsic toxicity of antibacterial；Exist in latent infection site The amount of antibacterial；Or the health of host animal.Therefore, the most harmless antibacterial can be to infecting under given advantage For pathogenic, and the most most of toxic bacteria needs specific environment to induce infection.Therefore, for normal flora member's Microbial species can be for pathogen when they surmount its normal endogenous effect in endogenous flora.Such as, endogenous Species can such as by send out continuously and outside they Ecological niches dissected in adjacent domain induction infect.When above-mentioned generation Time, these the most harmless endogenous bacteria are considered as pathogenic.

The induction in specific cells, tissue or the organ of other healthy individuals of known specific bacteria species and virus is infected. The antibacterial and the viral example that generally induce infection in the certain organs and tissue of health are listed below: it should be understood that these Example be not intended to be restricted and technical staff based on the knowledge in field shown in the most following disclosure can easily cognitive and Determine induction is infected or generally induction is infected in the various organs and tissue of health adult infectivity or pathogenic bacteria (and And cognition has the relative frequency of infection of each bacterial species): Manual of Clinical Microbiology 8th Edition,Patrick Murray,Ed.,2003,ASM Press American Society for Microbiology, Washington DC,USA；The Principles and Practice of of Mandell, Douglas and Bennett Infectious Diseases 5th Edition,G.L.Mandell,J.E.Bennett,R.Dolin,Eds.,2000, Churchill Livingstone, Philadelphia, PA, USA, all disclosures are incorporated herein by reference.

The infection of skin is generally by following induction: bacterial species: staphylococcus aureus, β Hemolytic streptococcus A, B, C Or G group, diphtheria corynebacterium (Corynebacterium diptheriae), ulcer am (Corynebacterium Or Pseudomonas aeruginosa ulcerans)；Or viral pathogen: Measles virus, rubella virus, varicella zoster virus, angstrom Can virus, Coxsackie virus, adenovirus, virus vaccinicum, herpes simplex virus or assays for parvovirus B 19.

The infection of soft tissue (such as fat and muscle) is generally by following induction: bacterial species: streptococcus pyogenes, golden yellow Staphylococcus, clostridium perfringens or other clostruidium (Clostridium spp.)；Or virosis Substance: influenza virus or Coxsackie virus.

The infection of mammary gland is generally induced by following bacterial species: staphylococcus aureus or streptococcus pyogenes.

The infection of head and neck lymph node is generally by following induction: bacterial species: staphylococcus aureus or streptococcus pyogenes；Or Person's viral pathogen: epstein-Barr virus, cytomegalovirus, adenovirus, Measles virus, rubella virus, herpes simplex disease Poison, Coxsackie virus or varicella zoster virus.

Arm/infection of the lymph node of axil is generally by following induction: bacterial species: staphylococcus aureus or pyogenesis chain Coccus；Or viral pathogen: Measles virus, rubella virus, epstein-Barr virus, cytomegalovirus, adenovirus or chickenpox- Varicella zoster virus.

The infection of mediastinum film lymph node is generally by following induction: bacterial species: viridans streptococci (viridans Streptococci), dyspepsiacoccus (Peptococcus spp.), peptostreptococcus (Peptostreptococcus spp.), Bacteroid (Bacteroides spp.), Fusobacterium (Fusobacterium spp.) or mycobacterium tuberculosis；Or virosis Substance: Measles virus, rubella virus, epstein-Barr virus, cytomegalovirus, varicella zoster virus or adenovirus.

The infection of hilar lymph node is generally by following induction: bacterial species: streptococcus pneumoniae, moraxelle catarrhalis, pneumonia are propped up Substance, Klebsiella pneumonia, hemophilus influenza, Chlamydophila pneumoniae, bordetella pertussis or mycobacterium tuberculosis； Or viral pathogen: influenza virus, adenovirus, rhinovirus, coronavirus, parainfluenza virus, respiratory syncytial virus, people Class stroma lung virus or Coxsackie virus.

The infection of intraabdominal lymph node is generally by following induction: bacterial species: Yersinia enterocolitica, pseudoconcretion are scorching Ademilson bacterium, Salmonella, streptococcus pyogenes, escherichia coli, staphylococcus aureus or mycobacterium tuberculosis；Or virosis Substance；Measles virus, rubella virus, epstein-Barr virus, cytomegalovirus, varicella zoster virus, adenovirus, influenza Virus or Coxsackie virus.

The infection of the lymph node of lower limb/inguinal region is generally by following induction: bacterial species: staphylococcus aureus or wine Streptococcus pyrogenes；Or viral pathogen: Measles virus, rubella virus, epstein-Barr virus, cytomegalovirus or pure bleb Exanthema virus.

The infection (i.e. septicemia) of blood is generally by following induction: bacterial species: staphylococcus aureus, pyogenesis hammer Bacterium, coagulase negative staphylococcus (coagulase-negative staphylococci), enterococcus (Enterococcus Spp.), escherichia coli, klebsiella (Klebsiella spp.), enterobacteria (Enterobacter spp.), Bacillus proteus (Proteus spp.), Pseudomonas aeruginosa, bacteroides fragilis (Bacteroides fragilis), streptococcus pneumoniae or B group Streptococcus；Or viral pathogen: Measles virus, rubella virus, varicella zoster virus, echovirus, Coxsackie disease Poison, adenovirus, epstein-Barr virus, herpes simplex virus or cytomegalovirus.

The infection of bone is generally by following induction: bacterial species: staphylococcus aureus, coagulase negative staphylococcus, wine Streptococcus pyrogenes, streptococcus pneumoniae, streptococcus agalactiae (Streptococcus agalactiae), other streptococcus；Escherichia coli, Pseudomonas, enterobacteria, Bacillus proteus or Serratieae；Or viral pathogen: assays for parvovirus B 19, rubella virus or hepatitis B Virus.

Meningeal infection is generally by following induction: bacterial species: hemophilus influenza, encephalitis diplococcus (Neisseria Meningitidis), streptococcus pneumoniae, streptococcus agalactiae or Listeria monocytogenes；Or viral pathogen: angstrom Can virus, Coxsackie virus, other enterovirus or mumps virus.

The infection of brain is generally by following induction: bacterial species: streptococcus (includes anginosus (S.anginosus), Streptococcus constellatus (S.constellatus), intermediate chain coccus (S.intermedius)), golden yellow Portugal Grape coccus, bacteroid, Prey irrigate bacterium (Prevotella spp.), Bacillus proteus, escherichia coli, klebsiella, false unit cell Bacterium, enterobacteria or Borrelia burgdoyferi；Or viral pathogen: Coxsackie virus, echovirus, poliovirus, its Its enterovirus, mumps virus, herpes simplex virus, varicella zoster virus, arbovirus or Bu Niya Virus.

The infection of spinal cord is generally by following induction: bacterial species: hemophilus influenza, encephalitis diplococcus, pneumonia streptococcus Bacterium, streptococcus agalactiae, Listeria monocytogenes or Borrelia burgdoyferi；Or viral pathogen: Coxsackie virus, Echovirus, poliovirus, other enterovirus, mumps virus, herpes simplex virus, chickenpox-band Shape herpesvirus, arbovirus or Bunyavirus.

The infection of eye/eye socket is generally by following induction: bacterial species: staphylococcus aureus, streptococcus pyogenes, pneumonia Streptococcus, streptococcus milleri (Streptococcus milleri), escherichia coli, Bacillus cereus, chlamydia trachomatis, stream Haemophilus influenza, pseudomonas, klebsiella or Tyreponema pallidum (Treponema pallidum)；Or virus causing disease Body: adenovirus, herpes simplex virus, varicella zoster virus or cytomegalovirus.

The infection of salivary gland is generally by following induction: bacterial species: staphylococcus aureus, viridans streptococci (such as, saliva Liquid streptococcus (Streptococcus salivarius), Streptococcus sanguis (Streptococcus sanguis), Streptococcus mutans (Streptococcus mutans)), peptostreptococcus or bacteroid, or other oral cavity anaerobium；Or viral pathogen: Mumps virus, influenza virus, enterovirus or rabies virus.

The infection in oral cavity is generally by following induction: bacterial species: produces melanotic Prey and irrigates bacterium (Prevotella Melaninogenicus), streptococcus anaerobius (anaerobic streptococci), viridans streptococci, actinomycetes (Actinomyces spp.), peptostreptococcus or bacteroid, or other oral cavity anaerobium；Or viral pathogen: pure Herpesvirus, Coxsackie virus or epstein-Barr virus.

Amygdaline infection is generally by following induction: bacterial species: streptococcus pyogenes or C or G group's hemolytic hammer Bacterium；Or viral pathogen: rhinovirus, influenza virus, coronavirus, adenovirus, parainfluenza virus, respiratory syncytial virus Or herpes simplex virus.

The infection of nasal sinuses is generally by following induction: bacterial species: streptococcus pneumoniae, hemophilus influenza, moraxelle catarrhalis, α-streptococcus, anaerobe (such as Prey irrigates bacterium) or staphylococcus aureus；Or viral pathogen: rhinovirus, influenza virus, Adenovirus or parainfluenza virus.

The infection of nasopharynx is generally by following induction: bacterial species: streptococcus pyogenes or C or G group beta hemolytic streptococcus； Or viral pathogen: rhinovirus, influenza virus, coronavirus, adenovirus, parainfluenza virus, respiratory syncytial virus or Herpes simplex virus.

Thyroid infection is generally by following induction: bacterial species: staphylococcus aureus, streptococcus pyogenes or pneumonia chain Coccus；Or viral pathogen: mumps virus or influenza virus.

The infection of larynx is generally by following induction: mycoplasma pneumoniae, Chlamydophila pneumoniae or streptococcus pyogenes；Or virosis Substance: rhinovirus, influenza virus, parainfluenza virus, adenovirus, coronavirus or Human Meta pneumo virus.

The infection of trachea is generally by following induction: cell species: mycoplasma pneumoniae；Or viral pathogen: parainfluenza virus Poison, influenza virus, respiratory syncytial virus or adenovirus.

Bronchial infection is generally by following induction: mycoplasma pneumoniae, Chlamydophila pneumoniae, bordetella pertussis, Streptococcus pneumoniae or hemophilus influenza；Or viral pathogen: influenza virus, adenovirus, rhinovirus, coronavirus, sidestream Influenza Virus, respiratory syncytial virus, Human Meta pneumo virus or Coxsackie virus.

The infection of pulmonary is generally by following induction: cell species: streptococcus pneumoniae, moraxelle catarrhalis, mycoplasma pneumoniae, lung Scorching klebsiella or hemophilus influenza；Or viral pathogen: influenza virus, adenovirus, respiratory syncytial virus or Parainfluenza virus.

The infection of pleura is generally by following induction: cell species: staphylococcus aureus, streptococcus pyogenes, pneumonia streptococcus Bacterium, hemophilus influenza, bacteroides fragilis, Prey irrigate bacterium, fusobacterium nucleatum (Fusobacterium nucleatum), digestion Streptococcus or mycobacterium tuberculosis；Or viral pathogen: influenza virus, adenovirus, respiratory syncytial virus or parainfluenza Virus.

The infection of mediastinum film is generally by following induction: bacterial species: viridans streptococci, dyspepsiacoccus, peptostreptococcus, plan Bacillus or mycobacterium tuberculosis；Or viral pathogen: Measles virus, rubella virus, epstein-Barr virus or giant cell are sick Poison.

The infection of heart is generally by following induction: bacterial species: streptococcus (includes streptococcus mitis (S.mitior), cattle Streptococcus (S.bovis), Streptococcus sanguis (S.sanguis), Streptococcus mutans (S.mutans), anginosus), intestinal ball Bacterium, staphylococcus (Staphylococcus spp.), diphtheria corynebacterium, bacillus aerogenes capsulatus, encephalitis diplococcus or sand Door Salmonella；Or viral pathogen: enterovirus, Coxsackie virus, echovirus, poliovirus, adenovirus, popular Property mumps virus, Measles virus or influenza virus.

The infection of esophagus is generally by following induction: bacterial species: actinomycetes, Mycobacterium avium, mycobacterium tuberculosis or chain Coccus；Or viral pathogen: cytomegalovirus, herpes simplex virus or varicella zoster virus.

The infection of stomach is generally by following induction: bacterial species: streptococcus pyogenes or helicobacter pylori；Or virosis Substance: cytomegalovirus, herpes simplex virus, epstein-Barr virus, rotavirus, norwalk virus or adenovirus.

The infection of small intestinal is generally by following induction: bacterial species: escherichia coli, clostridium difficile, fragile plan bar Bacterium, bacteroides vulgatus (Bacteroides vulgatus), bacteroides thetaiotaomicron (Bacteroides thetaiotaomicron), Clostridium perfringens, Salmonella enteritidis (Salmonella enteriditis), Yersinia enterocolitica Or shigella flexneri；Or viral pathogen: adenovirus, Astrovirus, Calicivirus, norwalk virus, rotavirus or Cytomegalovirus.

The infection of colon/rectum is generally by following induction: bacterial species: escherichia coli, clostridium difficile, fragility Bacteroid, bacteroides vulgatus, bacteroides thetaiotaomicron, clostridium perfringens, Salmonella enteritidis, enterocolitis Yale Gloomy bacterium or shigella flexneri；Or viral pathogen: adenovirus, Astrovirus, Calicivirus, norwalk virus, colyliform are sick Poison or cytomegalovirus.

The infection of anus is generally by following induction: bacterial species: streptococcus pyogenes, bacteroid, Fusobacterium, anaerobism hammer Bacterium, clostruidium, escherichia coli, enterobacteria, Pseudomonas aeruginosa or Tyreponema pallidum；Or viral pathogen: single Pure property herpesvirus.

The infection of perineum is generally by following induction: bacterial species: escherichia coli, klebsiella, enterobacteria, bacteroid, Clostruidium, Pseudomonas aeruginosa, streptococcus anaerobius, clostruidium or enterobacteria；Or viral pathogen: simple Property herpesvirus.

The infection of liver is generally by following induction: bacterial species: escherichia coli, klebsiella, streptococcus (angina Group), enterococcus, other viridans streptococci or bacteroid；Or viral pathogen: hepatitis A virus (HAV), epstein-Barr virus, simple Property herpesvirus, mumps virus, rubella virus, Measles virus, varicella zoster virus, Coxsackie virus or Adenovirus.

The infection of gallbladder is generally by following induction: bacterial species: escherichia coli, klebsiella, enterobacteria, enterococcus, Bacteroid, Fusobacterium, clostruidium, Salmonella enteritidis, Yersinia enterocolitica or shigella flexneri.

The infection of biliary tract is generally by following induction: bacterial species: escherichia coli, klebsiella, enterobacteria, enterococcus, Bacteroid, Fusobacterium, clostruidium, Salmonella enteritidis, Yersinia enterocolitica or shigella flexneri；Or Viral pathogen: hepatitis A virus (HAV), epstein-Barr virus, herpes simplex virus, mumps virus, rubella virus, Measles virus, varicella zoster virus, Coxsackie virus or adenovirus.

The infection of pancreas is generally by following induction: bacterial species: escherichia coli, klebsiella, enterococcus, false unit cell Bacterium, staphylococcus, mycoplasma (Mycoplasma spp.), salmonella typhi (Salmonella typhi), hook end spiral shell group Or Legionnella；Or viral pathogen: mumps virus, Coxsackie virus, hepatitis B virus, cytomegalovirus, 2 types Herpes simplex virus or varicella zoster virus.

The infection of spleen is generally by following induction: bacterial species: streptococcus, staphylococcus, Salmonella, pseudomonas, Escherichia coli or enterococcus；Or viral pathogen: epstein-Barr virus, cytomegalovirus, adenovirus, Measles virus, rubella Virus, Coxsackie virus or varicella zoster virus.

Adrenal infection is generally by following induction: bacterial species: streptococcus, staphylococcus, Salmonella, false unit cell Bacterium, escherichia coli or enterococcus；Or viral pathogen: varicella zoster virus.

The infection of kidney is generally by following induction: bacterial species: escherichia coli, proteus mirabilis (Proteus Mirabilis), proteus vulgaris (Proteus vulgatus), Providence (Providentia spp.), rub root Salmonella (Morganella spp.), enterococcus faecalis or Pseudomonas aeruginosa；Or viral pathogen: BK virus or the popular cheek Adenitis virus.

The infection of urinary catheter is generally induced by following bacterial species: escherichia coli, proteus mirabilis, proteus vulgaris, Providence, morganella morganii or enterococcus.

The infection of bladder is generally by following induction: bacterial species: escherichia coli, proteus mirabilis, proteus vulgaris, Providence, morganella morganii, enterococcus or Corynebacterium jekeum；Or viral pathogen: adenovirus or Cytomegalovirus.

The infection of peritoneum is generally by following induction: bacterial species: staphylococcus aureus, streptococcus pyogenes, pneumonia streptococcus Bacterium (Streptococcus pneumonia), escherichia coli, klebsiella, Bacillus proteus, enterococcus, bacteroides fragilis, product Melanocyte Prey irrigates bacterium, dyspepsiacoccus, peptostreptococcus, Fusobacterium or clostruidium.

The infection of peritoneum rear region is generally induced by following bacterial species: escherichia coli or staphylococcus aureus.

Prostatic infection is generally by following induction: bacterial species: escherichia coli, klebsiella, enterobacteria, unusual Bacillus proteus, enterococcus, pseudomonas, corynebacterium or gonococcus；Or viral pathogen: herpes simplex disease Poison.

The infection of testis is generally by following induction: bacterial species: escherichia coli, Klebsiella pneumonia, P. aeruginosa Bacterium, staphylococcus, streptococcus or Salmonella enteritidis；Or viral pathogen: mumps virus, Coxsackie virus or Lymphocyte function-associated antigen-1.

The infection of penis is generally by following induction: bacterial species: staphylococcus aureus, streptococcus pyogenes, gonorrhea Neisser Salmonella or Tyreponema pallidum；Or viral pathogen: herpes simplex virus.

The infection of ovary/adnexa is generally by following induction: bacterial species: gonococcus, chlamydia trachomatis, vagina add Moral is received Salmonella (Gardenerella vaginalis), Prey and is irrigated bacterium, bacteroid, dyspepsiacoccus, streptococcus or escherichia coli.

The infection in uterus is generally induced by following bacterial species: gonococcus, chlamydia trachomatis, vagina Gardnerella Bacterium, Prey irrigate bacterium, bacteroid, dyspepsiacoccus, streptococcus or escherichia coli.

The infection of cervix uteri is generally by following induction: bacterial species: the close spiral of gonococcus, chlamydia trachomatis or syphilis Body；Or viral pathogen: herpes simplex virus.

The infection of vagina is generally by following induction: bacterial species: Gardnerella vaginalis, Prey irrigate bacterium, bacteroid, digestion Coccus, escherichia coli, gonococcus, chlamydia trachomatis or Tyreponema pallidum；Or viral pathogen: herpes simplex Virus.

The infection of pudendum is generally by following induction: bacterial species: the close spiral shell of staphylococcus aureus, streptococcus pyogenes or syphilis Rotation body；Or viral pathogen: herpes simplex virus.

Bacterial strain/virus subtype

It will be understood by those skilled in the art that by bacterial species (it generally relates to for the set that is operationally categorized as approximating bacterial strain And there is confirmable physiology difference but generally not there is morphology difference speculate flora of the same clan, and described difference can Determine to use the serological technique of directed toward bacteria surface antigen).Therefore, each bacterial species (such as, streptococcus pneumoniae) Having many bacterial strains (or serotype), it inducing different in the ability infected or can induce certain organs/site at them Infection ability on different.Such as, despite the presence of the serotype of at least 90 kinds of streptococcus pneumoniae, but as the pneumonia of the mankind The reason of streptococcus disease, most commonly serotype 1,3,4,7,8 and 12.

As the second example, certain bacterial strain colibacillary of the most parenteral Escherichia coli (ExPEC) is more likely Induction urinary tract infection or other Extra intestinal infection, such as, neonatal meningitis, and other bacterial strain, including enterotoxigenic E.Coli (ETEC) enteropathogenic escherichia (EPEC), enterohemorrhagic Escherichia coli (EHEC), the escherichia coli of generation shiga toxin, are caused (STEC), enteroaggrerative E.coli (EAEC), intestinal invasive escherichia coli (EIEC) and diffusion adhesiveness escherichia coli (DAEC), alimentary infection/diarrhoea is more likely induced.Even among ExPEC bacterial strain subclass, specific virulence factor (such as, 1 The generation of type pili) some bacterial strain can be made more likely to induce the infection of bladder, and other virulence factor (such as, product of P pili Raw) other bacterial strain can be made more likely to induce the infection in kidney.According to the present invention it is possible to select more likely to induce the sense in bladder The ExPEC bacterial strain of dye is for the preparation of targeting bladder cancer, and can select more likely to induce the ExPEC bacterium of the infection in kidney Strain is for the preparation of targeting renal carcinoma.It is also possible to select large intestine bar ETEC, EPEC, EHEC, STEC, EAEC, EIEC or In DAEC bacterial strain (that is, inducing the bacterial strain of colon inflammation), one or more are for the preparation for the treatment of colon cancer.

It is also possible to there is the hypotype of substantial amounts of specific virus.Such as, there is the influenza virus of three types, i.e. A type Influenza virus, Influenza B virus and influenza virus C, they are different in epidemiology, host range and Clinical symptoms.Example As, influenza A virus is more likely relevant with viral pulmonary infection, and more likely scorching with muscle (that is, the flesh of Influenza B virus Voluptuousness contaminates) relevant.Additionally, each of influenza virus of these three type has many hypotypes, its can also epidemiology, Host range is different with Clinical symptoms aspect.According to the present invention it is possible to select the influenza A the most relevant with pulmonary infection sick Poison hypotype is with lung cancer-targeted, and the influenza B virus strain the most relevant to muscle inflammation can be selected to treat muscle/soft tissue Cancer.

It should be understood that the Clinical microorganism scholar of this area thus can based on the disclosure and with the bacterium of each bacterial species Strain (with the virus subtype of the virus of each type) relevant main knowledge, selects bacterial strain (or the specific disease of specific bacteria species The hypotype of poison) with targeting certain organs or tissue.

Bacteria composition, dosage and administration

The compositions of the present invention is included in particular organization or organ as pathogenic invasive organism (antibacterial or disease Poison) antigen of species.Compositions can include full bacterial species, maybe can comprise the extraction of the pathogenic bacteria species of the present invention Thing or preparation, such as cell wall and cell membrane extract, or full cell, or extracellular toxin, or cell and extracellular toxin entirely.Compositions is also One or more antigens separated from the pathogenic bacteria species of one or more present invention can be comprised；Some embodiment party In case, such compositions can be used for wherein may must accurately giving the specific antigen of given dose, or the thinnest giving it In the case of born of the same parents' species or component (such as, toxin) may be harmful to, described compositions can be used.Pathogenic bacteria species can be (such as from ATCC (Manassas, VA, USA)) being purchased, can be maybe to infect (such as lung from the antibacterial suffering from tissue or organ Scorching) individuality be clinically separated.

Can be acceptable at liposome, adjuvant or any medicine to be suitable for the form being administered to mammal, the such as mankind Carrier in the presence of, the microbial composite of the present invention be provided separately, or with other compound (such as, nucleic acid molecules, little point Son, peptide or peptide analogues) combination offer.As used herein, " pharmaceutically acceptable carrier " or " excipient " include arbitrarily and institute The solvent of promising physiological compatible, disperse medium, coating, antibacterial and antifungal, isotonic agent and absorption delaying agent etc..Carrier Can be adapted to the administration of any appropriate format, including administration, intravenous administration, parenteral, intraperitoneal in subcutaneous administration, skin It is administered or oral administration in administration, intramuscular adminstration, sublingual administration, inhalation, tumor.Pharmaceutically acceptable carrier include for The aseptic aqueous solution of the extemporaneous preparation of sterile injectable solution or dispersion liquid or dispersion liquid and sterilized powder.By this kind of medium and Reagent is well known in the art for pharmaceutically active substance.Unless any conventional media or reagent and reactive compound (that is, this Bright specific bacteria, bacterial antigens or a combination thereof thing) incompatible, then its purposes in the present compositions is intended. Supplementary active compounds can also be incorporated to compositions.

If desired, with the treatment of the bacterial antigens of the present invention can with multiple routine and the existing therapy for cancer, The compositionss such as such as chemotherapy, radiation therapy, surgical operation, or with any be intended to stimulating immune system, reduce inflammation or Otherwise make the individual other therapies (such as nutrient, vitamin and supplement) be benefited combination.Such as can also be to individual Body gives microorganism A, vitamin D, vitamin E, vitamin C, compound vitamin B, selenium, zinc, coenzyme Q10, bata-carotene, fish Oil, curcumin, green tea, bromelain, resveratrol, linseed meal, Bulbus Allii, lycopene, Herba Silybi mariani, melatonin, other resist Oxidant, cimetidine, indomethacin or cox 2 inhibitor (such as, Celebrex^TM[celecoxib] or Vioxx^TM[Rofe Former times cloth]).

Conventional pharmaceutical practice can be used to provide suitable preparation or compositions, thus give to the individuality standing cancer Compound.Can use the suitable approach of administration, such as parenteral, intravenous administration, intradermal administration, subcutaneous administration, Give in administration, sheath in administration, spinal column in administration in intramuscular adminstration, intracranial administration, socket of the eye, dosing eyes, intraventricular administration, capsule Administration, Sublingual in administration in medicine, brain pond, Intraperitoneal medication, intranasal administration, inhalation, Aerosol administration, topical, tumor It is administered or oral administration.Treatment preparation can be the form of liquid solution or suspension；For oral administration, preparation can be sheet Agent or the form of capsule；For Intradermal preparation, for powder, nose drop or aerocolloidal form；And for sublingual formulation, for dripping The form of agent, aerosol or capsule.

This area for prepare the known method of preparation such as " Remington ' s Pharmaceutical Sciences " (the 20th edition), ed.A.Gennaro, 2000, Mack Publishing Company, Easton, PA obtain. Formulations for parenteral administration can such as comprise excipient, sterilized water or saline, poly alkylene glycol such as Polyethylene Glycol, The oil of plant origin, or the naphthalene of hydrogenation.Biocompatibility, biodegradable lactide polymer, lactide/glycolides copolymerization Thing or Pluronic F127 may be used for controlling the release of compound.Other parenteral that may use Delivery system includes vinyl-vinyl acetate copolymer granule, osmotic pumps, implantable infusion system and liposome.For sucking Preparation can comprise excipient such as lactose, can be maybe to comprise such as polyoxyethylene-9-Laurel ether, glycocholate and deoxidation gallbladder The aqueous solution of hydrochlorate, can be maybe the oily liquids for administration of nose drop form or gel form.For treatment or prevention Compositions, according to disease, gives pathogenic bacteria species with effective dose to individuality, thus stops or slowing down the progress of cancer or turn Move, or increase individual survival (relative to such as from the prognosis of SEER data base).

The invasive organism species of the present invention or " effective dose " of its antigen include therapeutically effective amount or prevention effective dose. " therapeutically effective amount " refers in necessary dosage the amount continuing effectively to realize under the necessary time period required therapeutic outcome, described Therapeutic effect such as reduces or eliminates cancerous cell or tumor, prevention oncogenic process, slows down tumor growth or increase above and make use-case Time-to-live as desired by SEER data base.The effective dose of invasive organism (antibacterial or virus) species or its antigen is permissible Cause according to such as individual morbid state, age, sex and weight and compound individual required response ability because of Element and change.Dosage can be regulated to provide optimal treatment response.Therapeutically effective amount can also be for wherein treating useful effect Fruit is better than any pathogenic bacteria species or virus or the toxicity of their antigen or the amount of illeffects." prevention effective dose " is Refer to that described preventive effect is the most pre-in necessary dosage the amount continuing effectively to realize under the necessary time period required prevention result Anti-cancer, prevention transfer, slow down tumor growth, cancerous cell, tissue, organ or tumor or increase above is reduced or eliminated makes With the time-to-live desired by such as SEER data base.Generally, before cancer or at initial stage of cancer, individuality uses prevention Dosage, in order to prevention effective dose can be less than therapeutically effective amount.

For the administration by subcutaneous or intradermal, treatment or the prevention of one or more pathogenic bacteria species have The exemplary range of effect amount can be about 1 million to 1 hundred billion organism of every ml, can be maybe 1 hundred million to 70 hundred million biology of every ml Body, can be maybe 5 hundred million to 60 hundred million organisms of every ml, can be maybe 10 hundred million to 50 hundred million organisms of every ml, can be maybe every 20 hundred million to 40 hundred million organisms of ml, or the arbitrary integer in the range of these.The total concentration of every ml antibacterial can be every ml 100 Ten thousand to 1 hundred billion organisms, can be maybe 5,000 ten thousand to 70 hundred million organisms of every ml, or every 1 hundred million to 60 hundred million organism of ml, Can be maybe 5 hundred million to 50 hundred million organisms of every ml, can be maybe 10 hundred million to 40 hundred million organisms of every ml, or in the range of these Arbitrary integer.The antigen of pathogenic bacteria species treatment or prevention effective dose may range from 0.1nM to 0.1M, 0.1nM To 0.05M, 0.05nM to 15 μMs or the arbitrary integer of 0.01nM to 10 μM.

It should be noted that dose concentration and scope can become with the seriousness of morbid state to be alleviated, or can be with Individual immunne response and become.Generally, target is to realize sufficient immunne response.For being given by subcutaneous or intradermal Medicine, it may be determined that the degree of immunne response, such as by the size (example of the delay local immunity skin response in injection site As, diameter is from 0.25 inch to 4 inch).The required dosage realizing suitable immunne response can be according to individual (and they exempt from Epidemic disease system) and required response and become.Normalized dose can also be used.In the case of subcutaneous or intradermal administration, if Target is to realize the local skin response of 2 inches, then total bacteria composition dosage can for example, 2,000,000 antibacterials (such as, The vaccine of 0.001ml, its concentration is 2,000,000,000 organisms of every ml) to more than 20,000,000,000 antibacterials (vaccine of such as 1ml, its concentration For 20,000,000,000 organisms of every ml).It is also conceivable to the individual bacterial species in compositions or the concentration of its antigen.Such as, If in vaccine, a kind of specific concentration of pathogenic bacteria species, the cell size of these species or its antigenic load relative to Other pathogenic bacteria species are higher, then individual local immunity skin response may be owing to it to these specific bacteria species Response.In some embodiments, individual immune system can to a kind of bacterial species in vaccine than another kind more Strongly, the history of past illness being exposed to the infection of specific species is such as depended on, then can correspondingly regulate dosage for this individuality Or compositions.But, in embodiments more detailed in this article, immunne response will not be monitored by skin response.Such as, In mouse models more used herein, the effectively treatment of this kind of animal with antigen composition may be not resulted in correspondingly Skin response.Compared with the presence or absence that it will be understood by those skilled in the art that and depend on skin response, exist and can monitor The alternative way of immunne response.

For particular individual, can according to individual need with use or the professional judgement of the personnel that instruct compositions to be administered, The arrangement of time of adjustment for the treatment of in time and dosage (such as arrangement of time can be every day, every other day, weekly, monthly). Such as, in the case of subcutaneous or intradermal administration, compositions can every other day be given.Subcutaneous can give about 0.05ml's Predose, the most every other day increases 0.01-0.02ml, (such as, exists until giving sufficient skin response in injection site The most rubescent delayed response of the diameter of injection site 1 inch to 2 inches).Once realize the immunne response of this abundance, this agent Amount can continue as maintenance dose.Can often regulate maintenance dose to realize obvious skin needed for injection site Response (inflammation).Administration can continue for example, at least 1 week, 2 weeks, 2 months, 6 months, 1 year, 2 years, 3 years, 4 years or 5 years or longer The administration persistent period of time.

Oral cavity dosage can be administered 1,000 ten thousand to 1 trillion organisms the most every time, including one or more species Antigenic determinant.Can specify that oral dose, the most four times a day, daily or weekly.Administration can continue the most extremely Few 1 week, 2 weeks, 2 months, 6 months, 1 year, 2 years, 3 years, 4 years or 5 years or the administration persistent period of longer time.

In some embodiments, the present invention can comprise sublingual administration or by the antigen composition of inhalation, or Person is simultaneously or sequentially to one or more epithelial tissue (that is, percutaneous drug delivery by intradermal or subcutaneous injection；By suction Pulmonary epithelial is administered；By oral ingestion, gastrointestinal mucosa is administered；By sublingual administration, oral mucosa is administered) antigen that gives Compositions.Therefore, in some embodiments, the antigen composition of the present invention is given to cause immunne response at epithelial tissue. In some embodiments, one or more epithelium approach of administration can be with one or more other approach, such as being administered In tumor, administration, intramuscular adminstration or intravenous administration combine.

In each aspect of the present invention, the antigen composition given to patient can be characterized by that antigen is signed, i.e. foot Think the combination of specific antigen or epi-position, in order to it is that specific immunity should that antigen composition can cause special pathogen Answer, such as adaptive immune response.Astonishing and the unexpected aspect of the present invention is to be combined by these specific antigens The non-habitual of the immunne response of thing mediation or specific activation are effectively treated and be located therein special pathogen is pathogenic Cancer in tissue.

Route of administration as herein described and dosage range are only and illustrate, and be not intended to can by medical practitioner select to Medicine approach and dosage range.Reactive compound in the composition (such as, pathogenic bacteria species or virus or theirs is anti- Former) amount can change according to the factor of such as individual morbid state, age, sex and weight.Dosage side can be regulated Case is to provide optimal treatment response.For example, it is possible to give single pill, some separate dosage can be given in time, or Can proportional reduction or increase dosage, as treatment situation the state of emergency shown in.Can advantageously join with dosage unit form Parenteral composi processed is for the convenience being administered and dose uniformity.

In the case of antigen preparation (similar with vaccine), can be provided separately or with other compound and immunological adjuvants Combination provides the immune effective dose of the compounds of this invention.Compound can also be with carrier molecule, such as bovine serum albumin or key Hole relative hemocyanin connects to increase immunogenicity.Antigen composition (" vaccine ") is the material comprising and causing required immunne response Compositions.Antigen composition can select, activates or extend, but is not limited to: immune memory B, T cell, neutral grain Cell, mononuclear cell or macrophage, thus such as reduce or eliminate cancerous cell or the growth of tissue or propagation.Implement at some In scheme, the specific pathogenetic microorganism of the present invention, virus, virus antigen, antibacterial, bacterial antigens or combinations thereof thing energy In office cause required immunne response in the case of what its reagent is non-existent, and be thus considered antigen composition. In some embodiments, antigen composition includes suitable carrier, such as adjuvant, and it is for play a role with non specific manner To increase specific antigen or the reagent of the immunne response of antigen group, the antigenic quality in any given vaccine is administered can be made Reduce, or make needed for generation the dose frequency required for immunne response reduce.Bacterial antigens compositions can comprise and can induce For generally the most relevant with antibacterial antigenic determinant immunne response work or the antibacterial of death.In some embodiments, Antigen composition can comprise and has less toxic strain (decay) and thus induce the antibacterial of work of the most serious infection. In some embodiments, antigen composition can comprise and can induce exempting from for the usual antigenic determinant relevant with virus The work of epidemic disease response, decay or the virus of death.

Can prepare as follows and kill the antigen composition of antibacterial for comprising of being administered by injection.Antibacterial can closed Suitable culture medium grows, and washs with physiological solt solution.It is then possible to centrifuged bacterial, in settling flux saline solution again, and use Heat is killed.Can be counted by direct microcosmic, mix with aequum, and store in appropriate containers and make suspension standard Change, the safety of described suspension, storage life and aseptic can be tested in the way of accreditation.Except pathogenic bacteria species And/or its antigen, be suitable to administered to humans kill phenol preservative and/or 0.9% chlorination that antibacterial can comprise 0.4% Sodium.Bacterial vaccine can also comprise the brain heart infusion (cattle) of trace, peptone, yeast extract, agar, Sanguis caprae seu ovis, dextrose, phosphorus Acid sodium and/or other media components.

In some embodiments, bacterial vaccine can use in the form of tablets or capsules, or for oral ingestion Drop and use, for suck aerosol and use, or for sublingual administration drop, aerosol or tablet form and Use.

Specific bacteria species in the antigen composition comprising antibacterial, in the compositions of Sublingual or intradermal Concentration can be about 1 million to 1 hundred billion organism of every ml, can be maybe 1 hundred million to 70 hundred million organism of every ml, or permissible For 5 hundred million to 60 hundred million organisms of every ml, can be maybe 10 hundred million to 50 hundred million organisms of every ml, can be maybe every ml 2,000,000,000 to 4000000000 organisms, or the arbitrary integer in the range of these.The antibacterial total concentration of every ml can be every ml 1 million to 1 hundred billion Individual organism, can be maybe 5,000 ten thousand to 70 hundred million organisms of every ml, or every 1 hundred million to 60 hundred million organism of ml, can be maybe every 5 hundred million to 50 hundred million organisms of ml, can be maybe 10 hundred million to 40 hundred million organisms of every ml, or the arbitrary integer in the range of these.

In some embodiments, selected killing bacterial vaccine and will include common antibacterial lung for lung tissue cancer Portion's pathogen, and can be for example:

Or:

In embodiments selected by some, selected killing bacterial vaccine and will only include more conventional for lung tissue cancer Antibacterial pulmonary pathogen, and can be for example:

Or:

In embodiment selected by other, selected killing bacterial vaccine and will only include most common for lung tissue cancer Antibacterial pulmonary pathogen, and can be:

Or

Or

In some embodiments, for the micro-life of antigen in specific site (such as, the cancer of lung tissue) treatment cancer Compositions can include generally, more generally or most commonly at this tissue or organ induce and infect (such as, in the sense of lung tissue Dye, i.e. pneumonia) invasive organism.

Generally, pathogenic bacteria species and the antigen thereof of the present invention should in the case of not inducing toxicity, be used.This The toxicity of the compound of invention can use standard method to measure, such as by surveying in cell culture or laboratory animal Examination, and measure therapeutic index, i.e. LD50 (population to 50% is fatefulue dosage) and the LD100 (population to 100% For fatefulue dosage) between ratio.

In some respects, the present invention includes that anti-inflammatory agent is together with vaccinated purposes.In these embodiments, permissible Use anti-inflammatory therapy widely, including the nonsteroidal antiinflammatory medicine (NSAID) of effective dose, include but not limited to: double chlorine Fragrant acid potassium, diclofenac sodium, etodolac, indomethacin, ketorolac tromethamine, sulindac, tolmetin sodium, celecoxib, Meloxicam, Valdecoxib, fluorine Kui ammonia phenyl ester, mefenamic acid, nabumetone, meloxicam, piroxicam, tenoxicam, non-promise Ibuprofen calcium, flurbiprofen, ibuprofen, ketone ibuprofen, naproxen, naproxen sodium, oxaprozin, tiaprofenic acid, acetyl salicylic Acid, diflunisal, Choline magnesium trisalicylate, choline salicylate, trolamine salicylate, COX1 inhibitor, COX2 inhibitor (example As, Vioxx^TMAnd Celebrex^TM).Multiple herbaceous plant and natural health products can be used for providing anti-inflammatory therapy, bag Include but be not limited to: green tea, fish oil, vitamin D, antioxidant vitamins and (such as, B carotene, vitamin A, the dimension life of anti-material Element C, vitamin D, vitamin E, coenzyme Q10, selenium etc.), resveratrol, Rhizoma Curcumae Longae, bromelain, Olibanum, feverfew, pavilion skin Element, Rhizoma Zingiberis Recens, Herba Rosmarini Officinalis, Adeps Bovis seu Bubali, Fructus Capsici, Flos Caryophylli, Semen Myristicae, Willow bark.Alternative anti-inflammatory form also includes lifestyle change, Such as: move, lose weight, give up smoking, pressure is dredged, seek social support, depressed treatment, stress management, abdominal respiration method (, use non-burn food, including having omega-3 fatty acid for example with Mediterranean diet, low glycemic diet with changes in diet Food).

As detailed herein and in one aspect of the invention, it is provided that the method for relative immunity response.Described method includes There is the medicine of antigen composition as herein defined to the animal with organ or tissue.Described antigen composition can To have antigenic determinant, select or prepare described antigenic determinant so that described antigenic determinant is together in organ or group In knitting at least one pathogenic microbial pathogens be specific, from described organ or tissue extract can quantify immunity sample Product, measure the feature of immunne response in the described organ or tissue that can quantify in immune sample after giving medicine, and By the feature of the described immunne response quantifying immunity sample and the reference immunity sample obtained from corresponding organ or tissue The individual features of immunne response compares.As used herein, immunity sample will comprise the biomaterial of abundance to measure immunity The feature of response.As used herein, " feature " of immunne response can include but not limited to the certain immune cells type of specified quantitative (such as macrophage) or specific cells labelling (such as, the rise of integrin) or gene outcome (such as, cytokine).Aforementioned For example and the most infinite.

Optionally, the corresponding organ from animal or tissue can obtain before giving the step of medicine with reference to immunity sample ?.On the other hand, can obtain with reference to immunity sample from the correspondingly organ or tissue of the second animal, so that it specifically wraps Include: at least two animal (that is, reference sample available from animal and can quantify immunity sample available from the second animal) can use In method described herein.Optionally, animal can have the cancer being positioned at organ or tissue.

The feature of relative immunity response can be included in and can quantify and compare appointing in following cell with reference in immunity sample One or more digital indication (because these cells are known to the skilled person): struvite mononuclear cell, huge Phagocyte, CD11b+Gr-1+ cell, dendritic cell, CD11c+MHC II+ class cell, CD4+T cell, CD8+T cell or NK Cell.Optionally, macrophage can include following in any one or more: M1-sample macrophage or M2-sample huge bite thin Born of the same parents.

Those skilled in the art will recognize that macrophage can be defined as " M1-sample macrophage " or " M2-sample is huge to be bitten carefully Born of the same parents ".Such as, M1-sample macrophage is generally readily appreciated by one skilled in the art as promoting response cell-mediated for Th1CD4+T (see, e.g. Biswas and Mantovani (2010), Nature Immunology 10:889-96).Bite additionally, M1-sample is huge Cell is generally understood as having antigen presentation capability effectively, and is proficient in and kills intracellular pathogen (such as, virus).Additionally, M1-sample macrophage is generally understood as at least compared with M2-sample macrophage, is proficient in terms of tumor destruction and plays immunity work With.Those skilled in the art will recognize that and there is the biomarker that can use of many with at M1-sample macrophage with M2-sample is huge bites Difference is produced between cell.Such as and as described herein, compared with M2-sample macrophage, the expression of Nos2 generally quilt It is interpreted as associating with M1-sample macrophage and (see, e.g. Laskin et al. (2010) Annual Rev.Pharmacol.Toxicol.51:267-288).In addition and such as, M1-sample macrophage is generally understood as producing IL-12 and by IFN-γ effectively activated by IFN-γ R (Biswas and Mantovain, ibid).

Contrary with M1-sample macrophage, those skilled in the art are that M2-sample macrophage promotes by be generally understood that Response cell-mediated for Th2CD4+T (sees, usually: Biswas and Mantovani (2010), Nature Immunology 10:889-96).Additionally, M2-sample macrophage is generally understood as effectively, and encapsulation and scavenger cell epizoa etc..This Outer and compared with M1-sample macrophage, M2-sample macrophage is generally readily appreciated by one skilled in the art as T_regThin with B Born of the same parents play in terms of immunomodulating more obvious action (Biswas and Mantovain, ibid).Those skilled in the art it should be appreciated that To there is many biomarkers that can use to produce difference between M2-sample macrophage and M1-sample macrophage.The most also And institute is as herein described, compared with the more high expressed being generally found in M1-sample macrophage, the expression weakened of Nos2 will be logical Often it is understood and associates with M2-sample macrophage.In addition being expressly incorporated herein what experiment was described in detail, the expression of CD206 is generally understood as Associate with M2-sample macrophage and (see, e.g. Choi et al. (2010) Gastroenterology 138 (7) 2399- 409).In addition describing in detail and as tested herein, the expression of F4/80 is generally understood as associating with M2-sample macrophage.This Outward and such as, M2-sample macrophage is generally understood as effectively being activated by IL-4 or by IL-13 by IL-4R α (Biswas and Mantovain, ibid).

Additionally, the feature of relative immunity response can include the change comparing macrophage activation state.Macrophage activation The change of state can optionally be characterized as from M2-sample macrophage to change of M1-sample macrophage or vice versa.This area skill Art personnel will be appreciated that and there is many biomarkers that can use to monitor the activation of macrophage.As described herein, originally Skilled person it should be understood that and is defined as macrophage being activated to M1-sample phenotype or M2-sample phenotype, and this can pass through The labelling of each phenotypic correlation known and as herein described is selected to complete.Relevant to M1 and M2 macrophage disease includes The most following: atherosclerosis (see, e.g. Hirata et al. (2011) J.Am.Coll.Cardiol.58 (3): 248-255), allergic asthma (see, e.g. Moreira and Hogaboam (2011) J.Interferon.Cytokine , autoimmune prostatitis (see, e.g. Zhang and Schluesener (2011) Res.31 (6): 485-91) Prostate), colitis (see, e.g. Waddell et al. (2011) J.Immunol.186 (10): 5993-6003), COPD (see, e.g., Kunz et al. (2011) Respir.Res.22:34), glomerulonephritis (see, e.g., , inflammatory enteritis (see, e.g., Fujita et al. (2010) Am.J.Pathol.177 (3): 1143-54) , chronic pneumonia (see, e.g., Wendelsdorf et al. (2010) J.Theor.Biol.264 (4): 1225-39) , fat hepatitis (see, e.g., Rensen Redente et al. (2010) J.Leukoc.BIol.88 (1): 159-68) , pancreatitis (see, e.g., Gea-Sorli and Closa et al. (2009) Am.J.Pathol.175 (4): 1473-82) (2009) BMC Immunol.31:42), myocarditis (see, e.g., Li et al. (2009) Circ.Res.105 (4): 353- 64), hepatic fibrosis (see, e.g., Heymann et al. (2009) Inflamm.Allergy Drug Targets 8 (4): 307-18), Cystic fibrosis (see, e.g., Meyer et al. (2009) Am.J.Respir.Cell Mol.Biol.41 (5): 590-602), struvite nephritis (see, e.g., Wang et al. (2007) Kidney Int.72 (3): 290-299) And pneumosilicosis (see, e.g., Misson et al. (2004) J.Leukoc.Biol.76 (5): 926-232).

Optionally, the feature of relative immunity response can be included in can quantify and with reference to immunity sample in determine following carefully Cell marking (because described cell is generally readily appreciated by one skilled in the art) in any one or more in born of the same parents: struvite Mononuclear cell, macrophage, CD11b+Gr-1+ cell, dendritic cell, CD11c+MHC II+ class cell, CD4+T cell, CD8+T cell or NK cell.Macrophage can include following in any one or more: M1-sample macrophage or M2-sample are huge Phagocyte.Those skilled in the art will recognize that and there is the cell marking (cell that can determine that immunne response that many can select Outer and intracellular).In addition being expressly incorporated herein and described in detail, the expression of CD206 is generally understood as associating with M2-sample macrophage (see, e.g. Choi et al. (2010) Gastroenterology 138 (7) 2399-409).

Optionally, the feature of relative immunity response can be included in can quantify and with reference to immunity sample in determine by following carefully The cell marking (because described cell is generally readily appreciated by one skilled in the art) that any one or more in born of the same parents produces: inflammation Property mononuclear cell, macrophage, CD11b+Gr-1+ cell, dendritic cell, CD11c+MHC II+ class cell, CD4+T cell, CD8+ T cell or NK cell.Those skilled in the art will recognize that cytokine refers to minicell signal conductive protein molecule also And there is cytokine how known in the art.Such as, cytokine have been based on they effects in immunne response and It is categorized as 1 type and the classification of 2 types.Common 1 cytokines includes IFN-γ and TGF-β.Common 2 cytokines include but It is not limited to IL-4 and IL-13.Cytokine can be measured by many methods well known by persons skilled in the art.Such as and such as In greater detail herein, ELISA experiment produces (see, e.g. Figure 27) for measuring the cytokine from lung tissue.

As described in text, macrophage can include following in any one or more: as herein defined M1-sample is huge Phagocyte or M2-sample macrophage.Optionally, cytokine is produced due to the change in the activated state of macrophage.Optionally Ground, macrophage is changed to M1-sample macrophage from M2-sample macrophage.In addition and optionally, macrophage is huge from M1-sample Phagocyte is changed to M2-sample macrophage.

Optionally, the feature of relative immunity response can be included in can quantify and with reference to immunity sample in determine by following carefully The differential gene expression (because described cell is generally readily appreciated by one skilled in the art) that any one or more in born of the same parents produces: Struvite mononuclear cell, macrophage, CD11b+Gr-1+ cell, dendritic cell, CD11c+MHC II+ class cell, CD4+T Cell, CD8+T cell or NK cell.Macrophage can include following in any one or more: M1-sample macrophage or M2-sample macrophage.Term " differential gene expression " is understood to mean that the target from least two experiment condition is specific Considerable difference between gene expression.Such as, if under the first experiment condition, specific gene has the expression water determined Flat, the gene expression method as used by those skilled in the art is defined, and if under the second experiment condition, identical Gene there is on its expression considerable difference, then there is the differential expression of target gene.Those skilled in the art should Understand and there is the method that many can be used for detecting differential gene expression.Such as, as herein in terms of the relative Nos2/Arg1 of mensuration compares Described in detail, it is possible to use commercially available quantization round pcr (see, e.g. Figure 29).Optionally, due to the activation of macrophage Change in state and produce differential gene expression.Optionally, those terms as herein defined, macrophage can be from M2- Sample macrophage is changed to M1-sample macrophage.

In another embodiment, can be within the administration persistent period at least one week, with the administration of a hour to month The successive doses that interval gives, gives described medicine at site of administration.It is optionally possible to Intradermal or subcutaneous give described medicine. It is optionally possible to effectively induce the dosage of obvious local inflammation immunne response to give with every dose at site of administration State medicine.It is optionally possible to give described medicine, in order at site of administration, obvious local inflammation occurred in 1 to 48 hour. However, it will be apparent that local inflammation immunne response may not be normally present in all situations, although immunne response has begun to.This Skilled person it should be understood that and there is other method that can be used for monitoring the immunne response being gradually increased.Such as, can will be from Stand the individual immunocyte spectrum (with the relative change characterized) of immunne response with from the individuality not standing immunne response Those immunocytes spectrum compares.

In addition and optionally for method disclosed herein, animal can be mammal.Optionally, animal can be The mankind or mice.Aforementioned with strength form provide and be not intended to be restricted.

On the other hand, it is provided that the treatment preparation of the cancer in selecting the certain organs being suitable to treat individuality or organizing Method.Described method includes providing the animal suffering from the cancer being positioned at certain organs or tissue；It is micro-that offer has one or more The test formulation of the antigenic determinant of bio-pathogen, described microbial pathogens is in the respective specific organ of healthy individuals or group For pathogenic in knitting；Measure the spy with reference to the immunne response immunity sample that the organ or tissue from described animal obtains Levy；Test formulation is given to described animal；Measure the quantified immunity sample that corresponding organ or tissue from described animal obtain The feature of immunne response；The feature of the immunne response comparing reference and can quantify in immunity sample；And process with reference exempt from The feature of the increase of the immunne response of the quantified immunity sample that epidemic disease sample is compared is using as the test formulation as treatment preparation Suitability indication.Optionally, before acquisition can quantify immunity sample, described animal is put to death.

Optionally, the feature of relative immunity response can be included in and can quantify and compare following cell in immunity sample In the number tag of any one or more (because described cell be generally readily appreciated by one skilled in the art): struvite monokaryon Cell, macrophage, CD11b+Gr-1+ cell, dendritic cell, CD11c+MHC II+ class cell, CD4+T cell, CD8+T Cell or NK cell.Optionally, macrophage can include following in any one or more: M1-sample macrophage or M2-sample Macrophage, as herein defined those terms.Optionally, the feature of relative immunity response can include comparing macrophage The change of activated state.Optionally, macrophage can be changed to M1-sample macrophage from M2-sample macrophage.In addition and appoint Selection of land, macrophage can be changed to M2-sample macrophage from M1-sample macrophage.

Optionally, the feature of relative immunity response can be included in can quantify and with reference to immunity sample in determine following carefully Cell marking (because they are generally readily appreciated by one skilled in the art) in any one or more in born of the same parents: struvite monokaryon Cell, macrophage, CD11b+Gr-1+ cell, dendritic cell, CD11c+MHC II+ class cell, CD4+T cell, CD8+T Cell or NK cell.Optionally, macrophage can include following in any one or more: M1-sample macrophage or M2-sample Macrophage, as herein defined those terms.

Optionally, the feature of relative immunity response can be included in can quantify and with reference to immunity sample in determine by following carefully The cytokine that any one or more in born of the same parents produces: struvite mononuclear cell, macrophage, CD11b+Gr-1+ cell, dendron Shape cell, CD11c+MHC II+ class cell, CD4+T cell, CD8+T cell or NK cell.Macrophage can include following in Any one or more: M1-sample macrophage or M2-sample macrophage, those terms as herein defined.Optionally, by Cytokine is produced in the change of activated state of macrophage.Optionally, macrophage can change from M2-sample macrophage For M1-sample macrophage.

In addition and optionally, the feature of relative immunity response can be included in can quantify and with reference to immunity sample determines by The differential gene expression that any one or more in following cell produces: struvite mononuclear cell, macrophage, CD11b+Gr-1 + cell, dendritic cell, CD11c+MHC II+ class cell, CD4+T cell, CD8+T cell or NK cell.Optionally, huge bite Cell can include following in any one or more: M1-sample macrophage or M2-sample macrophage, as herein defined Those terms.Optionally, differential gene expression can be produced due to the change of activated state of macrophage.Optionally, huge bite Cell can be changed to M1-sample macrophage from M2-sample macrophage.In addition and optionally, macrophage can be huge from M1-sample Phagocyte is changed to M2-sample macrophage.

On the other hand, it is provided that in human individual, selectivity targeting is to cancerous tissue or the side of the immunne response of organ Method.Described method includes the medicine to described individuality with the microbial pathogens antigen composition of effective dose, Qi Zhongsuo Stating microbial pathogens can be pathogenic in the particular cancer organ or tissue of described individuality, and described antigen composition Included in together is specific antigenic determinant to microbial pathogens.Optionally, antigen composition can comprise entirely go out thin Bacterium cell composition.It is optionally possible to described individuality effectively to raise immunne response in individual cancer organ or tissue Dosage and persistent period give described medicine.Optionally, described method can also include the feature measuring immunne response.

On the other hand, it is provided that for the method treating the cancer being positioned at tissue or organ of human individual.Described side Method includes the microbial pathogens antigen comprising the bacterial cell composition that entirely the goes out combination to described individuality with effective dose For pathogenic in the medicine of thing, individual certain organs that wherein said microbial pathogens is positioned in described cancer or tissue 's.Described medicine can be given with amount and the persistent period of effectively regulation immunne response to described individuality.Optionally, immunity should The regulation answered can include the change of the activated state of macrophage.Optionally, the regulation of immunne response can include from M2-sample huge Phagocyte response is to the change of M-1 sample macrophage response.The regulation of immunne response can include from M1-sample macrophage response Change to M-2 sample macrophage response.Optionally, described method can also include the feature measuring immunne response.

Optionally, the feature of relative immunity response can be included in and can quantify and compare following cell in immunity sample In the number tag of any one or more (because described cell be generally readily appreciated by one skilled in the art): struvite monokaryon Cell, macrophage, CD11b+Gr-1+ cell, dendritic cell, CD11c+MHC II+ class cell, CD4+T cell, CD8+T Cell or NK cell.Optionally, macrophage can include following in any one or more: M1-sample macrophage or M2-sample Macrophage, as herein defined those terms.Optionally, the feature of relative immunity response can include comparing macrophage The change of activated state.In addition and optionally, macrophage can be changed to M1-sample macrophage from M2-sample macrophage.Appoint Selection of land, macrophage can be changed to M2-sample macrophage from M1-sample macrophage.

In addition and optionally, the feature of relative immunity response can be included in and can quantify and determine in immunity sample Cell marking (because they are generally readily appreciated by one skilled in the art) in any one or more in following cell: scorching Disease property mononuclear cell, macrophage, CD11b+Gr-1+ cell, dendritic cell, CD11c+MHC II+ class cell, CD4+T are thin Born of the same parents, CD8+T cell or NK cell.Macrophage can include following in any one or more: M1-sample macrophage or M2- Sample macrophage, as herein defined those terms.Optionally, the feature of relative immunity response can be included in can quantify and With reference to immunity sample determining, the cell marking produced by any one or more in following cell is (because they are generally by ability Field technique personnel understood): struvite mononuclear cell, macrophage, CD11b+Gr-1+ cell, dendritic cell, CD11c+ MHC II+ class cell, CD4+T cell, CD8+T cell or NK cell.Optionally, macrophage can include following in arbitrary Plant or multiple: M1-sample macrophage or M2-sample macrophage.Additionally, due to the change of the activated state of macrophage and permissible Produce cytokine.Macrophage can be changed to M1-sample macrophage from M2-sample macrophage.Optionally, macrophage can To be changed to M2-sample macrophage from M1-sample macrophage.

In addition and optionally, the feature of relative immunity response can be included in and can quantify and determine in immunity sample The differential gene expression produced by any one or more in following cell is (because they are generally managed by those skilled in the art Solve): struvite mononuclear cell, macrophage, CD11b+Gr-1+ cell, dendritic cell, CD11c+MHC II+ class cell, CD4+T cell, CD8+T cell or NK cell.Macrophage can include following in any one or more: M1-sample is huge bites thin Born of the same parents or M2-sample macrophage.Optionally, differential gene expression can be produced due to the change of activated state of macrophage.This Outer and optionally, macrophage can be changed to M1-sample macrophage from M2-sample macrophage.Macrophage can be from M1-sample Macrophage is changed to M2-sample macrophage.

On the other hand, it is provided that in the individuality of monitoring therapeutic scheme cancer in being just treated certain organs or tissue The method of usefulness.Described method is measured from certain organs or group after being included in the individual therapeutic scheme having carried out a period of time Knit the feature of immunne response of the rear treatment immunity sample of acquisition, wherein than the immunity not carried out desired by the individuality of therapeutic scheme Response feature compares the indication of the usefulness existing for therapeutic scheme of immunne response feature bigger in magnitude；Control described in and Treatment scheme includes that the preparation of one or more antigenic determinants comprising microbial pathogens, described microbial pathogens exist The corresponding certain organs of healthy individuals or tissue are pathogenic.

Method detailed in this article also includes the feature measuring pre-treatment with reference to the immunne response of sample, wherein said pre-treatment With reference to sample before therapeutic scheme starts, simultaneously or after but after acquisition before treatment immunity sample from certain organs or Tissue obtains, and the feature of the immunne response of relatively pre-treatment and rear treatment sample, wherein with pre-treatment with reference to compared with sample The indication of the usefulness increasing to therapeutic scheme of the magnitude of the immunne response of rear treatment immunity sample.Optionally, measuring immunity should The feature answered can include measuring the indication of struvite amount of mononuclear cells in the sample of organ or tissue.Optionally, measurement is exempted from The feature of epidemic disease response can include measuring the indication of macrophage quantity in the sample of organ or tissue.Macrophage can include Any one or more in following: M1-sample macrophage or M2-sample macrophage.

Optionally, the feature of measurement immunne response can include the CD11b+Gr-1+ measuring in the sample of organ or tissue The indication of the dendritic cell quantity in the indication of the quantity of cell, or the sample of mensuration organ or tissue.In addition the most optionally Ground, the feature measuring immunne response can include measuring CD11c+MHC II+ class cell quantity in the sample of organ or tissue Indication, or measure in the sample of organ or tissue the indication of CD4+T cell quantity, or measure in organ or tissue The indication of CD8+T cell quantity in sample.

Optionally, measure the magnitude of immunne response and can include measuring the finger of NK cell quantity in the sample of organ or tissue Levy.In addition and optionally, the feature of relative immunity response determines at following cell in can being included in reference and immunity sample In any one or more on cell marking (because described cell be generally readily appreciated by one skilled in the art): struvite list Nucleus, macrophage, CD11b+Gr-1+ cell, dendritic cell, CD11c+MHC II+ class cell, CD4+T cell, CD8+ T cell or NK cell.Optionally, macrophage can include following in any one or more: M1-sample macrophage or M2- Sample macrophage.

In addition and optionally, the feature of relative immunity response determines by following in can being included in reference and immunity sample The cytokine (because described cell is generally readily appreciated by one skilled in the art) that any one or more in cell produces: scorching Disease property mononuclear cell, macrophage, CD11b+Gr-1+ cell, dendritic cell, CD11c+MHC II+ class cell, CD4+T are thin Born of the same parents, CD8+T cell or NK cell.Macrophage can include following in any one or more: M1-sample macrophage or M2- Sample macrophage.Optionally, cytokine can be produced due to the change of activated state of macrophage.Macrophage can be from M2-sample macrophage is changed to M1-sample macrophage.In addition and optionally, macrophage can change from M1-sample macrophage For M2-sample macrophage.

Optionally, the feature of relative immunity response determines by following cell in can being included in reference and immunity sample Any one or more differential gene expression produced (because described cell is generally readily appreciated by one skilled in the art): struvite Mononuclear cell, macrophage, CD11b+Gr-1+ cell, dendritic cell, CD11c+MHC II+ class cell, CD4+T cell, CD8+T cell or NK cell.Macrophage can include following in any one or more: M1-sample macrophage or M2-sample are huge Phagocyte.Differential gene expression can be produced due to the change of activated state of macrophage.Macrophage can be huge from M2-sample Phagocyte is changed to M1-sample macrophage.Optionally, macrophage can be changed to from M1-sample macrophage that M2-sample is huge to be bitten Cell.

In every respect, the method that embodiment of the present invention relate to treating the cancer being positioned at individual pulmonary.Described method bag Include to described individuality give effective dose in pulmonary for the antigen of pathogenic one or more microbial species, and to institute State the chemotherapeutant that individuality gives the platiniferous of effective dose.Microbial species can be viral pathogen or bacterial pathogens or true Bacterium pathogen.

As used herein, wording " treatment cancer " can include but not limited to reduce the lung tumor load in individuality or increase Suffers from the individual life expectancy of pulmonary carcinoma.It should be understood that and there is the biological reading machine that many those skilled in the art can use Structure is to measure whether cancer is treated.

Viral pathogen used herein includes but not limited to: influenza virus, adenovirus, respiratory syncytial virus, pair Influenza virus, monkeypox, herpes simplex virus (1 type and 2 types), varicella zoster virus, cytomegalovirus, Ai-bar Er Shi Virus, coronavirus, Human Meta pneumo virus, Hendra virus, Nipah virus, Hantaan virus, Lassa fever virus, mankind T-are thin Born of the same parents' lymphotrophic virus, Coxsackie virus, ECHO virus, enterovirus or rhinovirus, or be pathogenic any disease in pulmonary Poison.

Bacterial pathogens used herein can be but be not limited to: streptococcus pneumoniae, moraxelle catarrhalis, mycoplasma pneumoniae, Klebsiella pneumonia, hemophilus influenza, staphylococcus aureus, Chlamydia pneumoniae, bacillus legionnaires,pneumophila or pertussis are rich Dai Shi bacillus, or be pathogenic any antibacterial in pulmonary.

Fungal pathogens used herein can be but be not limited to: Aspergillus fumigatus, blastomyces, coccidioides immitis, Coccidiodes Posadasii, Cryptococcus histolyticus, lattice spy cryptococcus, Fusarium spp., Histoplasma capsulatum, Paecilomyces varioti, Paracoccidioides brasiliensis, Penicillium Marneffei, Ye Shi lung pityrosporion ovale, Bo Yide puppet Allescheriasis, Scedosporium apiospermum, rhizopus, mucormycosis, plough Mould, Cunninghamella sp, many births match many spores, stachybotrys chartarum, long shoot Trichoderma spp., many pityrosporion ovales, or be pathogenic in pulmonary Any fungus.

As used herein, term " chemotherapeutant of platiniferous " includes but not limited to: cisplatin, carboplatin or ormaplatin, difficult to understand husky Profit platinum, DWA2114R ((-)-(R)-2 aminomethyl pyrrolidine (1,1-cyclobutane dicarboxylic acid is closed) platinum), zeniplatin, enloplatin, happy Ba Bo, CI-973 (SP-43 (R)-l, l-Tetramethylene .-dicarboxylic acids closes (2-)-(2-methyl-l, 4-65 butanediamine-N, N') platinum), 254-S nedaplatin, JM-216 (double-acetyl conjunction-amine-two chloro-cyclo-hexylamine platinum (IV)) (see: Weiss, R.B. and Christian,M.C.,“New Cisplatin Analogue in Development,”Drugs.46: (03)360-377 (1993))；CPA) 2Pt [DOLYM] and (DACH) Pt [DOLYM] cisplatin (Choi et al., Arch.Pharmacal Res.22 (2):151-156,1999)；254-S cisplatin analogues (Koga et al., Neurol.Res.18 (3): 244-247,1996)； Cis-l, 4-diamino-cyclohexane cisplatin analogues (Shamsuddin et al., J.Inorg.Biochem.61 (4): 291- 301,1996)；MeOH cisplatin (Shamsuddin et al., Inorg.Chem.36 (25): 59695971,1997)；CI-973 Cisplatin analogues (Yang etal.Int.J.Oncol.5 (3): 597-602,1994)；Cis-diamminedichloroplatinum (II) and class thereof Like the cis-l of thing, l-cyclobutane dicarboxylic acid closes (2R) 2-methyl-l, 4-butane diamine platinum (II) and cis-diamidogen (glycolic conjunction) Platinum (Claycamp&Zimbrick, J.Inorg.Biochem.26 (4): 257-67,1986；Fan et al.Cancer Res.48(11):3135-9,1988；Heiger-Bernays et al.Biochemistry 29(36):8461-6,1990； Kikkawa et al.,J.Exp.Clin.Cancer Res.12(4):233-40,1993；Murray et al.Biochemistry 31(47):11812-17,1992；Takahashi et al.,Cancer Chemother.Pharmacol.33 (l): 31-5,1993), together with-diphosphonic acid cisplatin analogues (FR 2683529), containing grappling The cisplatin analogues (Hartwig et al., J.Am.Chem.Soc.114 (21): 8292-3,1992) of dansyl, amino alkane The cisplatin analogues (Kitov et al., Eur.J.Med.Chem.23 (4): 381-3,1988) that base amino anthraquinones is derivative, along spiral shell Platinum, carboplatin, iproplatin and JM40 platinum analogs (Schroyen et al., Eur.J.Cancer Clin.Oncol.24 (8): 1309-12,1988) and JM8 and JM9 cisplatin analogues (Harstrick et al., Int.J.Androl.10 (1)；139- 45,1987)。

On the other hand, it is provided that the making at the antigen that pulmonary is one or more pathogenic microbial species of effective dose With, thus the medicine that the chemotherapeutant with platiniferous being formulated for the individual pulmonary carcinoma for the treatment of is used together.On the other hand, carry For effective dose at the antigen that pulmonary is one or more pathogenic microbial species, to contain with in greater detail herein The chemotherapeutant of platinum is used together the pulmonary carcinoma treating individuality.Microbial species can be viral pathogen or bacterial pathogens Or fungal pathogens, as described herein.

On the other hand, it is provided that effective dose at the antigen that pulmonary is one or more pathogenic microbial species, from And the medicine that the chemotherapeutant with platiniferous being formulated for the individual pulmonary carcinoma for the treatment of is used together.On the other hand, it is provided that have Effect amount at the antigen that pulmonary is one or more pathogenic microbial species, with the Chemo-Therapy with platiniferous in greater detail herein Treat agent and be used together the pulmonary carcinoma treating individuality.Microbial species can be viral pathogen or bacterial pathogens or mycosis Substance, as described herein.The chemotherapeutant of platiniferous can be but be not limited to: cisplatin, carboplatin or oxaliplatin.

On the other hand, it is provided that test kit.Described test kit is included in pulmonary as one or more pathogenic micro-lifes The antigen of thing species, the chemotherapeutant of platiniferous；And the chemotherapeutant of this antigen and platiniferous is provided to patient in need Description.Microbial species can be viral pathogen or bacterial pathogens or fungal pathogens, as described herein.

In every respect, embodiment of the present invention relate to the combination comprising the organism component that can induce gastrointestinal infection Thing, in order to organism can be characterized as pathogen.But, can seldom induce disease for pathogenic organism in some cases Sick.By generally with other organism existed with host animal symbiosis or commensalism, such as antibacterial, determining to a certain extent Plant major part animal.Therefore, find in healthy animal and many plant the most harmless antibacterial, and be usually located at certain organs and The surface of tissue.Generally, these antibacterials contribute to the properly functioning of health.Such as, in the mankind, symbiosis can be found in intestinal Escherichia coli, wherein they promote immunity and reduce by the risk of more fatal pathogenic infection.

The most harmless antibacterial, such as escherichia coli can induce infection in healthy individuals, and result is from slightly To severe infection to dead.(that is, induction is infected) that whether organism such as antibacterial is pathogenic is somewhat dependent upon down Row factor, such as, enter and arrive the approach of particular host cell, tissue or organ；The intrinsic toxicity of antibacterial；At latent infection The amount of the antibacterial that site exists；Or the health of host animal.Therefore, the most harmless biological physical ability is given to infecting It is pathogenic under advantage, and even toxic biological body can need specific environment to induce infection.Therefore, for normally The organism of flora member can be for pathogen when they surmount its normal endogenous effect in endogenous flora.Such as, Endogenous species can such as by send out continuously and outside they Ecological niches dissected in adjacent domain induction infect.When this Time raw, and in the present invention, these the most harmless endogenous biological bodies are considered as pathogenic.

The specific known healthy individuals at other of organism, such as bacterial species, virus, anthelmintic and protozoacide In the specific region of GIT, induction is infected.The example of the organism generally infected in the induction of the specific region of GIT is listed below；Should Be understood by these examples to be not intended to be restricted, and technical staff such as based on such as by shown in following disclosure about spy Determine the knowledge of patients, by can be easily cognitive and determine that induction is infected or logical in the various regions of the GIT of health adult Infectivity that often induction is infected or pathogenic bacteria, described in be disclosed as: Manual of Clinical Microbiology 8th Edition,Patrick Murray,Ed.,2003,ASM Press American Society for Microbiology, Washington DC,USA；The Principles and Practice of of Mandell, Douglas and Bennett Infectious Diseases, the 5th edition, G.L.Mandell, J.E.Bennett, R.Dolin, Eds., 2000, Churchill Livingstone, Philadelphia, PA, USA, all disclosures are incorporated herein by reference.

The infection in oral cavity is generally by following induction: bacterial species: produces melanotic Prey and irrigates bacterium, streptococcus anaerobius, green chain Coccus, actinomycetes, peptostreptococcus or bacteroid, or other oral cavity anaerobium；Or viral pathogen: herpes simplex disease Poison, Coxsackie virus or epstein-Barr virus.

The infection of esophagus is generally by following induction: bacterial species: actinomycetes, Mycobacterium avium, mycobacterium tuberculosis or chain Coccus；Or viral pathogen: cytomegalovirus, herpes simplex virus or varicella zoster virus.

The infection of stomach is generally by following induction: bacterial species: streptococcus pyogenes or helicobacter pylori；Or virosis Substance: cytomegalovirus, herpes simplex virus, epstein-Barr virus, rotavirus, norwalk virus or adenovirus.

The infection of small intestinal is generally by following induction: bacterial species: escherichia coli, clostridium difficile, fragile plan bar Bacterium, bacteroides vulgatus, bacteroides thetaiotaomicron, clostridium perfringens, Salmonella enteritidis, Yersinia enterocolitica Or shigella flexneri；Or viral pathogen: adenovirus, Astrovirus, Calicivirus, norwalk virus, rotavirus or Cytomegalovirus.

The infection of colon/rectum is generally by following induction: bacterial species: escherichia coli, clostridium difficile, fragility Bacteroid, bacteroides vulgatus, bacteroides thetaiotaomicron, clostridium perfringens, Salmonella enteritidis, enterocolitis Yale Gloomy bacterium or shigella flexneri；Or viral pathogen: adenovirus, Astrovirus, Calicivirus, norwalk virus, colyliform are sick Poison or cytomegalovirus.

The infection of anus is generally by following induction: bacterial species: streptococcus pyogenes, bacteroid, Fusobacterium, anaerobism hammer Bacterium, clostruidium, escherichia coli, enterobacteria, Pseudomonas aeruginosa or Tyreponema pallidum；Or viral pathogen: single Pure property herpesvirus.

Organism such as antibacterial the most operationally be categorized as approximate bacterial strain set (it is usually directed to have confirmable life Neo-Confucianism is distinguished but is not generally had the flora that the supposition of morphology difference has common ancestry, and described difference can use directed toward bacteria table The serological technique of face antigen and determine).Therefore, each bacterial species (such as, escherichia coli) has many bacterial strains (or serum Type), they can be different or different in the ability of the infection in they induction certain organs/sites in the ability that induction is infected. Some bacterial strain colibacillary more likely induces alimentary infection/diarrhoea, including enterotoxigenic E.Coli (ETEC), cause enteropathic Escherichia coli (EPEC), enterohemorrhagic Escherichia coli (EHEC), to produce the escherichia coli (STEC) of shiga toxin, intestinal aggregation big Enterobacteria (EAEC), intestinal invasive escherichia coli (EIEC) and diffusion adhesiveness escherichia coli (DAEC).According to the present invention it is possible to Select in ETEC, EPEC, EHEC, STEC, EAEC, EIEC or DAEC bacterial strain (that is, inducing the bacterial strain of colon inflammation) of large intestine bar One or more are for the preparation for the treatment of IBD.

It is also possible to there is specific virus, anthelmintic or protozoacide many hypotypes, its relevant to specific crowd and by This is suitable for purposes in the present invention.

The compositions of the present invention is included in the specific region of GIT the antigen for pathogenic organism.Compositions is permissible Comprise full organism, full cell or totivirus body component, maybe can comprise extract or the preparation of organism, such as cell wall or Cell membrane extract or extracellular toxin.Compositions can also comprise one or more antigens separated from these organisms.Pathogenic Microorganism can be (such as from American Type Culture Collection, Manassas, VA, USA) being purchased, Can be maybe from the individual clinical isolates suffering from infection.

Can be acceptable at liposome, adjuvant or any medicine to be suitable for the form being administered to mammal, the such as mankind Carrier in the presence of, the compositions of the present invention that be derived from pathogen is provided separately, or (such as, nucleic acid divides with other compound Molecule, little, peptide or peptide analogues) combination offer.As used herein, " pharmaceutically acceptable carrier " or " excipient " include appointing Meaning and all solvents for physiological compatible, disperse medium, coating, antibacterial and antifungal, isotonic agent and absorption delaying agent Deng.Carrier can be adapted to the administration of any appropriate format, gives including administration in subcutaneous administration, skin, intravenous administration, parenteral It is administered or oral administration in medicine, Intraperitoneal medication, intramuscular adminstration, sublingual administration, inhalation, tumor.Pharmaceutically acceptable load Body includes for sterile injectable solution or the aseptic aqueous solution of the extemporaneous preparation of dispersion liquid or dispersion liquid and sterilized powder.Will This kind of medium and reagent are well known in the art for pharmaceutically active substance.Unless any conventional media or reagent and activation Compound (that is, the specific bacteria of the present invention, bacterial antigens or a combination thereof thing) is incompatible, then it is pre-for the compositions of the present invention Phase.Supplementary active compounds can also be incorporated to compositions.

This area for prepare the known method of preparation such as " Remington ' s Pharmaceutical Sciences " (20th edition), ed.A.Gennaro, 2000, Mack Publishing Company, in Easton, PA Obtain.Formulations for parenteral administration can such as comprise excipient, sterilized water or saline, the most poly-second of poly alkylene glycol Glycol, the oil of plant origin, or the naphthalene of hydrogenation.Biocompatibility, biodegradable lactide polymer, lactide/second is handed over Ester copolymer or Pluronic F127 may be used for controlling the release of compound.Other may use Parenteral delivery system includes vinyl-vinyl acetate copolymer granule, osmotic pumps, implantable infusion system and liposome.With In suck preparation can comprise excipient such as lactose, can be maybe comprise such as polyoxyethylene-9-Laurel ether, glycocholate and The aqueous solution of dexycholate, can be maybe the oily liquids for administration of nose drop form or gel form.For treatment Or prevention compositions, the amount individuality mutually can being in progress effectively to stop or slowing down IBD gives preparation.

The pathogenic species of the present invention or " effective dose " of its antigen include therapeutically effective amount or prevention effective dose." treatment Effective dose " refer in necessary dosage the amount continuing effectively to realize under the necessary time period required therapeutic outcome, described treatment Effect such as reduces or eliminates the symptom of IBD.The effective dose of invasive organism species or its antigen can be according to such as individual Morbid state, age, sex and weight and compound cause the factor of ability of individual required response to change.Permissible Regulation dosage is to provide optimal treatment response.Therapeutically effective amount can also exceed any causing a disease for wherein treatment beneficial effect Property species or the toxicity of its antigen or the amount of illeffects." prevention effective dose " refer to necessary dosage and continue necessity time Between effectively realize the amount of required prevention result under section, described preventive effect such as prevents IBD.Generally, before IBD or at IBD At the initial stage, individuality uses preventive dose, in order to prevention effective dose can be less than therapeutically effective amount.

For the administration by subcutaneous or intradermal, treatment or the prevention of one or more pathogenic bacteria species have The exemplary range of effect amount can be about 1 million to 1 hundred billion organism of every ml, can be maybe 1 million to 70 hundred million life of every ml Object, can be maybe 5 hundred million to 60 hundred million organisms of every ml, can be maybe 10 hundred million to 50 hundred million organisms of every ml, can be maybe Every 20 hundred million to 40 hundred million organisms of ml, or the arbitrary integer in the range of these.The antibacterial total concentration of every ml can be every ml 1 million to 1 hundred billion organism, can be maybe 5,000 ten thousand to 70 hundred million organisms of every ml, or every 1 hundred million to 60 hundred million biology of ml Body, can be maybe 5 hundred million to 50 hundred million organisms of every ml, can be maybe 10 hundred million to 40 hundred million organisms of every ml, or these scopes Interior arbitrary integer.The antigen of pathogenic bacteria species treatment or prevention effective dose may range from 0.1nM to 0.1nM, 0.05nM to 15 μM or the arbitrary integer of 0.01nM to 10 μM.

It should be noted that dose concentration and scope can become with the seriousness of morbid state to be alleviated, or can be with Individual immunne response and become.Generally, target is to realize sufficient immunne response.For being given by subcutaneous or intradermal Medicine, it may be determined that the degree of immunne response, such as by the size (example of the delay local immunity skin response in injection site As, diameter is from 0.25 inch to 4 inch).The required dosage realizing suitable immunne response can be according to individual (and they exempt from Epidemic disease system) and required response and become.Normalized dose can also be used.

In the case of subcutaneous or intradermal administration, if target is the local skin using bacteria composition to realize 2 inches Skin response, then total amount can for example, 2,000,000 antibacterials (such as, the vaccine of 0.001 ml, its concentration is 2,000,000,000 lifes of every ml Object) to more than 20,000,000,000 antibacterials (such as, the vaccine of 1ml, its concentration is 20,000,000,000 organisms of every ml).It is also conceivable to Individual bacterial species in compositions or the concentration of its antigen.Such as, if in vaccine, a kind of specific pathogenic bacteria species Higher relative to other pathogenic bacteria species, the then individual local of concentration, the cell size of these species or its antigenic load Immunity skin response may be owing to its response to these specific bacteria species.In certain embodiments, individual siberian crabapple System can be more more intensive than another kind of to a kind of bacterial species in vaccine, such as, depend on being exposed to the infection of specific species History of past illness, then can correspondingly regulate dosage or compositions for this individuality.

For particular individual, can according to individual need with use or the professional judgement of the personnel that instruct compositions to be administered, The arrangement of time of adjustment for the treatment of in time and dosage (such as arrangement of time can be every day, every other day, weekly, monthly). Such as, in the case of subcutaneous or intradermal administration, compositions can every other day be given.Subcutaneous can give about 0.05ml's Predose, the most every other day increases 0.01-0.02ml, (such as, exists until giving sufficient skin response in injection site The most rubescent delayed response of the diameter of injection site 1 inch to 2 inches).Once realize the immunne response of this abundance, this agent Amount can continue as maintenance dose.Can often regulate maintenance dose to realize obvious skin needed for injection site Skin response (inflammation).Administration can continue for example, at least 2 weeks, 2 months, 6 months, 1 year, 2 years, 3 years, 4 years or 5 years or longer time Between the administration persistent period.

In some embodiments, the present invention can include being resisted to one or more epithelial tissue by non-enteric approach Former compositions.Such as, by intradermal or subcutaneous injection for skin；By suction for lung epithelial.Therefore, at some In embodiment, give the antigen composition of the present invention to cause immunne response in the non-intestinal tissue of such as epithelial tissue.? In some embodiments, one or more non-enteric approach of administration can be with one or more other approach, the such as tumors being administered Interior administration, intramuscular adminstration or intravenous administration combine.

In each aspect of the present invention, the antigen composition given to patient can be characterized by that antigen is signed, i.e. foot Think the combination of specific antigen or epi-position, in order to it is that specific immunity should that antigen composition can cause special pathogen Answer, such as adaptive immune response.

Reactive compound in the present compositions (such as, bacterial species, virus, protozoacide or parasite, or Their antigen) amount can change according to the factor of such as individual morbid state, age, sex and weight.Can adjust Joint dosage is to provide optimal treatment response.For example, it is possible to give single pill, some separate dose can be given in time Amount, or can proportional reduction or increase dosage, as treatment situation the state of emergency shown in.Can be advantageously with dosage unit Form preparation parenteral composi is for the convenience being administered and dose uniformity.

In the case of antigen preparation (being similar to vaccine), can be provided separately or with other compound and immunological adjuvants Combination provides the immune effective dose of the compound of the present invention.Compound can also with carrier molecule, such as bovine serum albumin or Keyhole limpet hemocyanin connects to increase immunogenicity.Antigen composition (" vaccine ") is the material comprising and causing required immunne response The compositions of material.Antigen composition can select, activate or extend immune memory B, T cell, neutrophilic granulocyte, monokaryon Cell or macrophage, thus such as reduce or eliminate the symptom of IBD.In some embodiments, the specificity of the present invention causes Characteristic of disease microorganism, virus, virus antigen, antibacterial, bacterial antigens or combinations thereof thing energy what its reagent in office are non-existent In the case of cause required immunne response, and be thus considered antigen composition.In some embodiments, antigen group Compound includes suitable carrier, such as adjuvant, and it is for playing a role to increase specific antigen or antigen with non specific manner The reagent of immunne response of group, can make the antigenic quality in any given vaccine is administered reduce, or exempts from needed for making generation Dose frequency required for epidemic disease response reduces.Bacterial antigens compositions can comprise to induce and resist for the most relevant with antibacterial The work of the immunne response of former determiner or the antibacterial of death.In some embodiments, antigen composition can comprise and has Less toxic strain (decay) also thus induces the antibacterial of work of the most serious infection.In some embodiments, antigen Compositions can comprise that can induce the work of the immunne response for the usual antigenic determinant relevant with virus, decay or dead The virus died.

Can prepare as follows and kill the antigen composition of organism for comprising of being administered by injection.Organism is permissible Suitable culture medium grows, and washs with physiological solt solution.It is then possible to centrifugal organism, it is resuspended in saline solution, And kill by heat.Can be counted by direct microcosmic, mix with aequum, and store in appropriate containers and make suspension Liquid standardization, can test the safety of described suspension, storage life and aseptic in the way of accreditation.Except organism and/ Or its antigen, be suitable to administered to humans kill preparation and can include phenol preservative (such as 0.4%) and/or sodium chloride (example Such as from about 0.9%).Compositions can also comprise the brain heart infusion (cattle) of trace, peptone, yeast extract, agar, Sanguis caprae seu ovis, the right side Rotation sugar, sodium phosphate and/or other media components.

In some embodiments, antigen composition can serve as inhalant aerosol.

Generally, the compositions of the present invention should be used in the case of not inducing toxicity.The poison of the compound of the present invention Property standard method can be used to measure, such as by testing in cell culture or laboratory animal, and measure treatment and refer to Number, i.e. LD50 (population to 50% is fatefulue dosage) and LD100 (population to 100% is fatefulue dosage) it Between ratio.

In some embodiments, the antibacterial for the endogenous flora member of the specific region of GIT may be used for preparation originally The antigen composition of invention.The ranks of table 1 go out many bacterial species and can be formed endogenous together with biotic district, each of which species A part for property flora.Such as, the member of weary bacteria (Abiotrophia spp.) the usually endogenous flora in oral cavity.

Table 1: the common flora of human bacterial (endogenous bacteria human pathogen)

Endogenous microbes flora such as antibacterial is for pathogeny, by sending out continuously or bacteremia is sent out and arrived Tissue.Under advantage, all endogenous biological physical abilitys become pathogenic, and local invades and by sending out continuously Send out to neighbouring tissue and organ.The endogenous bacteria flora of skin, oral cavity and colon is interpreted to can be used for bacterium blood The species that disease is sent out.The tissue that thus can be able to send out these antibacterials for the antibacterial of specific endogenous flora territory member or In organ, induction is infected.Therefore, an aspect of of the present present invention include endogenous microbes pathogen treatment be positioned at endogenous bacteria can The purposes of the Symptomatic IBD of tool in the GIT region of infection is induced to send out.The row of table 2 list the territory of endogenous flora.Table 2 Ranks go out the GIT region that IBD may be located at.Therefore, an aspect of of the present present invention includes that endogenous microbes pathogen is prepared Antigen composition or selection have the existing preparation of pathogen and are positioned at pathogen for treatment and can send out and induce infection The purposes of the IBD in GIT region.Therefore, in alternative embodiment, for disease in the region that the first row of table 2 is listed IBD can be with comprising the treatment of antigen composition that microbial pathogens is specific antigenic determinant, described microorganism Pathogen is the member of the endogenous flora in one or more endogenous flora territories that the first row of table 2 is listed, and by The suitably X in row or check mark represents.

Table 2: the tissue/organ of endogenous flora is pathogenic

Tissue/organ site	Oral cavity	Stomach	Duodenum/jejunum	Ileum	Colon
						Oral cavity	x
Tonsil	x
						Nasopharynx/hole	x
Esophagus		x
						Stomach		x
Small intestinal			x	x
						Colon/rectum					x
Anus					x

According to the combined information of table 1 and 2, the IBD inventory in GIT specific region shown in the 1st row of table 2 can be by Comprise the antigen composition treatment of the antigenic determinant of the corresponding bacterial species of table 1, in order to the column heading of table 2 can essentially be by The bacterial species of table 1 substitutes.

In some embodiments, the pathogen for the present invention can be Exogenous bacteria pathogen.Such as, at table 3 In the organism listed can serve as microbial pathogens to prepare antigen composition, or can select that there are those pathogen Antigen composition, thus be positioned at the IBD in the GIT region listed by the related organisms of table 3 for treatment.Some embodiment party In case, targeting particular organization or the endogenous of organ and the antigenic determinant of Exogenous bacteria species can be used in combination.Example As, it is derived from clostridium difficile or is that specifically antigen composition may be used for treating and is positioned at the IBD of colon to it.

Table 3: Exogenous bacteria human pathogen and they are in the sites of infection of GIT

In some embodiments, the pathogen for the present invention can be viral pathogen.Table 4 provides virus causing disease Body is together with it is reported that the illustration of tissue that each viral species is pathogen and organ is enumerated.Therefore, an aspect of of the present present invention carries Supply to utilize and be determined Virus Name in neighbouring table 4 to specifying virus to treat for the most fixed immunogenic composition to be positioned at The IBD in GIT region.

Table 4: virus human pathogen and sites of infection thereof

The cumulative information of table 1 to table 4 provides extensively determining of the pathogen of the antigen composition that can be used for the present invention, even With the determination that wherein these organisms are pathogenic GIT region, and correspondingly determine can be by the antigen preparation of the present invention The GIT region that the wherein IBD for the treatment of is positioned at.

In some embodiments, the pathogen selected for using in antigen composition of the present invention can be for wherein The pathogen of the common inducement of the actute infection in the GIT region that IBD to be treated is positioned at.Table 5 determine the type antibacterial and Viral pathogen is together with wherein they generally induce the GIT region infected.Therefore, in selected embodiment, belong at table 5 IBD in the GIT region determined in first row can be by comprising one or more the pathogenic lifes listing the secondary series at table 5 Object is the antigen composition treatment of antigenic determinant.

Table 5: the common inducement of the actute infection (antibacterial and virus) in selected GIT region

The specific organism generally infected in the induction of the specific region of GIT can be changed by geographical position.Therefore, table 5 It is not all geographical position and common causative exhaustive planting group.It should be understood that the given zone of the GIT for the present invention Territory, this area general Clinical microorganism scholar can determine that in specific geographical area or plants the Common Pathogenic species in group.

For gastrointestinal parasite widely (including various protozoacide and parasite), the mankind are host, and this is for this Pathogen (Schafer, T.W., Skopic, the A.Parasites of the small of GIT is constituted for the purpose of invention intestine.Curr Gastroenterol Reports 2006；8:312-20；Jernigan,J.,Guerrant,R.L., Pearson,R.D.Parasitic infections of the small intestine.Gut 1994；35:289-93； Sleisenger&Fordtran’s Gastrointestinal and liver disease.8th ed.2006；Garcia, L.S.Diagnostic medical parasitology.5th ed.2007).The compositions of the present invention can correspondingly comprise Various protozoacide components, including such as blue primary giardia lamblia (Giardia lamblia), little Cryptosporidium (Cryptosporidium parvum), people Cryptosporidium (Cryptosporidium hominus), Isospora belli (Isospora belli), sarcocystis (Sarcocystis) species, coccidiosis (Coccidian) sample corpusculum (Cyclospora (Cyclospora) species), Bi Shi intestinal microsporidian (Enterocytozoon bieneusi), amoeba histolytica (Entamoeba histolytica), unbecoming entamoeba (Entamoeba dispar), entamoeba coli (Entamoeba coli), endamoeba hartmanni (Entamoeba hartmanni), small interior dragonfly ameba (Endolimax Nana), Iodamoeba butschlii (Iodamoeba b ü tschlii), Dientamoeba fragilis (Dientameoba fragilis), Blastocystis hominis (Blastocystis hominus), cyclospora cayatanesis (Cyclospora cayetanensis), micro-spore Sub-worm (Microsporidia), schizotrypanum cruzi (Trypanosoma cruzi), chilomastix mesnili (Chilomastix Mesnili), pentatrichomonas hominis (Pentatrichomonas hominis), balantidium Coli (Balantidium coli).Equally, the compositions of the present invention can include various parasite component, including such as: merozoic cestode (Cestodes) (cestode (tapeworms)), taeniasis bovis (Taenia saginata), taeniasis suis (Taenia solium), diphyllobothrium (Diphyllobothrium) species, H.nana (Hymenolepis nana), H. diminuta (Hymenolepis Diminuta), japanese double cord tapeworm (Dipylidium caninum), nematicide (Nematodes) (ascarid (round Worms)), ascariasis (Ascaris lumbricoides), strongyloides intestinalis (Strongyloides stercoralis), U.S. Continent plate mouth nematode (Necator americanus), Ancylostoma duodenale (Ancylostoma duodenale), ancylostoma caninum (Ancylostoma caninum), Trichuris trichiura (Tichuris trichiura), capillaria philippinensis (Capillaria Philippinensis), trichostrongyle (Trichostrongylus) species, trichinella (Trichinella) species, America plate Pipe strongylid in mouth nematode (Necator americanus), Anisakid nematode (Anisakis) and relative species, Coase tower (Angiostrongylus costaricensis), enterobiasis (Enterobius vermicularis), trematodiasis (Trematodes) (trematodiasis (flukes)), fasciolopsis buski (Fasciolopsis buski), heterophyid (Heterophyes) species, Echinostomatidae (Echinostoma) species, clonorchis sinensis (Clonorchis sinensis), Rear testis trematodiasis (Opisthorchi) species, sheet trematodiasis (Fasciola) species, Metagonimus Yokogawai (Metagonimus Yokogawi), Schistosoma mansoni (Schistosoma mansoni), Schistosoma japonicum (Schistosoma Japonicum), schistosoma mekongensis (Schistosoma mekongi), schistosoma intercalatum (Schistosoma Intercalatum), Echinostomatidae (Echinostoma) species and paragonimus (Paragonimus) species.

In selected embodiment, the present invention include diagnosis algorithm with evaluate patient to organism in front exposure.Example As, diagnosis algorithm can include obtaining medical history and/or the evaluation patient's immunity to selected pathogen being exposed to selected pathogen Response.For example, it is possible to carry out serological test to detect the antibody of selected pathogen in patients serum.For this of the present invention Aspect, can have the one or many Diagnostic indicator in front exposure to pathogen based on patient, such as by suffering from In person's serum, the existence of the antibody of the antigenic determinant of this pathogen selects the antigenic determinant of selected pathogen for right The immunogenic composition of selected patient.

In embodiment selected by other, the present invention includes that diagnosis algorithm is to evaluate patient to using selected immunogenicity group The immunological response of the treatment of compound.Such as, diagnosis algorithm can include evaluating patient's antigen to this immunogenic composition The immunne response of determiner, such as, use serological test to determine the antibody of those antigenic determinants.The present invention is somebody's turn to do Aspect, if evaluating the active immunity response showing to there is the antigenic determinant to said composition, then can be continuing with institute Select the treatment of immunogenic composition, and if evaluate show not exist the foot of the antigenic determinant to immunogenic composition Enough immunological responses actively, then can interrupt vaccine therapy, and can begin to use different immunogenic composition can Replacement therapy.

Although disclosed herein is various embodiments of the present invention, but can know according to the routine of those skilled in the art Know, carry out many adjustment and amendment within the scope of the invention.It is known etc. that this kind of amendment includes for any aspect of the present invention The replacement of jljl, thus realize identical result in substantially the same manner.Numerical range includes the numeral of the range of definition.Word " comprise (comprising) " and use with open-ended term form herein, be essentially identical to wording and " include but not limited to ", And word " comprises (comprises) " and has suitable implication.As used herein, singulative " (a) ", " one (an) " and " it is somebody's turn to do (the) " include plural referents, unless clearly indicated otherwise herein.Include being more than it is therefoie, for example, " thing " is quoted Such thing of one.The quoting it is not an admission that such document is the prior art of the present invention of document herein.In this specification In any existing file of quoting and all disclosures (including but not limited to that patent and patent are open) be incorporated herein by reference, as With specifically and individually pointing out that each single disclosure is incorporated herein by reference, as stated it completely herein.The present invention Including the most as described above and reference example and all embodiments of accompanying drawing and change.

In some embodiments, the present invention gets rid of the step including medical treatment or surgical operation therapy.

The following example illustrates embodiment of the present invention.

Embodiment 1: clinical research

Bacteria composition

In blinded study, the bacteria composition that five kinds are killed is used for treating cancer types widely And the stage, as follows:

1.Bayer Corporation MRV^TM“Bayer MRV”(Hollister-Steir Laboratories, Spokane, WA, U.S.A.), comprise following bacterial species:

Prepare this vaccine for following indication: rhinitis, infectious asthma, chronic sinusitis, nasal polyp and chronic serosity Property otitis media.The treatment of cancer is not designated as the intended use of this vaccine.Vaccine also includes following ingredients: 0.4% phenol, 0.9%NaCl, brain heart infusion (cattle), peptone, yeast extract, Sanguis caprae seu ovis, dextrose and the sodium phosphate of trace.

2.Stallergenes MRV“Stallergenes MRV”(Laboratories des Stallergenes, S.A., Fresnes, France), comprise following:

Prepare this vaccine for the identical indication with MRV vaccine, i.e. recurrent respiratory infections and as contraindication Listed cancer.

It is as follows, surprisingly it has been found that these MRV vaccines comprising many common pulmonary pathogen are effective to control Treat pulmonary carcinoma.

3.Polyvaccinum Forte(PVF；Biomed S.A., Krakow, Poland), including following:

Prepare this vaccine for upper and lower respiratory tract and the chronic and relapsing inflammatory disease state of urogenital tract, Including the chronic and recurrent that nasopharyngitis, relapsing laryngitis, tracheitis, bronchitis, otitis media, nervi trigeminus and occipital bone are neural Neuralgia, sciatica, brachial neuritis, intercostal neuralgia, chronic bladder ureteritis, vaginitis, adnexitis and son Endometrium inflammation.The treatment of cancer is not designated as the intended use of this vaccine.

Although it is interesting to note that the total concentration of antibacterial in PVF is identical with MRV (Bayer and Stallergenes), but Patient is generally at the dosage single subcutaneous injection less than common dose needed for using MRV compositions to realize similar skin response PVF compositions shows obvious struvite immunne response, it is meant that immunne response is similar to Polyvaccinum Forte epidemic disease A kind of novel components in Seedling, such as escherichia coli.As follows, surprisingly it has been discovered that comprise escherichia coli (colon, The common causative of abdominal part, kidney, ovary, peritoneum, liver and pancreas) PVF effectively treat colon, peritoneum lymph node, The cancer of kidney, ovary, peritoneum, liver and pancreas.

4.Staphage Lysate (Delmont Laboratories Inc., Swarthmore, PA, USA), under comprising Row:

Staphylococcus aureus

As follows, surprisingly it has been discovered that comprise staphylococcus aureus (mammary gland and the common causative of bone) Staphage Lysate effectively treats the cancer of mammary gland and bone.

The administration of MRV, Staphage Lysate and PVF

Bacteria composition (vaccine) is the suspension killing bacterial cell, is gently rocked suspension the most before the use To guarantee be uniformly distributed before taking out medicament (dose) from bottle, and on Monday, Wednesday and Friday the most subcutaneous give Medicine.Suggestion patient's continual cure at least 6 months.Required vaccine dose is determined by the adequacy of the immunne response to vaccine. By the least dosage (0.05cc), dosage is gradually increased (every time for 0.01-0.02cc), until realizing sufficient immunity Response.After injection in 2-48 hour, the local-acknowledgement of this delay occurs in injection site, and lasts up to 72 hours Or it is longer.Target is to realize the circular patches of diameter 1 to 2 inch of pink colour/redness in injection site, represents sufficient immunity thorn Swash.Once realize this response, then under realizing the level needed for this response, keep dosage.If response is substantially less than 2 inches of (examples As, half inch), then increase dosage, if it is noticeably greater than 2 inches (such as, 3 inches), then reduce dosage.This local immunity should Answer generally the most after injection first occur in 24 hours.Inquiry patient to check this response, if in the presence of, then to its measure or Labelling.Maintenance dose needed for realizing the immunne response of this abundance significantly changes, and depends on the immunne response of individuality, to some Group as little as 0.001cc, for other people up to 2cc.Vaccine must store (2 ° to 8 DEG C) in cold closet.Injection common Site is upper arm, thigh or abdominal part.Change per injection exact site, in order to do not given in wherein still suffer from pink colour/ Red site.The known contraindication of vaccine is the anaphylaxis of any component to vaccine.

5th vaccine, i.e. many microorganisms oral vaccines, the alternative aspect in the present invention uses, and it is as follows:

5.Respivax, is manufactured by BB-NCIPD Ltd (Bulgaria).This oral vaccines comprises killing of following lyophilizing Bacterial species:

The administration of Respivax

Manufacture Respivax oral vaccines to infect for treatment chronic respiratory system, and comprise many modal exhale Inhale road pathogen, including the inducement of many modal pulmonary infections.With the dosage treatment patient of a piece of 50mg tablet every day, carry Each species for every dosage are 1.25 × 10⁹The equivalent of individual cell.Patient the is prescribed above-mentioned dosage lasting company of at least 6 months The continuous period.

It is as follows, surprisingly it has been found that the Respivax oral vaccines comprising many common pulmonary pathogen is effective Ground is used for treating pulmonary carcinoma.

Embodiment 1A: the cancer of pulmonary

This relates in part to the preinvasive cancer of pulmonary or to the transfer of pulmonary, it is controlled by the microbial pathogens of pulmonary Treat, such as endogenous respiratory system bacteria flora.

If patient is initially diagnosed with 3B or the cancer of 4 phases (should not have an operation), then they are suitable to pulmonary carcinoma research.Make Carrying out stages of lung cancer with standard method, described method is such as at AJCC:Cancer Staging Handbook (the 6th edition) 2002； Springer-Verlag New York:Editors:Fredrick Greene,David Page and Irvin Fleming In, or at International Union Against Cancer:TNM Classification of Malignant Tumors (the 6th edition) 2002；Wiley-Liss Geneva Switzerland:Editors:L.H.Sobin and Described in C.H.Wittekind.The pulmonary carcinoma for example, it is possible to classify as follows:

TNM pulmonary clinic and pathologic classifications

The Stage Classification of TNM hypotype

Manually and be collected electronically there is diagnosis coding 162.9 (pulmonary carcinoma) and the chart of 197 (metastatic carcinomas).To these patients Gather information, such as diagnosis date, date of death and carcinoma stage.Check that the chart of patient is to determine diagnosis date and cancer rank Section.Patient is excluded outside analyzing due to underlying cause: the 1) stage of mistake；2) loss of data；3) there is no icon；Or 4) Chart arrives for data analysis the most on time.20 patients are eliminated from research, because their chart does not arrive, Or there is insufficient information, wherein 6 entitled MRV user.Seminar amounts to and includes 108 patients: 50 use MRV epidemic disease Seedling, and 58 be provided without MRV vaccine.

Initial diagnosis have the patient of the employing MRV of 3B and 4 phase pulmonary carcinoma with the survival ratio of the patient being provided without MRV relatively and As follows with SEER standard survival data (Fig. 1) of the patient that initial diagnosis has 3B and 4 phase pulmonary carcinoma:

Only include that the survival (as above) using those patients of the MRV of at least two moon is as follows than (Fig. 2):

Median survival and survival in 1 year, survival in 3 years and survival in 5 years are with the MRV antibacterial of pulmonary infection (comprise generally induce) Treatment group in more preferable, it was demonstrated that this vaccine effectiveness to lung cancer therapy.With the MRV vaccine therapy patient of at least 2 months There is higher survival rate, also confirm that this vaccine effectiveness to lung cancer therapy.

Based on including that the data that MRV compositions is infeasible patient population are alternatively analyzed, thus solve by The sense organ probability of the deviation of following initiation, i.e. afflicted patient more likely select new treatment (using MRV) and healthy patients Accept to use the antigen composition of the present invention with may be less likely to.MRV compositions is that the survival of feasible MRV patient (is designated as " lung 1 ") with MRV compositions be infeasible non-MRV patient survival (being designated as " lung 2 ") relatively eliminate some this selections Deviation, it is provided that what MRV treated becomes apparent from and illustrate more accurately, as shown in Figure 3.

In some embodiments, time period-for example, at least is extended by with repetition rate injection (i.e., three-times-weekly) 2 months, 3 months, 4 months, 5 months, 6 months or 12 months or 2 years, 3 years, 4 years or 5 years and the antigen bacteria combination that uses Thing obtains specific significant clinical benefit (in the case of the terminal cancer of the most inoperable pulmonary carcinoma, time longer Section can be more useful).The treatment of the type can be carried out with the immunostimulation providing persistently, extending.When above-mentioned analysis limits When treat the patient of at least 2 months with MRV, the survival advantage of MRV treatment is shown more clearly that the most in the diagram.

As shown in Figure 4, it is 23% relative to an annual survival rate and SEER data base's group of 2 groups only 48% of non-MRV lung One annual survival rate, is 70% with the 3B of the MRV treatment at least two moon or an annual survival rate of 4 phase patients with lung cancer.The 3 of MRV group Annual survival rate and non-MRV patient and SEER register the two compared with many more than 4 times.Non-MRV group neither one in lung 2 is studied is deposited Live 5 years, and have 15% within 5 years, still to live after diagnosis with the patient of MRV minimum 2 months periods for the treatment of.In disease, such as it is considered Being incurable disease and in the case of usual 5 annual survival rates are only the inoperable pulmonary carcinoma of 3% (SEER registration), the above results is The most encouraging and surprising.

When the analysis of patient data is limited to the patient treating at least 6 months with MRV, survival curve is very significant, As shown in Figure 5.Patient more than 60% lived in the 3rd year, be non-MRV group and SEER registration survival more than 10 times.With SEER Being only of data 3% is 0% to compare with non-MRV group, treats 36% (5 in 14 patients of the patient of at least 6 months with MRV Individual) within 5 years, live after diagnosis.These notable results have prospect in the case of cancer diagnosis is considered as incurable disease and make us very much Surprised.Therefore, in some embodiments, can be at least 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 In the moon, 8 months, 9 months, 10 months, 11 months or 12 months, 2 years, 3 years, 4 years, 5 years or indefinite administration persistent period Treat the cancer of such as terminal cancer (the most inoperable pulmonary carcinoma).

Make analysis be limited to those patients with MRV treatment minimum time section (such as 6 months), which results in beneficially MRV The deviation of group, is less than because eliminating survival from group (be included in death those before they can complete the treatment of 6 months) The MRV patient of this time period.By compensating the short-term survivor getting rid of non-MRV and SEER group, the detail statistics credit of this deviation Analysis shows, this deviation plays the least work in the survival advantage treat the highly significant of patient of at least 6 months with MRV With.

In 3B phase pulmonary carcinoma, cancer is restricted to pulmonary, can be thus according to each aspect of the present invention by comprising lung The vaccine of portion's pathogen, such as MRV stimulate target anticancer to treat response.In the 4th phase pulmonary carcinoma, cancer has been transferred to far-end Organ, it is not by being stimulated by the targeting of pulmonary pathogen according to the inventive method.Therefore, according to some embodiments, permissible Select suffer from the patient of 3B phase pulmonary carcinoma to treat with MRV vaccine, because all of cancer is limited to pulmonary, thus can be by MRV vaccine targeting.When the analysis of patient data is limited to the patient suffering from 3B phase pulmonary carcinoma, survival curve the most clear The benefit that MRV treats is shown to Chu.As shown in figure 11, an annual survival rate and the SEER number of 53% it is only relative to 2 groups of non-MRV lung According to the annual survival rate that storehouse group is 23%, it is 76% with an annual survival rate of the 3B phase patients with lung cancer of MRV treatment.The 3 of MRV group Annual survival rate is 3 times of non-MRV patient, and is more than 6 times of SEER registration.Non-MRV group neither one is survived 5 years, and uses The 3B phase patient of MRV treatment has 14% within 5 years, still to live after diagnosis.In disease, be such as considered as incurable disease and usual 5 years In the case of survival rate is only the inoperable 3B phase pulmonary carcinoma of 5% (SEER registration), the above results is to make us very much bulging Wave and surprising.

Because some patients are many after diagnosis the moon or even 1 year or 2 years all do not carry out their visit for the first time, so they It is included in survival curve and makes curve to longer survival deflection.In order to determine whether this deviation affects the difference of survival curve, Analyzing survival from visiting the date for the first time, as shown in Figure 12, this eliminates this deviation.3B phase patients with lung cancer in fig. 12 The comparison of survival curve, it is shown that the survival benefit of the MRV treatment bigger than shown in Figure 11, shows the benefit portion that MRV treats Divide the most masked.As shown in figure 12, compared with the survival in 1 year of only the 21% of the 3B phase patient that unused MRV treats, It is 57% with 1 annual survival rate (date from visiting for the first time) of the 3B phase patients with lung cancer of MRV treatment.Although unused MRV treatment 3B phase patient is survived 3 years, but 3 annual survival rates with the 3B phase patient of MRV treatment are 33%, and 5 annual survival rates are 14%, i.e. notable and unpredictable consequence.

When analyzing the 3B patients with lung cancer within being limited to visit for the first time into diagnosis 3 months, it is clearly shown that and controls with the early stage of MRV The benefit treated.As shown in figure 13, although visiting for the first time at 3 months interior all 3B phase patients with lung cancer diagnosed in 1 year of diagnosis Death, but survive 1 year with the 70% of the 3B patients with lung cancer of MRV treatment in 3 months of diagnosis, 40% survival 3 years, and 20% survival 5 years, is the survival benefit of highly significant for early stage MRV treats.

An aspect of of the present present invention includes with the antigenic determinant comprising the microbial pathogens being known as pulmonary pathogen Antigen composition treatment primary lung cancer or to the transfer of pulmonary, the most exogenous pulmonary pathogen of described pulmonary pathogen or be The pathogen of the endogenous flora member of respiratory system.Such as, the endogenous bacteria respiratory system of infection is the most often induced in pulmonary The antigenic determinant of flora species (seeing table 5) may be used for treating constitutional and the metastatic cancer being positioned at pulmonary: pneumonia chain Coccus, moraxelle catarrhalis, mycoplasma pneumoniae, Klebsiella pneumonia, hemophilus influenza.It is also possible to select from table 5 Common virus pulmonary pathogen is for some embodiments.Or, the pathogenic information provided based on table 2, can select from table 1 Select the more exhaustive of endogenous pulmonary pathogen.In other alternative embodiment, it is possible to use the viral lung that table 4 is listed Portion's pathogen.And in other alternative embodiment, the Exogenous bacteria pulmonary pathogen from table 3 may be used for joining The antigen composition of the present invention processed, is i.e. selected from: achromobacter, Actinomycesa lmadurae, Bacillus alcaligenes, microgranule sporozoon, anthrax bar Bacterium, other bacillus cereus, Pasteur send out bacterium, horizontal plug Bartonella, animal ulcer Burger bacterium, Huo Shi bordetella, parapertussis Bordetella, bordetella pertussis, Borrelia burgdoyferi, Borrelia recurrentis, brucella, gladiolus primary gram Hall moral bacterium, Burkholderia mallei, Burkholderia pseudomallei, campylobacter fetus, Canis familiaris L. sting carbon dioxide and bite Fiber bacterium, dog sting carbon dioxide Cytophaga, Chlamydia pneumoniae, chlamydia psittaci, Chlamydophila pneumoniae, livid purple pigment bar Bacterium, Chlamydophila psittaci, Chryseobacterium sp, Corynebacterium pseudotuberculosis, Coxiella burnetii, Francisella tularensis, Ge Dengshi Bacterium, Legionnella, hook end spiral shell group, Mycobacterium avium, mycobacterium kansasii, mycobacterium tuberculosis, other mycobacteria, promise Card Salmonella, Orientia Tsutsugamushi, oxalic acid bacterium, Pseudomonas aeruginosa, other pseudomonas, Rhodococcus fascians, rickettsia conorii, Pu Shi Rickettsia, Li Kecishi rickettsia, rickettsia exanthematotyphi.

Such as, because MRV compositions comprises many modal pulmonary pathogen, so these vaccines may be used for treatment Primary lung cancer or Lung metastases, as shown in the accumulation data represented herein, and these vaccines may be used for many case reports In.According to aforementioned result, an aspect of of the present present invention includes that be the anti-of pathogenic microbial pathogens with comprising known in pulmonary The antigen composition of former determiner treats primary lung cancer or to the transfer of pulmonary, the most exogenous lung of described microbial pathogens Portion's pathogen or be the pathogen of endogenous flora member of respiratory system.In selected embodiment, common pulmonary pathogen Antigenic determinant may be used for treating constitutional and the metastatic cancer being positioned at pulmonary, such as, from following bacterial species or The antigenic determinant of one or more in Virus Type: streptococcus pneumoniae, moraxelle catarrhalis, mycoplasma pneumoniae, kerekou pneumonia Primary Salmonella, hemophilus influenza, influenza virus, adenovirus, respiratory syncytial virus and parainfluenza virus.Selected by other In embodiment, the antigenic determinant of streptococcus pneumoniae (inducement of modal bacterial lung infections) can be used alone or Modal pathogen is used together to treat the cancer of pulmonary with other pulmonary.

Primary lung cancer can also originate from bronchial tissue, therefore, in some embodiments, comprises known induction and props up gas The antigen composition of antigenic determinant of the microbial pathogens that pipe infects may be used for treating suffering from and is positioned at bronchial tissue The patient of cancer, includes but not limited to the common inducement of following bronchial infection: mycoplasma pneumoniae, Chlamydophila pneumoniae, one hundred days Cough bordetella, streptococcus pneumoniae, hemophilus influenza, influenza virus, adenovirus, rhinovirus, coronavirus, parainfluenza virus Poison, respiratory syncytial virus, Human Meta pneumo virus or Coxsackie virus.Can be with comprising known induction pulmonary and bronchus Infect microbial pathogens (such as, streptococcus pneumoniae, hemophilus influenza and mycoplasma pneumoniae be all common pulmonarys and Bronchopathy substance) the antigen composition of antigenic determinant, or alternately with comprising the micro-of known induction pulmonary infection The antigen group of the antigenic determinant of the antigenic determinant of bio-pathogen and the microbial pathogens of known induction bronchial infection Compound treats the pulmonary carcinoma (or Lung metastases) being positioned at pulmonary and bronchial tissue.

Embodiment 1B: there is the breast carcinoma shifted to bone or pulmonary

The most common inducement of intramammary infection and infection of bone is staphylococcus aureus.Therefore, in one aspect of the invention in, The antigen composition of the antigenic determinant comprising staphylococcus aureus may be used for treating the breast carcinoma having to Bone tumour.Under The notable case with the patient R (PtR) of S. aureus vaccines treatment shown in the case report of face shows the method pair Treatment has the usefulness of the breast carcinoma of Bone tumour.As shown in Figure 6, in some 52 patients accumulated, with comprising golden yellow Portugal The survival to bone and/or the patient with breast cancer of pulmonary's transfer that has of the MRV (n=19) of grape coccus is better than not using MRV vaccine (n=33) survival of the patient treated:

According to above result, an aspect of of the present present invention includes that the antigen with the microorganism comprising known induction intramammary infection is certainly The antigen composition treatment preinvasive cancer at mammary gland of stator or the transfer to mammary gland, and with comprising known induction infection of bone Bacterial species or virus antigenic determinant antigen composition treatment bone preinvasive cancer or to the transfer of bone.Selected In embodiment, the vaccine of the antigenic determinant comprising staphylococcus aureus (mammary gland and the most common inducement of infection of bone) is permissible Be used alone or be applied in combination to treat the cancer of mammary gland with the most commonly encountered diseases substance of other mammary gland, or be used alone or with The most commonly encountered diseases substance of other bone is applied in combination to treat the cancer of bone.

Embodiment 1C: to the transfer of bone

In the patient suffering from carcinoma of prostate, one of most common site of transfer is bone.In in one aspect of the invention, bag MRV compositions containing the antigenic determinant of staphylococcus aureus (the most common inducement of infection of bone) may be used for treatment to bone Transfer, such as in the patient suffering from or having suffered from constitutional carcinoma of prostate.The chart of Fig. 7 be accepted surgical operation or Radiate and destroy its prostate (thus, for primary tumor) and there are some accumulations of the detectable cancer being limited to Bone tumour The comparison of survival of metastatic prostate cancer patient.It is shown that the survival of the patient treated with MRV (n=4) is basic It is better than the patient that unused MRV (n=7) treats.

According to aforementioned result, an aspect of of the present present invention includes resisting with the microbial pathogens comprising known induction infection of bone The antigen composition of former determiner treats primary bone cancer or to the transfer of bone, the most exogenous osteopathia of described microbial pathogens Substance or be the pathogen of endogenous flora member of skin, oral cavity or colon.Such as, in selected embodiment, from The antigenic determinant of one or more in the following microbial species of common osteopathia substance list may be used for treatment and is positioned at bone Constitutional and metastatic cancer: staphylococcus aureus, coagulase negative staphylococcus, streptococcus pyogenes, streptococcus pneumoniae, Streptococcus agalactiae, other streptococcus, escherichia coli, pseudomonas, enterobacteria, Bacillus proteus, Serratieae, assays for parvovirus B 19, Rubella virus, hepatitis B virus.In embodiment selected by other, the staphylococcus aureus for the most common inducement of infection of bone is permissible It is used alone or is used together the cancer treating bone with the most commonly encountered diseases substance of other bone.

Embodiment 1D: be positioned at the cancer of colon

The survival (seeing Fig. 8) improving colorectal cancer patients has been shown, such as following four groups of knots with the treatment of PVF compositions Shown in the comparison of patients with bowel cancer group.

4th phase colorectal cancer patients, it is treated with MRV.

4th phase colorectal cancer patients, its unused vaccine therapy.

4th phase colorectal cancer patients, it uses PVF vaccine therapy.

4th phase colorectal cancer patients, it is from SEER (detection, epidemiology and final result) data base.

This embodiment shows that the patient of the colon cancer with PVF treatment has the survival of basic improvement, and described PVF comprises greatly The most common inducement that enterobacteria, i.e. colon bacteria infect,.

If patient shows the 4th phase colon cancer, then it is suitable to first two groups of this research.Owing to underlying cause will be suffered from Person gets rid of from this analysis:

Incorrect diagnosis

The incorrect phase

The loss of necessary data (such as, date of death)

There is no icon

For data analysis, chart arrives us the most on time.

Patient's group includes 136 the 4th phase colorectal cancer patients altogether: 15 use PVF vaccine, and 56 use MRV vaccine, and And 65 be provided without vaccine.Result figure 8 illustrates, as follows:

With the patient of the 4th phase colon cancer that PVF (it comprises escherichia coli, one of the most modal colon disease substance) treats Median survival be patient or the unused vaccine therapy treated with MRV (it does not comprise colon disease substance) patient twice with On, and be four times of SEER registration.With only the 71% of MRV group, without only compared with in the of 45% of 69% and SEER registration of vaccine group, All 15 still live after diagnosis with the patient of PVF treatment for 10 months.The survival of 30 months of PVF group is MRV group and without epidemic disease The twice of Seedling group, and four times of almost SEER registration.

Rank test (wilcoxon test) show by the patient of PVF vaccine therapy and MRV group (p=0.0246) and Without the statistically significant survival difference between vaccine group (p=0.0433).This is significantly in view of the minimum of PVF group (n=15) Scale, shows substantive therapeutic effect.As these results prove, comprise what escherichia coli, i.e. colon bacteria infected The PVF compositions of most common inducement is the effective treatment for colon cancer.

The survival of those patients having analyzed the immunological therapy providing the present invention in 3 months of diagnosis (is i.e. arranged Those patients except being long-term survivor before providing treatment).The result of this analysis figure 9 illustrates.It is shown that Fig. 9 " MRV " and " without vaccine " survival curve shift the most to the left and (show that the selection deviation towards " for a long time " survivor can be at figure In 8, these curves are shifted the most to the right), and significantly, the actually curve than Fig. 8 of the PVF curve in Fig. 9 more to the right, Show that the benefit of the early treatment with PVF (that is, in 3 months of diagnosis) is much better than any long-term survivor that Fig. 9 is got rid of Deviation.This analysis provides following noticeable sign, the benefit of the PVF treatment of the i.e. the 4th phase colon cancer can be than Fig. 8 institute That shows is bigger, and starts the treatment by the compositions of the present invention after diagnosis the most early, and benefit is the biggest.

According to aforementioned result, an aspect of of the present present invention relates to comprising the microbial pathogens that is known as colon disease substance The antigen composition treatment colon cancer of antigenic determinant, the disease of described microbial pathogens for example, colon endogenous flora member Substance or exogenous colon disease substance.Such as, the antigenic determinant of following microbial species may be used for treating and is positioned at colon Constitutional and metastatic cancer: escherichia coli, clostridium difficile, bacteroides fragilis, bacteroides vulgatus, multiform intend bar Bacterium, clostridium perfringens, Salmonella enteritidis, Yersinia enterocolitica, shigella flexneri；Adenovirus, Astrovirus, Calicivirus, norwalk virus, rotavirus or cytomegalovirus.Such as, the cancer being positioned at colon can be with bag The alternative preparation of PVF compositions containing colon bacillus or the antigenic determinant that only comprises colon disease substance is treated.At other In selected embodiment, the antigenic determinant of escherichia coli (the most common antibacterial inducement of colon infections) can be used alone or with The most commonly encountered diseases substance of other colon is used together to treat the cancer of colon.

The purposes of embodiment 1E:Respivax (a kind of oral vaccines) treatment pulmonary carcinoma

With the dosage of a piece of 50mg tablet every day, give oral cavity Respivax vaccine as mentioned above, it is provided that often dosage is every Individual species are 1.25 × 10⁹The equivalent of individual cell.Suggestion patient continues above-mentioned dosage at least 6 months.

As shown in Figure 10, unused resisting substantially it is better than with the survival of the 3B phase patients with lung cancer of oral cavity Respivax antigen therapy The patient of former compositions treatment.Compared with the median survival of only 20 months of unused antigen composition vaccine therapy, use The median survival of the patient of Respivax treatment is 37 months.40% work in 5 years after diagnosis with the patient of Respivax treatment , and the survival of untreated patient's neither one was more than 2 years.

According to aforementioned result, an aspect of of the present present invention includes with the microbial pathogens comprising generally induction pulmonary infection The oral administration of the antigen composition of antigenic determinant treats pulmonary's preinvasive cancer or to the transfer of pulmonary.

Embodiment 2: Case report

These Case reports show form the patient of the patient population of reflection in aforementioned accumulation research and this is described Bright other side.Especially, the independent Case report of patient A-N is shown in and makes us frightened with in some patients of anti-inflammatory therapy The result being surprised, and the Case report of patient O-AA shows to include many effective vaccines in the case of there is not anti-inflammatory therapy The general patient population for the treatment of example.

MRV with the lung cancer with unused anti-inflammatory agent

The JIUYUE of the patient A (PtA): the 0th year, PtA finds that upper right quarter chest pain occurs together and stridulates.These Symptoms last and the 1st Year January, she has carried out chest X-ray examination, its enclosed mass showing to find 7cm × 8cm size at right lung point.Fine needle aspiration is Nonsmall-cell lung cancer is positive.On the January of the 1st year 27, MRI shows that subclavian artery is got involved, and this makes its excision that can not undergo surgery, Therefore, PtA is diagnosed as 3B phase inoperable advanced lung cancer.She has carried out Palliative radiation and the chemistry of decrement of short-term Therapy.She is apprised of suffers from terminal cancer, it is contemplated that the life-span is 3 to 6 months.

On the April of the 1st year 29, PtA starts to use MRV vaccine therapy, 3 times a week.On the same day, she also starts to resist with nonsteroidal Inflammation medicine (NSAID) is treated: indomethacin 50mg every day 4 times also takes in antioxidant supplement agent and vitamin D.After 18 months, To the October of the 2nd year, tumor size was obviously reduced, a diameter of 3cm, to the May 19 of the 5th year, with combine absorption MRV vaccine, After the treatment of indomethacin, antioxidant vitamin and vitamin D starts 4 years, the only cicatrix of remaining residue.PtA continues to use MRV Vaccine and auxiliary anti-inflammatory agent conjoint therapy were treated more than 4 years, until the May of the 5th year, had not the most had the card of residual cancer According to, although she is diagnosed as the pulmonary carcinoma of unsuitable operative treatment in late period before more than 4 years.More than 14 years from being diagnosed as advanced lung cancer, PtA is known to feel good the evidence of not residual cancer.

According to aforementioned result, one aspect of the present invention includes using the microorganism cause of disease comprising generally induction pulmonary infection The antigen composition of the antigenic determinant of body treats pulmonary carcinoma.

According to aforementioned result, another aspect of the present invention includes through relatively frequently repetitively administered of relatively long time period Immunogenic composition.

With targeting MRV treatment combine anti-inflammatory agent such as antioxidant, vitamin D and indomethacin and reality are used in combination Improving existence in matter relevant, this existence is more than wherein not using the compositions with the present invention to assist anti-inflammatory agent mode in combination The existence of other similar case.Such as, an other similar case (wherein not giving anti-inflammatory agent), patient B is diagnosed as not The preferably 3B phase nonsmall-cell lung cancer of operative treatment, it is dead in diagnosing 3 months.These cases provide the antigen of the present invention Synergistic evidence between compositions and anti-inflammatory agent treatment.

According to aforementioned result, one aspect of the present invention includes using and comprises target organ or be organized as pathogenic micro-life The antigen composition of the antigenic determinant of thing pathogen and the anti-inflammatory therapy of auxiliary are to realize synergism to treat cancer.

MRV with the lung cancer with unused anti-inflammatory agent

The spring of the patient C (PtC): the 0th year, PtC starts pain occur in its upper right chest region.Pain lasts and The October 5 of the 0th year, he carried out chest X-ray examination, and the enclosed mass of display 12cm × 11cm size actually occupies whole The individual upper right lobe of the lung.Fine needle aspiration is that low differentiation nonsmall-cell lung cancer is positive.The December of the 0th year has carried out exploratory thoracotomy, art on 7th Middle discovery tumor invading thoracic wall and superior vena cava, therefore the tumor of PtC is (that is, the 3B phase) of unsuitable operative treatment.PtC is carried out The Palliative radiation of short-term and the chemotherapy of decrement.He be informed that suffer from terminal cancer, it is contemplated that the life-span is 3 to 6 months.Extremely On the January of the 1st year 27, the tumor of fast-growth has increased to 14cm × 11.5cm.

On the February of the 1st year 9, PtC starts to control with indomethacin 50mg every day 4 times, antioxidant vitamin and vitamin D Treat.After 3 weeks, on the March of the 1st year 1, PtC starts with MRV vaccine therapy 3 times a week.To the June of the 1st year, PtC felt good also Run 3 to 4 times weekly, each 8km.On the June of the 1st year 4, chest X-ray examination display tumor size is reduced to diameter 11cm. PtC feels good always, and it is abundant and vibrant that this makes it live, and works the most comprehensively and continue comprehensive body movement. The treatment of the combination treatment (indomethacin, antioxidant and vitamin D) that PtC continues MRV vaccine and auxiliary anti-inflammatory agent exceedes Within 16 months, (due to impaired renal function, this is known length to stopped the treatment of indomethacin at that time until July 24 of the 2nd year Phase uses the potential side effect of indomethacin).After 6 months, the December of the 2nd year, after targeting vaccine therapy 22 months, stopped MRV treatment (because MRV exceedes this invalid date).PtC feels good always, until the June of the 6th year, he is diagnosed as at that time Both sides Lung Cancer Recurrence, this causes him dead the May 26 of the 7th year, is i.e. diagnosed as advanced lung cancer at him and is apprised of and can deposit After living 3 to 6 months after 6.5 years.

In this case, in the face of diagnosis that would generally be dead in 1 year, including of being used in combination with targeting MRV treatment resists Oxidant, vitamin D are relevant to substantially improvement existence with the auxiliary anti-inflammatory agent use more than 16 months of indomethacin, should Existence is used in combination the existence of other similar case of auxiliary anti-inflammatory agent mode more than the most not compositions with the present invention, and And inoperable pulmonary carcinoma is dead in diagnosis 8 months.These cases provide antigen composition and the anti-inflammatory of the present invention Synergistic evidence between medicine treatment.

The PVF of anti-inflammatory agent is not used for having the colon cancer to liver and pulmonary's transfer

Patient E (PtE): PtE has carried out colon cancer excision the June 17 of the 0th year, then carries out chemotherapy. On the August of the 0th year 15, he was diagnosed as the 4th phase and has the cancer to liver and Lung metastases, and this diagnosis has excessively poor pre- After.On the October of the 0th year 20, PtE starts antioxidant and vitamin D Regimen Chemotherapy, the December of the 0th year 10 days, and he starts to use PVF compositions is treated 3 times a week, and period, he persistently combined antioxidant and vitamin D.The JIUYUE of the 1st year, he starts to use Celebrex^TM2 treatments 100mg every day.Although initial prognosis is excessively poor, but suffers from advanced metastatic colon cancer in diagnosis Afterwards more than 3 years, PtE when last contact still and feel good.

According to aforementioned result, it is pathogenic to colon, liver and pulmonary that one aspect of the present invention includes that use comprises known The antigen composition of the antigenic determinant of the microbial pathogens of property treats the cancer of colon, liver and pulmonary.

In 15 patients being diagnosed as the 4th phase colon cancer and treat with PVF, different from PtE, that survival period is the shortest trouble Person, i.e. the unused anti-inflammatory agent of patient F is treated.These cases provide with targeting PVF therapy united anti-inflammatory agent mode (i.e., Celebrex^TM, antioxidant and vitamin D) there is synergism, contribute to PtE and extend survival period, ratio wherein these auxiliary are anti- The survival period of the similar case that inflammation prescription formula is not used in combination with the compositions of the present invention is longer.

The PVF for having the colon cancer to pulmonary's transfer being used together with anti-inflammatory medicaments

Patient G (PtG): PtG there is hemorrhage of rectum the May of the 0th year, and is diagnosed as colon cancer.He carried out operation, Chemotherapy and radiation, but the August 16 of the 1st year, the transfer (the 4th phase cancer) to lung, this late diagnosis poor prognosis occur. He was in the scheme starting antioxidant vitamin and vitamin D June of the 0th year, and within 23rd, started to take in the JIUYUE of the 1st year NSAID celecoxib 100mg every day 2 times.The March of the 3rd year, he starts PVF vaccine therapy 3 times a week, he persistently this treatment until The April of the 4th year, he occurs in that brain metastes at that time, and this causes him dead the June 2 of the 4th year, i.e. after diagnosis the 4th phase colon cancer Almost 3 years.PtG has substantially been survived and has been had, than the 4th phase, the time that the diagnosis expection of colon cancer to Lung metastases is longer.With regard to this Speech, the invention provides and anti-inflammatory agent mode is used in combination to reach synergism with such as the immunogenic composition of PVF.

Patient H (PtH): PtH is diagnosed as the colon cancer to liver and Lung metastases the February 13 of the 0th year.1 in 1st year The moon 11, he carries out antioxidant and vitamin D scheme by prescription.But, the March of the 1st year, he proceeded by chemotherapy Investigation and answer the requirement of research coordination person to disable these supplement at that time.He unused any NSAID treats.1st year May 12, he starts to treat with PVF, and he carries out this treatment 3 times a week until after 2.5 months it is dead.When relating to other When the similar case using anti-inflammatory agent compares, this case shows: give without while targeting antigen active treatment Auxiliary anti-inflammatory agent mode, will lack synergism, and this synergism can be with the use of auxiliary anti-inflammatory agent mode Occur.

In a word, for the 4th phase colorectal cancer patients treated by targeting PVF vaccine therapy, therapy connection is activated with targeting antigen Close the use of the auxiliary anti-inflammatory medicaments including antioxidant, vitamin D and celecoxib used and the basic survival period improved Relevant, this survival period is longer than the survival of two cases that these auxiliary anti-inflammatory agent modes are not used in combination with vaccine Phase, this provides and shows synergistic evidence.

For there is the use of the cancer of pancreas to the transfer of pulmonary, liver and abdominal lymph node and not using anti-inflammatory medicaments PVF

The August of the patient I (PtI): the 1st year, PtI is diagnosed as cancer of pancreas, and he receives its pancreas of excision at that time (that is, Whipple operation).But, the July of the 2nd year, he occurred in that pancreas occur in the transfer to lung bilateral the February in the 4th year The cancer return in gland region also has the transfer of abdominal part and liver.This is the late diagnosis that prognosis is excessively poor.PtI in the 2nd year 9 Started by the moon 27 antioxidant vitamin, vitamin D, heavy dose of turmeric (curcumin), fish oil (9mg every day), white hellebore Alcohol and the scheme of green tea (equivalent of 36 glasss every day), all these anti-inflammatory agent modes that are, all these he takes the most continuously. The March of the 3rd year, he starts with celecoxib treatment 100mg every day 2 times, and he took more than 20 months.The May of the 4th year, PtI starts Treating 3 times a week with PVF, he continues to use regularly to be continued above 3 years since then.PtI is after diagnosis advanced metastatic cancer of pancreas Survival was more than 5 years, and in the case of diagnosis has excessively poor prognosis, this is the survival period being obviously prolonged.This case provide with PVF compositions combines multiple anti-inflammatory agent mode (that is, celecoxib, antioxidant, vitamin D, the Rhizoma Curcumae Longae of the high dose taken Root, fish oil, resveratrol, green tea) form synergistic evidence, this synergism contributes to PtI and is forming transitivity pancreas Remarkably survive 5 years after cancer (generally dead in 6 months diagnosis).

According to aforementioned result, one aspect of the present invention includes that use comprises known induction pancreas, abdominal lymph node, liver With the antigen composition of the antigenic determinant of the microbial pathogens of pulmonary infection treat pancreas, abdominal lymph node, liver and The cancer of pulmonary.

The diagnosis of patient J (PtJ) and PtI is essentially identical (that is, has the pancreas of ventrad lymph node, lung and hepatic metastasis Cancer).In addition to antioxidant and vitamin D, PtJ does not accepts any other anti-inflammatory agent together with PVF vaccine, and it is in diagnosis 4 Death in month, and PtI, combine many other anti-inflammatory agent modes (that is, celecoxib, the Rhizoma Curcumae Longaes taking heavy dose with PVF vaccine Root, fish oil, resveratrol and green tea), survive after diagnosis 5 years.These cases provide high dose multiple anti-inflammatory prescription Formula and the synergistic evidence of targeting vaccine therapy.

For having the MRV of the breast carcinoma to Bone tumour

The March of the patient K (PtK): the 0th year, there is the constant pain at cervical region and back in PtK.On the July of the 0th year 28, her quilt Being diagnosed as the 4th primary breast cancer to cervical spine transfer, this is the diagnosis of refractory.She has carried out two mammary gland of excision and has swollen Block (axillary lymph nodes is positive) has also carried out Palliative radiation to the transfer in her spinal cord.On the January of the 1st year 18, PtK starts to take Antioxidant and the treatment of vitamin D, and take NSAID indomethacin 50mg every day 4 times.After 3 days, on the January of the 1st year 21, She starts to treat by MRV compositions, and said composition is included as the staphylococcus aureus of the most commonly encountered diseases substance of mammary gland and bone.To the greatest extent Pipe is the most persistently remembered with the file of the definite time span of this associating MRV/ indomethacin/antioxidant/vitamin D treatment Carry, but give the enough vaccines of this patient (20ml) nearly 2 years with routine dose and frequency (i.e., 3 times a week), and PtK is old State her and complete the course for the treatment of of recommendation at home.Noticeablely, it is being diagnosed as after the 4th primary breast cancer 13 years of Bone tumour, PtK Still survive and at least contact with us.

According to aforementioned result, one aspect of the present invention includes using and comprises the pathogen being known as mammary gland and infection of bone The antigen composition of the antigenic determinant of microbial pathogens treats the cancer of mammary gland and bone.

Different from patient K, patient L (PtL) is diagnosed as having the breast carcinoma to Bone tumour the October 11 of the 0th year. She is not given NSAID or other anti-inflammatory agents.On the February of the 1st year 27, PtL starts to treat with MRV.She is after 9 months, i.e. On the November of the 1st year 4 is dead, is only diagnosed as having 1 year after the 4th primary breast cancer of Bone tumour.PtK's with PtL is similar Contrast between case confirms by anti-inflammatory agent and the probability of the Synergistic treatment of the antigen composition of the present invention.

For having the MRV using and not using anti-inflammatory agent of the breast carcinoma to Bone tumour

Patient M (PtM): PtM is diagnosed as the 4th primary breast cancer to Bone tumour the June 15 of the 0th year.In order to continue Pain slow down, she starts to take NSAID naproxen 250mg every day 2 times, and, she started to take antioxygen the October of the 3rd year Agent and vitamin D.After 3 months, she started with MRV vaccine the January 15 of the 4th year, and (it contains staphylococcus aureus, i.e. Modal mammary gland and the pathogen of bone) combine these anti-inflammatory agent therapies (that is, naproxen, antioxidant and vitamin D) and control Treat.PtM has been survived more than 9 years being diagnosed as first suffering from after the 4th primary breast cancer of Bone tumour, it is contemplated that relevant to this diagnosis The most excessively poor prognosis, this is a unusual long survival period.

According to aforementioned result, one aspect of the present invention includes using and comprises the common inducement being known as mammary gland and infection of bone The antigen composition of antigenic determinant of microbial pathogens treat the cancer of mammary gland and bone.

Different from PtM, patient N (PtN): PtN is diagnosed as suffering from the 4th phase cancer to Bone tumour the April 8 of the 0th year Disease.She started to take antioxidant and vitamin D the April 24 of the 0th year.But, before starting MRV treatment, she is given Using blood thinners warfarin, limit vitimin supplement E and vitamin C, if be used in combination with warfarin, both is important Antioxidant can cause possible complication.Additionally, due to NSAID forbids use same with warfarin, the most in this case NSAID can not be given.PtN started to treat with MRV the June 2 of the 1st year.The August of her after 14 months the 2nd year is dead.? In the case of Gai, possibly, use targeting vaccine therapy and without auxiliary anti-inflammatory agent (that is, NSAID, vitamin E and therapeutic dose Vitamin C) synergism limit its possible benefit.

In a word, have in the 4th primary breast cancer case of Bone tumour with targeting MRV therapy for treating described in detail above, Associating MRV uses auxiliary anti-inflammatory agent relevant to the basic survival period improved, and this survival period is longer than does not combines with vaccine Using the survival period of 2 cases of auxiliary anti-inflammatory agent mode, this provides evidence and shows its synergism.

For to the MRV of Lung metastases

Patient O (PtO) is diagnosed as renal carcinoma the June of the 0th year, has bilateral pulmonary and the transfer of bone (fl).This is usual It is considered as late diagnosis and the poor prognosis of refractory.He starts MRV the August 10 of the 0th year and treats and continue rule treatment (often Week 3 times) 16 months (afterwards MRV not in use by).He starts the experimental drug treatment of 7 months, poly-second two in the JIUYUE of the 0th year Alcohol Intederon Alpha-2a.Owing to transfer causes the risk of fracture, he " is pegged " by fl, but due to postoperative complication, needs Amputation is carried out below midleg big to left lower limb.The JIUYUE of the 2nd year, has excised his carcinous right side kidney.The October of the 2nd year, PET Scanning does not finds the evidence of cancer in lung, and without the evidence of further Bone tumour.The feelings of cancer evidence are not had in his lung Under condition, PtO has survived more than 9 years after being diagnosed as bilateral pulmonary transfer, and this is surprising result.

According to aforementioned result, one aspect of the present invention includes using and comprises the microbial pathogens being known as lung pathogen The antigen composition of antigenic determinant treat the transfer to pulmonary.

For the MRV to bone and Lung metastases

Patient P (PtP) is diagnosed as renal carcinoma the July of the 0th year, and has carried out Resection of right kidney.The December of the 4th year, he goes out Bone (bilateral femur) and lung (bilateral) transfer are showed.PtP decreases conventional therapy and starts to treat with MRV the April of the 5th year, His the most persistently this treatment, 3 times a week, reaches 18 months.The health status of PtP is improved and he has recovered normal daily work Dynamic.The X-line of chest and femur and imaging do not show development, and carry out 18 middle of the month of MRV treatment, lung and femur at PtP Interior stable disease.

According to aforementioned result, one aspect of the present invention includes the micro-life using the common inducement being included as lung and infection of bone The antigen composition of the antigenic determinant of thing pathogen treats the transfer to lung and bone.

For to the MRV of Lung metastases

Patient Q (PtQ) is diagnosed as colon cancer the metastasis of possible oriented lung the June of the 0th year.At that time, completely cut Except constitutional colon tumor, only remain several Lung metastases.PtQ starts to treat with MRV in the December of the 0th year on the 11st, and she continues This treatment reaches 4 months 3 times a week.On the April of the 1st year 19, after treating 6 months with chemotherapy, she undergos surgery and only excises Remaining visible lung damage, it is defined as metastatic lesion.Even if carrying out chemotherapy after transfer seen from excision, have The diagnosis of the colon cancer of Lung metastases is also poor prognosis.Although the poor prognosis that she is initial, but initially it is diagnosed as Lung metastases also at her Rear more than 10 years with MRV treatment, PtQ maintains splendid health status and does not has the evidence of cancer.

For having the staphylococcus aureus of the breast carcinoma to Bone tumour

Patient R (PtR): PtR is diagnosed as breast carcinoma the May of the 0th year and transfers to her breastbone, femur and cervical vertebra spine Prominent, this is incurable cancer of poor prognosis.She treats with radiation and tamoxifen.The May of the 4th year, she is its lumbar vertebra spine Prominent existing other transport zone, she starts to use megestrol therapy.The November of the 4th year, she starts with containing only golden yellow Portugal Vaccine (the Staphage Lystate vaccine) treatment of grape coccus, staphylococcus aureus be mammary gland and bone infect the most normal The inducement seen, therefore its vaccine is treatment breast carcinoma and the optional preparation of osteocarcinoma.She persistently treats 5 years by this vaccine rule.To the greatest extent Pipe is the metastatic breast cancer having many places Bone tumour, and PtR is still survived more than 17 years, in the feelings of the metastatic breast cancer that can not be cured Under condition, this is a surprising survival period, and is the sufficient evidence of targeting vaccine therapy prospect for treating breast carcinoma.

According to aforementioned result, an aspect of of the present present invention includes using and comprises the most common inducement being known as mammary gland and infection of bone The antigen composition of antigenic determinant of microbial pathogens treat the cancer of mammary gland and bone.

This embodiment shows only to comprise for tissue the system of the antigenic determinant being modal pathogenic organisms Agent can have special advantage, also as shown in following mouse model data.Identical of views with this, the cancer of pulmonary it is positioned in treatment In disease, different from MRV, we have found that the usefulness of the enhancing of Respivax, this have answered following truth, i.e. to a certain degree Upper Respivax preparation is more preferable, because it comprises the pathogenic species of higher concentration, these species are the most normal for induction pulmonary infection See (that is, the bacteria cell count of the 67% of Respivax is by the induction modal species composition of pulmonary infection, and MRV epidemic disease Seedling only 30% is by the most common species composition of induction pulmonary infection).

According to aforementioned result, one aspect of the present invention includes preparing antigen composition to be known as the common of infection and luring The antigenic determinant of the microbial pathogens of cause is defined in formula proportion preponderates, and infects the acceptance of modal inducement Maximum advantage.Such as, from the ratio being known as infecting the antigenic determinant of the pathogen of common inducement can be 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or 100%.

Therefore, in some embodiments, other antigenic determinant any relative in compositions, the present invention provides wherein The antigen composition of the antigenic determinant of the boundary ratio that use selects according to the present invention.Such as, antigen composition can be containing big In the antigenic determinant of X%, it is from pathogenic (or Common Pathogenic or most common pathogenic) species, and wherein, X can be such as 10,20,30,40,50,60,70,80,90,95 or 100 (or any integer between 10 to 100).Such as, at antigen composition In the antigenic determinant of at least X% can be to be special to microbial pathogens, this microbial pathogens is the trouble at cancer place It is pathogenic (or Common Pathogenic or most common pathogenic) in the certain organs of person or tissue.Use antigen composition Other measuring method of the sum of middle microbial pathogens, at least X% can be selected as the specific device of the patient at cancer place It it is pathogenic (or Common Pathogenic or most common pathogenic) microbial pathogens in official or tissue.Some embodiment party In formula, antigen composition can be correspondingly mainly by the most pathogenic in the certain organs of the patient at cancer place or tissue The antigenic determinant composition of one or more microbial pathogenses.Select embodiment in, antigen composition can mainly or All by the patient at cancer place certain organs or tissue in be Common Pathogenic microbial pathogens antigen decision Son composition.In other embodiment selected, antigenicity antigen composition can mainly by or all by the trouble at cancer place It it is the antigenic determinant composition of most common pathogenic microbial pathogens (or pathogen) in the certain organs of person or tissue.

For each aspect of the present invention, organism is characterized as them for pathogenic frequency.To this, the invention still further relates to Endogenous flora is pathogenic frequency.In order to clear, to this, the sign herein of pathogenic frequency, such as " the most pathogenic " Appointment, relate generally to certain organs or tissue in infection proportion, described infection be commonly due to specific organism but not Owing to frequency used by the Microorganism colonization that metaplasia is pathogenic infection.In North America, main human infection is understood to Induced by endogenous biological body, although even these organisms are not generally to induce the shape of a part for the endogenous flora of infection Formula and exist.Such as, although streptococcus pneumoniae be the common inducement of the pulmonary infection (i.e. pneumonia) of the mankind (thus, it is intended that for lung " Common Pathogenic " in portion), but be that streptococcus pneumoniae is not generally to induce the endogenous bacterium of the respiratory tract of infection accurately Presented in the part of group, it is not thus the most the most pathogenic in endogenous field planting.

MRV for multiple myeloma

Patient S (PtS) is diagnosed as multiple myeloma (3A phase) the autumn of the 0th year, and bone scanning has Multiple Injuries, Including skull, humerus and pelvis.He has treated 6 months with standard chemotherapeutic (American and French human relations and prednisone).But, in the 3rd year December, due to his disease, he occurs in that pathologisch Bruch by femur on the right side of it, and this needs steel wire nail fixing and local is put Penetrate.On the April of the 4th year 28, PtS starts to treat with MRV, and MRV is included as the staphylococcus aureus of the common inducement of septicemia, This treatment he continue for more than 13 years until the 17th year this vaccine not in use by.Remarkably, PtS is being diagnosed as multiple bone marrow Still survive after tumor almost 25 years, it is contemplated that his " late period " diagnosis, this unexpected result really.

According to aforementioned result, one aspect of the present invention includes being comprised by administration being known as leukemogenic microorganism The antigen composition of the antigenic determinant of pathogen treats hematologic cancer.

According to aforementioned result, and as shown in report other patient cases detailed in this article, as described in this paper elsewhere, this The other side of invention relates to repeating, relatively frequently, through the administration of immunogenic composition of relatively long time period.

For having the PVF of the colon cancer of liver and abdominal lymph node transfer

Patient T (PtT) is diagnosed as colon cancer in the JIUYUE of the 0th year, and with excising its primary tumor (and subsequent chemistry Treatment) treat.After 10 months, she occurs in that hepatic metastasis, this transfer July of the 1st year by excision.Until the 7th year June, PtT still maintains a good state, and she is diagnosed as palindromia-should not start at aorta and spinous process at that time The abdominal lymph node enclosed mass of art, this plugs her left side urinary catheter, needs to insert kidney stoma.The October of the 7th year, PtT is recognized For being late period and using palliative radiation therapy.She started to treat with PVF the November 17 of the 7th year, and from this, she continued every 1 day This treatment.PtT is survived almost 4 years after being diagnosed as late recurrent transfer row colon cancer.

According to aforementioned result, one aspect of the present invention includes using comprising and is known as inducing that abdominal lymph node infects is micro- The antigen composition of the antigenic determinant of bio-pathogen treats the cancer of abdominal lymph node.

For the MRV shifted to skin and perineum

Patient U (PtU) is diagnosed as colon cancer the November of the 0th year and treats with excision primary tumor.He is in the 2nd The July in year is diagnosed as the 4th phase cancer because transferring to perineum (that is, crissum/genitals soft tissue area) and skin.He enters one Cancer as much as possible in the perineum cancer of edge (be diffused into over perform the operation) is removed in step operation, and accepts follow-up radiation and Chemo-Therapy Treat.The site of only known residual cancer is in skin and perineum.PtU started to treat with MRV the May 25 of the 3rd year, MRV comprises the staphylococcus aureus of the common inducement that skin and perineum infect, he the most persistently this treatment reach 5 months.To the greatest extent Manage the poor prognosis that he is initial, but PtU will be at 10 years being diagnosed as having after the 4th phase cancer of perineum and cutaneous metastatic more Splendid health status.

According to aforementioned result, one aspect of the present invention includes being known as in skin and perineum infecting by comprising The antigen composition of the antigenic determinant of the microbial pathogens of common inducement treats the cancer of skin and perineum.

For the PVF shifted to peritoneum

Patient V (PtV) is diagnosed as breast carcinoma the May of the 0th year, and she has carried out radical operation of mastocarcinoma and complementaryization at that time Learn treatment.The January of the 12nd year, there is abdominal pain and ascites and is diagnosed as peritoneum transfer, this diagnosis poor prognosis in her.12nd year August 5, PtV start with PVF treat, PVF comprises the escherichia coli of the common inducement of peritoneal infection, and the most persistently this is controlled for she Treat 1 year.Her tumor marker and ascites reduce, and the August of the 13rd year, i.e. PVF treated latter 1 year, and she is in order to uncorrelated Medical condition has carried out abdominal operation, and patient does not finds the evidence of any previous peritoneal cancer at that time.PtV has interrupted making of vaccine With.Shift latter 3 years 9 months being diagnosed as peritoneum in late period, PtV survival when last contact.

According to aforementioned result, one aspect of the present invention includes by comprising the micro-life being known as inducing peritoneal infection The antigen composition of the antigenic determinant of thing pathogen treats peritoneum transfer.

For ovary and the PVF of basin osteocarcinoma

Patient W (PtW) is diagnosed as 3B phase low differentiation ovarian cancer the autumn of the 0th year.She was carried out the November of the 0th year Operation, has excised left ovary, but cancer can not have been excised completely, and therefore her risk of recurrence is the highest.She has carried out whole process Postoperative chemotherapy.But, start to raise and be diagnosed as right side ovum the January of the 3rd year at the 2nd year her tumor marker The recurrence in territory, home range.She carries out this right ovary enclosed mass of excision the February of the 3rd year, but cancer still can not be accurate Really excising completely, she has carried out follow-up chemotherapy.But, at the December of the 3rd year, she occurred in that again at pelvis area Recurrence additionally and retroperitoneal lymphadenopathy.She started to use PVF vaccine therapy the January 5 of the 4th year, PVF comprise ovary and The escherichia coli of pelvic infection inducement, her lasting this treatment 6 months.She has risen to the tumor marker of 2600 and drops to The scope of 300.After being diagnosed as recurrent ovarian carcinoma 2 years 9 months, PtW was survived when last contact and feels the best. It should be noted that her tumor marker declines after PVF treatment.

According to aforementioned result, one aspect of the present invention includes being known as inducing ovary and pelvis area by comprising The antigen composition of the antigenic determinant of the microbial pathogens infected treats ovary and pelvis cancer.

MRV for follicularis non-Hodgkin lymphoma

Patient Y (PtY): be diagnosed as 4A phase follicularis non-Hodgkin lymphoma, with obvious lymph node widely Sick (that is, the lymph gland of increase).He have rejected all of conventional therapy.PtY starts to treat by MRV compositions, and MRV comprises generally Induction head and neck, axillary fossa, mediastinum and the multiple pathogens of inguinal region Lymphod infection.Additionally, he starts with taking in multiple dimension Raw element/supplement, health diet and other immune enhancing therapy are treated.He the most persistently uses this vaccine more than 3 years, that Time his size of lymph gland start to be greatly reduced and he feels good.Lymphadenopathy be dissipated in continuation, and imaging Show that previous substantial amounts of lymphadenopathy dissipates the most completely.PtY feels good and does not has appreciable lymphadenopathy: clear Obvious recovery from illness.After he is initially diagnosed as 4A phase follicularis non-Hodgkin lymphoma 5 years, the sign that PtY does not recur And live the actively life of health.The 4A phase follicularis non-Hodgkin lymphoma making him with MRV vaccine therapy is the most slow Solve.

According to aforementioned result, one aspect of the present invention include by comprising known in lymphoma region be The antigen composition of the antigenic determinant of the microbial pathogens of the common inducement of Lymphod infection treats lymphoma.

For having the PVF of the colon cancer shifted to liver and kidney

The colon cancer that patient Z (PtZ) first treats before being diagnosed as occurs that transitivity spreads, and also may with the transfer of liver There are other transfers of bilateral renal.Hepatic metastasis stove is cut.The poor prognosis of this phase (that is, the 4th phase) colon cancer and other is normal The limited benefit of rule treatment (that is, chemotherapy).PtZ initially have rejected chemotherapy.After being diagnosed as transitivity colon cancer 3 Month, PtZ starts to treat with Polyvaccinum Forte (PVF), and PVF comprises the common inducement of colon, liver and renal infection Escherichia coli.Additionally, PtZ starts to treat by multivitamin/supplement scheme and health diet.He the most persistently uses This vaccine and vitamin and supplement scheme, and start chemotherapy.Although the overall course advancement of her disease is slow, but Occur in that the recurrence of Lung metastases and hepatic metastasis, after he is initially diagnosed as 28 months of metastatic disease, his body mass stable And his energy level is good.After being diagnosed as the 4th phase colon cancer after 3 years (36 months), except relevant to chemotherapy Feel sick and outside slight weight loss, PtZ feels good.

According to aforementioned result, one aspect of the present invention include by comprising known at colon, liver and kidney be The antigen composition of the antigenic determinant of pathogenic microbial pathogens treats the cancer of colon, liver and kidney.

For having the PVF of the colon cancer to liver, hepatic portal hepatic lymph nodes and pulmonary

Patient AA (PtAA) is diagnosed as liver, portal lymph node and the transitivity colon cancer of pulmonary's transfer.This phase is (i.e. 4th phase) prognosis excessively poor (that is, " late period " cancer) of colon cancer, and the limited benefit of conventional therapy (that is, chemotherapy). PtAA starts chemotherapy, but after his diagnosis about 5 months due to side effect stopped treatment, he starts to use at that time Polyvaccinum Forte (being included in the strain that colon, liver, abdominal lymph node and pulmonary's induction are infected) treatment, every 2 days 1 Secondary, and carry out multivitamin/supplement scheme and health diet.PtAA CT scan later confirms: although two livers The size of transfer moderately grows (3.4cm to 4.5cm and 1.2cm to 3.0cm), but the portal lymph node of necrosis is made a definite diagnosis from him Shi great little does not the most change, and pulmonary's transfer size does not change.Although prognosis is excessively poor, PtAA is being diagnosed as terminal cancer Within the nearlyest 1 year, continue to feel the best.

According to aforementioned result, one aspect of the present invention includes by comprising known at colon, liver, abdominal part lymph Knot and pulmonary are that the antigen composition of the antigenic determinant of pathogenic microbial pathogens is to treat colon, liver, abdominal part pouring Fawn on the cancer with lung.

Embodiment 3: microbial pathogens

In selectable aspect, present invention utilizes if the microbial antigen of antibacterial or virus antigen is to prepare antigen group Compound, wherein, selects microbial species based on the tissue or organ at microorganism known induction infection place.Antibacterial parasitic fungi Group is modal pathogen, and it has caused the most of infection outbreak of the most animals including people.Such as, by former Send out property contact, or the mucosa injury that such as caused by blood vessel, wound, chemical damage or the infringement that caused by primary infection it After contact and invade come infection host flora.

For microbial pathogens, toxicity and infection ability be microorganism adhering, produce enzyme, (complement, anti-at immune product Body) in survival and the combination of ability of survival in the microbiocidal activity of macrophage and neutrophilic granulocyte.Including endogenous Property antibacterial some antibacterials can be enough toxicity, thus induce single microorganism and infect, other then to many microorganisms sense The synergism of dye is effective.In a word, the tool that the most individually microorganism is played in the environment of mixed infection Body effect.In some cases, owing to actute infection can provide more suitably immunostimulation, therefore, at some embodiments In, present invention utilizes the microbial species relevant with actute infection.

In some embodiments, the antibacterial for the endogenous flora member of specific region may be used for preparing the present invention's Antigen composition.The ranks of table 6 go out many bacterial species can form endogenous flora together with biotic district, each of which species A part.Such as, weary bacteria is the prototypical member of endogenous flora in respiratory tract and oral cavity.

Table 6: the common flora of human bacterial (endogenous bacteria human pathogen)

Endogenous microbes flora such as antibacterial for pathogeny by send out continuously or bacteremia send out and Arrive tissue.Under advantage, the organic physical ability of all endogenouss becomes pathogenic, and local invades and passes through to broadcast continuously Dissipate and send out to neighbouring tissue and organ.The endogenous bacteria flora of skin, oral cavity and colon is interpreted to can be used for The species that bacteremia is sent out.The group thus can be able to sent out on these antibacterials for the antibacterial of specific endogenous flora territory member Knit or in organ, induction is infected.Therefore, one aspect of the present invention includes the treatment of endogenous microbes pathogen wherein this is endogenous Property antibacterial can send out the purposes of cancer of tissue or the organ infected with induction.The row of table 7 list 9 of endogenous flora Region: skin, respiratory system, genitals, GU system, oral cavity, Stomach duodenum/jejunum, ileum and colon.The ranks of table 7 go out The organ or tissue that cancer is likely to be at.Therefore, an aspect of of the present present invention includes that endogenous microbes pathogen is anti-to prepare Former compositions or selection have the existing preparation of pathogen and are positioned at pathogen for treatment and can send out and induce the group of infection Knit or the purposes of cancer of organ.Therefore, in alternative embodiment, it is positioned at tissue or device that the first row of table 7 is listed The tumor of official can be with comprising the antigen composition treatment that microbial pathogens is specific antigenic determinant, described micro-life Thing pathogen is the member of the endogenous flora in one or more endogenous flora territories that the first row of table 7 is listed, and by X or check mark in suitable row represent.Such as, it is positioned at intraprostatic tumor and can internally come from GU system with comprising System and/or the microbial pathogens of reproductive system or the treatment of antigen composition that pathogen is specific antigenic determinant.? In table 6, list the quantity of the bacterial species coming from endogenous flora territory in listing in table 7 and corresponding endogenous flora Territory.Therefore, one aspect of the present invention includes the antigen group using the antigenic determinant being included in table 6 bacterial species listed Compound treats the cancer being positioned at the tissue that table 7 is listed, the region of endogenous flora relevant to tumor sites the most in table 7 Match to endogenous flora region relevant with bacterial species in table 6.

Table 7: the tissue/organ of endogenous flora is pathogenic

* antibacterial by sending out continuously (×) or send out () arrival tissue/organ by bacteremia.

According to the combined information of table 6 and 7, the cancer being positioned at the tissue shown in the 1st row of table 7 or organ can be by comprising The antigen composition treatment of the antigenic determinant of the corresponding bacterial species of table 6, in order to the column heading of table 7 can essentially be by table 6 Bacterial species substitute.

In some embodiments, the microbial pathogens for the present invention can be Exogenous bacteria pathogen.Such as, The organism listed in table 8 can serve as microbial pathogens to prepare antigen composition, or can select have those The antigen composition of pathogen, thus the cancer of tissue or the organ listed by the related organisms of table 8 it is positioned at for treatment.? In some embodiments, targeting particular organization or the endogenous of organ and the antigen of Exogenous bacteria species can be used in combination Determiner.Such as, it is derived from clostridium difficile or it be may be used for treatment for specifically antigen composition is positioned at knot The cancer of intestinal.

Table 8: Exogenous bacteria human pathogen and sites of infection thereof

In some embodiments, the microbial pathogens for the present invention can be viral pathogen.Table 9 provides disease Viral disease substance is together with it is reported that the illustration of tissue that each viral species is pathogen and organ is enumerated.Therefore, the one of the present invention Aspect includes using specifying virus to be positioned at the Virus Name side of Fig. 9 really for specifically immunogenic composition with treatment The cancer of fixed organ or tissue.Such as, it is derived from vaccine virus or it be may be used for treatment for specific antigen composition It is positioned at the cancer of skin, blood tissues, lymph node, brain, spinal cord, eye or heart.

Table 9: virus human pathogen and sites of infection thereof

The cumulative information of table 6 to table 9 provides the extensive of the microbial pathogens of the antigen composition that can be used for the present invention Determining, together with the determination that wherein these organisms are pathogenic tissue or organ, and correspondingly determine can be by antigen system The tissue that is positioned at of wherein cancer of agent treatment or organ.

In some embodiments, the microbial pathogens selected for using in antigen composition of the present invention can be The tissue being positioned at by cancer to be treated or the pathogen of the common inducement of the actute infection of organ.Table 10 determines such The antibacterial of type and viral pathogen are together with wherein they generally induce the tissue infected and organ.Therefore, selected embodiment party In case, belonging to the cancer in the tissue determined in the first row of table 10 can be listed the secondary series at table 10 by comprising One or more pathogenic organisms are the antigen composition treatment of antigenic determinant.Such as, the cancer belonging to skin can be by The antigen composition of the antigenic determinant comprising one or more following organisms is treated: staphylococcus aureus, β hemolytic chain Coccus A, B, C and D group, diphtheria corynebacterium, corynebacterium ulcerrans, Pseudomonas aeruginosa, Measles virus, rubella virus, varicella Herpesvirus, echovirus, Coxsackie virus, adenovirus, virus vaccinicum, herpes simplex virus or assays for parvovirus B 19.

Table 10: the common inducement of the actute infection (bacillary and viral) in various tissue/organ sites

In the embodiment selected, specific microbial pathogens is applicable to the treatment of particular cancers, in table 10 List the example of selected embodiment.These are exemplary, are not alternative system used according to the invention Agent exhaustive.

The specific organism generally inducing infection in particular organization or organ can be changed by geographical position.Such as, Mycobacterium tuberculosis is the ratio pulmonary infection inducement more conventional in other regions and population in some geographic areas and population, because of This, although mycobacterium tuberculosis is geographical at some and plants not common lung pathogen in group and it is probably in other groups Common lung pathogen.Therefore, table 10 is not all geographical position and common causative exhaustive planting group.It should be understood that It is that, for particular organization or the organ site of the present invention, this area general Clinical microorganism scholar can determine that in specific geographic district Common Pathogenic species in territory or kind group.For veterinary purpose, there are certainly in the selected tissue of selected species common Special pathogen, and this can also change geographically.

In selected embodiment, the present invention include diagnosis algorithm with evaluate patient to microbial pathogens front cruelly Dew.Such as, diagnosis algorithm can include obtaining and is exposed to the medical history of selected pathogen and/or evaluates patient to selected pathogen Immunne response.For example, it is possible to carry out serological test to detect the antibody of the selected pathogen in patients serum.For this This respect of invention, can have the one or many Diagnostic indicator in front exposure to pathogen based on patient, such as The antigen of selected microbial pathogens is selected by the existence of the antibody of the antigenic determinant of this pathogen in patients serum Determiner is for the immunogenic composition to selected patient.

In embodiment selected by other, the present invention includes that diagnosis algorithm is to evaluate patient to using selected immunogenicity group The immunological response of the treatment of compound.Such as, diagnosis algorithm can include evaluating patient's antigen to this immunogenic composition The immunne response of determiner, such as, use serological test to determine the antibody of those antigenic determinants.The present invention is somebody's turn to do Aspect, if evaluating the active immunity response showing to there is the antigenic determinant to said composition, then can be continuing with institute Select the treatment of immunogenic composition, and if evaluate show not exist the foot of the antigenic determinant to immunogenic composition Enough immunological responses actively, then can interrupt vaccine therapy, and can begin to use different immunogenic composition can Replacement therapy.

As patient R is discussed, in the embodiment selected, select for antigen composition of the present invention is micro- Bio-pathogen can be the modal pathogen inducing actute infection in the tissue or organ at cancer place to be treated, this Can provide as the case of patient R proved particular benefits.Such as, for the treatment of osteocarcinoma, staphylococcus aureus can For selected strain；For the treatment of cancer in lung tissue, streptococcus pneumoniae can be selected；For the treatment of breast carcinoma, gold can be selected Staphylococcus aureus；For kidney or the treatment of the cancer of bladder, escherichia coli can be selected strain；Colon cancer is controlled Treating, escherichia coli can be selected strain.It should be understood that the Clinical microorganism scholar of this area can be true according to the present invention Fixed for each particular organization or the modal pathogenic species of organ, i.e. antibacterial or virus.In the embodiment selected, The antigenic determinant of the most commonly encountered diseases substance only having particular organization or organ can be used for treating the cancer of this tissue or organ.? In selectable embodiment, the antigenic determinant of the most commonly encountered diseases substance of particular organization or organ can be specific at this with known In tissue or organ, the antigenic determinant for other pathogenic pathogen is applied in combination, it is preferred that other pathogen are selected from More conventional pathogen.

In some embodiments, other antigenic determinant any relative in compositions, the present invention provides and wherein uses The antigen composition of the antigenic determinant according to the boundary ratio selected by the present invention.Such as, antigen composition can be containing being more than The antigenic determinant of X%, it is from pathogenic (or Common Pathogenic or most common pathogenic) species, and wherein, X can be such as 10,30,40,50,60,70,80,90,95 or 100 (or any integer between 10 to 100).Such as, in antigen composition The antigenic determinant of at least X% can be to be special to microbial pathogens, and this microbial pathogens is the patient at cancer place Certain organs or tissue in be pathogenic (or Common Pathogenic or most common pathogenic).Use in antigen composition Other measuring method of the sum of microbial pathogens, at least X% can be selected as the certain organs of the patient at cancer place Or be pathogenic (or Common Pathogenic or most common pathogenic) microbial pathogens in tissue.At some embodiments In, antigen composition can correspondingly mainly by the most pathogenic in the certain organs of the patient at cancer place or tissue (or The most pathogenic or the most pathogenic) one or more microbial pathogenses antigenic determinant composition.Following data shows Go out the surprising usefulness of preparation selected by these:

(1) (it comprises many common respiratory pathogens and most common for mammary gland and bone to find to use MRV The staphylococcus aureus of pathogen) contribute to treating the breast carcinoma (see Fig. 6) having to Bone tumour.But, survival benefit (with The survival ratio of the patient of unused MRV treatment relatively, with the survival of patient of MRV treatment) be medium (that is, with unused vaccine therapy The median survival of 26 months of patient compare, the median survival with 31 months of the patient of vaccine therapy).On the other hand, make With the vaccine of selectively targeted breast carcinoma and osteocarcinoma, (that is, containing only staphylococcus aureus, it is the most normal that mammary gland and bone infect The inducement seen) patient (patient R) that treats has significant survival benefit, and survival was more than 17 years.MRV comprises not Induction (or being far from typically inducing) infection of bone and generally induce other strain infected elsewhere (i.e. respiratory tract) and seem essence On reduce this vaccine to mammary gland and the benefit of the treatment of cancer of bone.

(2) Respivax is used^TMSurvival (that is, the median survival of 38 months and the 5 of 40% of the 3B phase patients with lung cancer for the treatment of Year survival) substantially greater than with survival (that is, the median survival of 18 months and the 5 of 14% of the 3B phase patients with lung cancer of MRV treatment Year survival).Respivax^TMActually contain the strain generally causing pulmonary infection than MRV higher concentration.Respivax^TMCarefully Bacterium Cytometric 67% is made up of the strain generally inducing pulmonary infection, and the 30% of MRV bacteria cell count is by leading to The often strain composition of induction pulmonary infection.Therefore, the combination of the modal antibacterial of the induction pulmonary infection containing larger proportion Thing, i.e. Respivax^TM, show the treatment to pulmonary carcinoma than MRV treatment more effectively.

(3) the unused epidemic disease of survival ratio of the 4th phase colorectal cancer patients treated with MRV (it does not contains any colon disease substance) The patient's of Seedling treatment is worse.This shows to use and is not from the organ or tissue of cancer place as pathogenic microorganism It is invalid that the treatment of antigenic determinant is not only, but also may deteriorate.

(4) Muridae research is illustrated below, and especially, is used together Klebsiella pneumonia with together with other antigen Treatment is compared, and cancerous cell model data relates to only with the treatment of Klebsiella pneumonia antigenic determinant.

Therefore, number use herein is derived from certain organs or is organized as the targeting antigen combination of pathogenic microbial pathogens Thing, according to providing for treatment is in this certain organs or in-house cancer, from pathogenic to the most pathogenic to the most logical The most pathogenic evidence increasing gradual change.

In some embodiments, through consulting table 6 to 10, by selecting the certain organs containing the patient at cancer place Or be the vaccine of pathogenic pathogen (or antigenic component of antigen) in tissue, the present invention includes that use is ratified for other The antibacterial of purpose or virus type vaccine (such as, poliomyelitis vaccine, Haemophilus influenzae vaccine, meningococcus vaccine, lung Scorching coccus vaccine, influenza virus vaccine, hepatitis B vaccine, Hepatitis A Vaccine, diphtheria vaccine, tetanus vaccine, pertussis Vaccine, Measles Vaccine, Mumps Vaccine, rubella vaccine, chickenpox vaccine, BCG vaccine, cholera vaccine, Japanese encephalitis's epidemic disease Seedling, rabies vaccine, antityphoid vaccine, yellow fever vaccine, antismallpox vaccine etc.) for use as treatment of cancer.Such as, streptococcus pneumoniae epidemic disease Seedling, complete cell vaccine or by one or more antigenic components (such as, pneumococal polysaccharide-23-of streptococcus pneumoniae Valency) vaccine that forms, can be used for treating the cancer in any following site, streptococcus pneumoniae is arranged in this site the most in table 10 Pathogen for common: hilar lymph node, hematological cancer, bone, meninges, spinal cord, eye/eye socket, hole, thyroid, a gas Pipe, pulmonary, pleura or peritoneum.As another example, hepatitis B virus vaccine can be used for treating the cancer in any following site, In table 9, hepatitis B virus is listed in pathogen in this site: liver, pancreas or hematological cancer.

In some embodiments, selected compositions and method are specifically got rid of from the scope of the present invention.Such as, from some Embodiment is got rid of in the treatment of following cancer, uses following microbial pathogens, in order to invention required for protection is permissible Extend to specific embodiment (except following one or more):

A) such as by injection BCG (Mycobacterium bovis) treatment gastric cancer and colon cancer；

B) such as pulmonary carcinoma is treated by injection mycobacteria w；

C) such as nonsmall-cell lung cancer is treated by injection mycobacterium vaccae；

D) such as melanin stream is treated by injection coryne bacterium parvum；

E) such as gastric cancer is treated by injection streptococcus pyogenes；

F) such as by injection nocardia rubra treatment pulmonary carcinoma or acute myelogenous leukemia；

G) such as cervical cancer is treated by injection lactobacillus casei；

H) such as by injection Pseudomonas aeruginosa treatment lymphoma and pulmonary carcinoma；

I) such as melanoma is treated by injection virus vaccinicum；

J) such as melanoma is treated by injection rabies virus；

K) such as by oral administration the compositions being made up of the combined antigen of following strain is used for animal (or, can Selectively, to people) constitutional (or, selectively, the transitivity) cancer that is positioned at pulmonary treats: streptococcus pneumoniae；Mucositis Neisseria gonorrhoeae；Streptococcus pyogenes；Hemophilus influenza；Staphylococcus aureus；Klebsiella pneumonia.

L) such as by oral administration the compositions being made up of the combined antigen of following strain is used for animal (or, can Selectively, to people) constitutional (or, selectively, the transitivity) cancer that is positioned at pulmonary treats: streptococcus pneumoniae；Mucositis Neisseria gonorrhoeae；Streptococcus pyogenes；Hemophilus influenza；Staphylococcus aureus；Klebsiella pneumonia；Ozena citric acid Bacterium (Klebsiella ozaenae)；Streptococcus viridans.

Embodiment 4: Muridae research

In following Muridae research, use following common materials: PBS (Gibco), and mice is that 7 week old are female C57BL/6。

Embodiment 4A: the cancer of pulmonary

This part relates to Lewis lung cancer mouse model.As follows for the bacterial vaccine of this experiment: streptococcus pneumoniae [cell And meat soup] vaccine (lot#J049-1 [2 × 10⁹]；Klebsiella pneumonia [cell and meat soup] vaccine (lot#J046-1 [2 × 10⁹]；Staphylococcus aureus [cell and meat soup] vaccine (lot#J041-2 [10 × 10⁹]；Escherichia coli (colon separator) [cell and meat soup] vaccine (lot#J047-1 [6 × 10⁹]；Salmonella enteritidis [cell and meat soup] vaccine (lot#J31 [15 × 10⁹]；Klebsiella pneumonia [only cell] vaccine (lot#J048-1 [2 × 10⁹]；And only culture medium (kerekou pneumonia primary Salmonella culture medium) (lot#J046-1).Mice is treated in experiment packet according to table 11 definition.

Table 11: the experiment packet of mice model of lung cancer

Specifically, the-10th ,-8 ,-6 ,-4 and-2 days by bacterial vaccine subcutaneous pretreatment of mice group.At the 0th day, use Lewis lung cancer cell (Cedarlane lot#508714) vein of 10e5 dosage excites mice.Hereafter, epidemic disease is every other day used Seedling injection carrys out subcutaneous treatment mice, continues duration of experiment defined in table 11.Only use medium treatment matched group.Every 4 days Measure the weight of animals and carry out record.When mice starts to occur morbidity, terminate experiment.Hereafter, by genuine for all mice people Put to death, and pulmonary surgery is removed and weighs.Pulmonary is positioned in the bottle with Buoin liquid, and in each group Lung neoplasm quantity count.These results illustrate in table 12.The representative instance of these pulmonarys describes in fig. 14.

Table 12: the quantity of the obvious lung tumor of the mice of each group

Then, by with the mouse lung weight of tumor cell injection with only with PBS injection mouse lung weight compared with, from And measure tumor load and the curative effect of vaccine therapy thus.These results are shown in table 13.

Table 13: by the Mean pulmonary weight of the mice killing bacterial vaccine immunity in vein implants Lewis lung cancer model (mg) and tumor weight suppression (compared with the control)

Embodiment 4B: skin carcinoma

This part relates to the mouse model of skin carcinoma.As follows for the bacterial vaccine of this experiment: streptococcus pneumoniae [cell and Meat soup] vaccine (lot#J049-1 [2 × 10⁹]；Klebsiella pneumonia [cell and meat soup] vaccine (lot#J046-1 [2 × 10⁹]；Staphylococcus aureus [cell and meat soup] vaccine (lot#J041-2 [10 × 10⁹]；Escherichia coli (colon separator) [cell and meat soup] vaccine (lot#J047-1 [6 × 10⁹]；Salmonella enteritidis [cell and meat soup] vaccine (lot#J31 [15 × 10⁹]；Staphylococcus aureus [only cell] vaccine (lot#J041-2 [10 × 10⁹]；And only culture medium (golden yellow Portugal Grape coccus culture medium) (lot#J041-1).Mice is treated in experiment packet according to table 14 definition.

Table 14: the experiment packet of skin carcinoma mouse model

Specifically, the-10th ,-8 ,-6 ,-4 and-2 days by bacterial vaccine subcutaneous pretreatment of mice group.At the 0th day, with 2 × B16 melanoma cell (the lot#3995448 of 10e6 dosage；ATCC CRL-6323) vein excites mice.Hereafter, Mei Geyi It carrys out subcutaneous treatment mice with vaccine injection, continues duration of experiment defined in table 14.Only use medium treatment matched group. Within every 4 days, measure the weight of animals and carry out record.Once tumor can perception, then using caliper, every other day to measure tumor straight Footpath.When mice starts occur that morbidity or the diameter of tumor of arbitrary group reach 20mm, terminate experiment.Hereafter, by all mice people Genuine execution.The average external volume of tumor figure 15 illustrates present in the group of mice described herein.

Embodiment 4C: colon cancer

This part relates to the mouse model of colon cancer.As follows for the bacterial vaccine of this experiment: streptococcus pneumoniae [cell and Meat soup] vaccine (lot#J049-1 [2 × 10⁹]；Klebsiella pneumonia [cell and meat soup] vaccine (lot#J046-1 [2 × 10⁹]；Staphylococcus aureus [cell and meat soup] vaccine (lot#J041-2 [10 × 10⁹]；Escherichia coli (colon separator) [cell and meat soup] vaccine (lot#J047-1 [6 × 10⁹]；Escherichia coli (prostate separator) [cell and meat soup] vaccine (lot#J040-2[6×10⁹]；Salmonella enteritidis [cell and meat soup] vaccine (lot#J31 [15 × 10⁹]；And it is only cultivation Base (Escherichia coli culture medium) (lot#J040-1).Mice is treated in experiment packet according to table 15 definition.

Table 15: the experiment packet of colon cancer mouse model

Specifically, the-10th ,-8 ,-6 ,-4 and-2 days by bacterial vaccine subcutaneous pretreatment of mice group.At the 0th day, with 2 × MC-38collo adenocarcinoma cell (by Dr.Jeff Schlom Lab, the NCI gives) intraperitoneal of 10e5 dosage excites mice.This After, every other day carry out subcutaneous treatment mice with vaccine injection, continue duration of experiment defined in table 15.Only use at culture medium Reason matched group.Observe the following clinical factor of mice: body weight, sense of touch be cold, diarrhoea, rapid breathe, close one's eyes, movable reduce, piloerection And tic.When mice starts to show clinical onset signal, put to death human for mice and this sky is defined as dead day.Should The survival data of experiment describes in figure 16.

Additionally, calculate the health included in this embodiment to morbidity/death in defined the 29th day tested of table 16 Mice.

Table 16: healthy to morbidity/dead group marking * *

* health=10 points；It is only tumor=5 point；Tumor+ascites=2 point；And dead=0 point.

The survival of each mice group that table 17. is tested from colon cancer is summed up

* MST median survival time

* ILS is the increase of vital stage compared with matched group

* * compares with the matched group of placebo treatment

Total comparison survival:

Logarithm order (Mantel Cox) p=0.001

Breslow (broad sense rank test) p=0.003

Tarone-Ware p=0.002

Embodiment 4 is summed up

Skin model:

For the group treated by staphylococcus aureus (only cell), there is notable treatment advantage.This research shows to kill The staphylococcus aureus the gone out effectiveness to the skin cancer treatment of mouse model, is the skin of mice with staphylococcus aureus Infect most common inducement the fact consistent.For slowing down or suppress tumor growth, data and the immunogenicity using the present invention Compositions is consistent.Be only aureus cell vaccine (wherein by centrifuge cell and meat soup remove culture medium and Extracellular toxin, thus only collect cell, then reconstruct with normal saline) than aureus cell and meat soup vaccine (its bag Containing culture medium and extracellular toxin) more effectively.This is possibly due to staphylococcus aureus extracellular toxin suppression immunologic function, such as, can kill Go out the leukocidin of leukocyte.Therefore, the present invention includes wherein from the immunomodulating produced by objective microbe pathogen Compound separates the embodiment of the antigenic determinant of immunogenic composition to be used for.

Lung model:

The data represented in this embodiment show the immunogenic composition that there is use from Klebsiella pneumonia Parenchyma suppression, consistent for the fact that this is the common inducement of mouse lung infection with Klebsiella pneumonia.Mice In (but generally not mankind), Salmonella enteritidis can induce pneumonia, this and the useful work of this vaccine in mouse lung model With unanimously.Being that the mankind of common pulmonary pathogen are different from streptococcus pneumoniae, streptococcus pneumoniae is in the pulmonary pathogen of mice It is relatively rare (although streptococcus pneumoniae can induce pneumonia in mice).Escherichia coli and staphylococcus aureus can be little Inducing pulmonary infection in Mus singularly, this is consistent in gentle benefit shown in this article with them.This embodiment shows the lung killed Scorching citric acid bacteria vaccine is significantly efficiently used for treating the pulmonary carcinoma of mice, specifies that wherein immunogenic composition comprises It is only the embodiment (seeing 2 groups to 6 groups) of the antigen of most common pathogenic organisms.

Colon models:

Salmonella enteritidis is gastrointestinal and the most common inducement of intraperitoneal infection of mice, this and the gastrointestinal treatment mice Consistent with the beneficial effect shown in this article of intraperitoneal cancer.

(i.e. Salmonella enteritidis, escherichia coli, golden yellow Fructus Vitis viniferae in the immunogenic composition used in this embodiment Coccus, Klebsiella pneumonia, streptococcus pneumoniae), Salmonella enteritidis is modal mice g.i./intraperitoneal pathogen. Escherichia coli are second modal mice g.i./intraperitoneal pathogen.Staphylococcus aureus and Klebsiella pneumonia energy Find with a part of colonic microflora form, and g.i./intraperitoneal infection can be induced, although being far from common.Streptococcus pneumoniae Do not induce g.i./intraperitoneal to infect.Accordingly, Salmonella enteritidis vaccine shows the essence in this mouse colon tumors model Property benefit, bacillus coli vaccine shows moderate benefit, staphylococcus aureus and Klebsiella pneumonia vaccine and shows gently Spend benefit, and streptococcus pneumoniae shows and is no advantage.In the mankind, Salmonella species induction g.i. infects, thus, Can anticipate that Salmonella enteritidis and other salmonella vaccine contribute to treating the colon cancer of the mankind.

Embodiment 5: animal model

Embodiment 5A: illustrate the heat inactivation Klebsiella pneumonia antigen composition monocyte/macrophage to mice Impact with dendritic cell population

Following method and material are for this embodiment:

Mice is studied for these, female from the C57BL/6 of Harlan Labs (Livermore, CA) predetermined 7-8 week old Mice.

Antibody and reagent following antibody are for this embodiment: anti-I-A/I-E FITC (MHC II type；M5/114.15.2)； Anti-Gr-1PE (RB6-8C5)；Anti-CD11b PerCP-Cy5 (M1/70)；Anti-CD11c APC (N418)；Anti-CD4FITC (GK1.5)；Anti-NK1.1PE (PK136)；Anti-CD8a eFluor780 (53-6.7)；Anti-CD44APC (IM7).From EBioscience (San Diego, CA) obtains all antibody.Liberase TM and DNAse I is obtained from Roche.All trainings Support base from HyClone (Fisher).

The kerekou pneumonia in the PBS comprising 0.4% phenol, the heat with phenol killed with the treatment of antigen composition Primary Salmonella (KO12 [5.0OD600 unit]) dilution 1/10, and at the 0th, 2,4 and 6 days to 4 mouse subcutaneous injection 100 μ l. With PBS injection control mice (n=5) in the 0th, 2,4 and 6 days.

Bronchoalveolar lavage put to death mice at the 7th day, and was inserted into being connected with 1ml syringe by exposing trachea 22G conduit carry out bronchoalveolar lavage (BAL).The PBS of 1ml is injected pulmonary and excises, and it is micro-to be placed on 1.5ml In type centrifuge tube.Wash pulmonary successively more than 3 times with the PBS of 1ml, and merge liquid.By from the first of each mice Secondary cleaning mixture is centrifugal under 400xg, and freezing supernatant is for cytokine analysis.The irrigating solution of last 3ml is centrifuged, And cell is merged with the cell mass from first time lavation.To cell counting and with to MHC II type, Ly6G/C, CD11b and CD11c specifically antibody staining.After dyeing, washed cell on FACS Calibur flow cytometer point Analysis.

Pulmonary digests after carrying out BAL, is placed on by lung containing 417.5 μ g/ml Liberase TL (Roche) and 200 μ In the 5ml RPMI of g/ml DNAse I (Roche).Then, at 37 DEG C, lung is digested 30 minutes.After digestion, lung is made to pass through 70um cell filter is to produce single cell suspension.Then by cell centrifugation, wash, be resuspended in FACS buffer (tool Have the PBS of 2%FCS and 5mM EDTA) and count.After counting, by antigen identical with BAL cell to cell dyeing use By facs analysis.

Peritoneal lavage, after BAL, uses the 1ml syringe being connected with 25G syringe needle, and the PBS of 1ml injects the abdomen of mice Film.Rub abdominal part 1 minute, and use 1ml pipet to reclaim the PBS of 0.5ml from peritoneum.Irrigating solution is put into 1.5ml be centrifuged Pipe, is centrifuged 5 minutes with 400xg, and is resuspended in FACS buffer before dyeing and facs analysis.

Spleen and Lymph node analysis remove spleen and draining lymph node after BAL and peritoneal lavage, and are placed on PBS. Smashed to pieces by 70 μm cell filters (Fisher) and destroy spleen, and use the rubber ends of thromboembolism from 1ml syringe Destroy lymph node.After destroying, by being centrifuged from the single cell suspension of spleen and lymph node, wash with FACS buffer Wash once, and be resuspended in FACS buffer before counting, dyeing and facs analysis.

Facs analysis uses 50 μ l antibody of dilution in FACS buffer, and cell dyes in 96 orifice plates 20 on ice Minute.After 20 minutes, in hole, add the FACs buffer of 100 μ l, and plate is centrifuged 5 minutes with 400xg.Subsequently, Remove culture medium, and with FACS buffer solution cell more than 1 time.After final washing, cell is resuspended in 200 μ l FACS buffer in, and use FACS Calibur flow cytometer (BD) obtain data.For except all samples of BAL Product collect minimum 20,000 live event, wherein collect minimum 5,000 event for BAL.

Obtain following results in this embodiment.

There is no the normal mouse of tumor with the treatment of Klebsiella pneumonia antigen composition at the 0th, 2,4 and 6 days.The 7th My god, by sacrifice and to analyze bronchoalveolar lavage fluid, lung tissue, peritoneal lavage, lymph node and spleen thin at monokaryon Change in terms of born of the same parents and macrophage.Acute inflammation is defined by the high expressed of CD11b with Gr-1 (labelling identical with Ly6c) Property blood mononuclear cell/macrophage quantity increase, and observe the F4/80 of lymph node drain, i.e. Klebsiella pneumonia The injection site (seeing, Figure 17 A) of antigen composition.These acute inflammatory monocyte/macrophages are also expressed the highest The MHC II type molecule of level, shows the exposure to cellular antigens.Importantly, treat with Klebsiella pneumonia antigen composition Mice 1 week, causes in the bronchoalveolar lavage fluid of the mice treated and the acute inflammatory in pulmonary's (i.e. target organs) The increase of mononuclear cell frequency, but then do not have in spleen or peritoneum, shows that treatment can induce special to pulmonary of mononuclear cell Property return and do not affect other organ (seeing Figure 17 B).Mononuclear cell can be dendritic cell (DC) at lung differentiation, and with Our observation is consistent, i.e. dramatically increases in monocyte recruitement, it was further observed that at the cell frequency of the labelling representing ripe DC (seeing: Figure 17 C) is dramatically increased in terms of rate.

As shown in figure 17, treat 7 days with Klebsiella Pneumoniae antigen composition, cause the acute inflammatory at mouse lung Mononuclear cell and dramatically increasing in dendritic cell (with compared with placebo=PBS treatment).As shown in figure 17, the 0th, 2, Within 4 and 6 days, treat mice with Klebsiella Pneumoniae antigen composition or PBS.At the 7th day, by sacrifice, and by pulmonary A is measured with the flow cytometer of spleen) and B) struvite mononuclear cell (CD11b+Gr-1+ cell) and C) dendritic cell The sum of (CD11c+MHC II+ type cell).At A) error bars that represents represents the meansigma methods often organizing 4-5 mice.

Embodiment 5B illustrates Klebsiella pneumonia antigen composition and the combination of heat inactivation bacillus coli antigen of heat inactivation Thing monocyte/macrophage, dendritic cell and the impact of effector cell population on mice

Following method and material are for this embodiment:

Mice. these are studied, female from the C57BL/6 of Harlan Labs (Livermore, CA) predetermined 7-8 week old Mice.

Antibody and reagent. use following antibody: anti-I-A/I-E FITC (MHC II type；M5/114.15.2)；Anti-Gr- 1PE(RB6-8C5)；Anti-CD11b PerCP-Cy5 (M1/70)；Anti-CD11c APC (N418)；Anti-CD4FITC (GK1.5)； Anti-NK1.1PE (PK136)；Anti-CD8a eFluor780 (53-6.7)；Anti-CD44APC (IM7).From eBioscience (SanDiego, CA) obtains all antibody.Liberase TM and DNAse I is obtained from Roche.All culture medium from HyClone(Fisher)。

With the treatment of antigen composition. the kerekou pneumonia in the PBS comprising 0.4% phenol, the heat with phenol killed Primary Salmonella (K.pneumoniae；lot KO12；5.0OD600 unit]) dilution 1/10, and little to 5 at the 0th, 2,4 and 6 days Sub-cutaneous injections 100 μ l.In comprising 0.4% phenol, the escherichia coli (lot that heat is killed；5.0OD600 unit]) dilution 1/ 10, and at the 0th, 2,4 and 6 days to 5 mouse subcutaneous injection 100 μ l.Control mice (n was injected at the 0th, 2,4 and 6 days with PBS =5).

Bronchoalveolar lavage. put to death mice at the 7th day, and be inserted into 1ml syringe even by exposing trachea The 22G conduit connect is to carry out bronchoalveolar lavage (BAL).The PBS of 1ml injected pulmonary and excises, and being placed on 1.5ml In micro centrifuge pipe.Wash pulmonary successively more than 3 times with the PBS of 1ml, and merge liquid.By from the of each mice Once washing liquid is centrifugal under 400 × g, and freezing supernatant is for cytokine analysis.Irrigating solution by last 3ml Centrifugal, and cell is merged with the cell mass from first time lavation.To cell counting and with to MHC II type, Ly6G/ C, CD11b and CD specifically antibody staining.After dyeing, washed cell on FACS Calibur flow cytometer point Analysis.

Pulmonary digests. after carrying out BAL, lung is placed on containing 417.5 μ g/ml Liberase TL (Roche) and 200 In the 5ml RPMI of μ g/ml DNAse I (Roche).Then, at 37 DEG C, lung is digested 30 minutes.After digestion, lung is made to pass through 70 μm cell filters are to produce single cell suspension.Then by cell centrifugation, wash, be resuspended in FACS buffer (tool Have the PBS of 2%FCS and 5mM EDTA) and count.After counting, by cell dyeing and use the antigen identical with BAL cell by Facs analysis.

Peritoneal lavage. after BAL, use the 1ml syringe being connected with 25G syringe needle, the PBS of 1ml is injected mice Peritoneum.Rub abdominal part 1 minute, and use 1ml pipet to reclaim the PBS of 0.5ml from peritoneum.Irrigating solution is put into 1.5ml from Heart pipe, is centrifuged 5 minutes with 400xg, and is resuspended in FACS buffer before dyeing and facs analysis.

Spleen and Lymph node analysis. after BAL and peritoneal lavage, remove spleen and draining lymph node, and be placed on PBS. Smashed to pieces by 70 μm cell filters (Fisher) and destroy spleen, and use the rubber ends of thromboembolism from 1ml syringe Destroy lymph node.After destroying, by being centrifuged from the single cell suspension of spleen and lymph node, wash with FACS buffer Wash once, and be resuspended in FACS buffer before counting, dyeing and facs analysis.

Facs analysis. use 50 μ l antibody of dilution in FACS buffer, in 96 orifice plates, cell is dyeed on ice 20 minutes.After 20 minutes, in hole, add the FACs buffer of 100 μ l, and plate is centrifuged 5 minutes with 400 × g.With After, remove culture medium, and with FACS buffer solution cell more than 1 time.After final washing, cell is resuspended in In the FACS buffer of 200 μ l, and FACS Calibur flow cytometer (BD) is used to obtain data.For except BAL's All samples collects minimum 20,000 live event, wherein collects minimum 5,000 event for BAL.

Obtain following results in this embodiment:

As shown in figure 18, combined with Klebsiella pneumonia antigen composition, bacillus coli antigen at the 0th, 2,4 and 6 days Thing or PBS process mice.At the 7th day, by sacrifice, and by stream in peritoneal lavage, pulmonary, lymphoid tuberculosis spleen Formula cell instrument measures struvite mononuclear cell (CD11b+Gr-1+ cell) and dendritic cell (CD11c+MHC II+ type cell) Sum.Error bars in figure 18 represents the standard deviation from 5 mices.Student ' s t-is used to test, * p-value < .05

Figure 18 illustrates and treats with the treatment of Klebsiella pneumonia antigen composition rather than bacillus coli antigen compositions, aobvious Write and add the mononuclear cell of mouse lung and the quantity of DC.Compared with pulmonary, Klebsiella pneumonia does not results in the abdomen of mice The monocytic increase of film, escherichia coli then result in this situation.Importantly, with Klebsiella pneumonia or large intestine bar In the spleen of the mice of bacterium treatment, only exist the slight increase increased and there is not DC of struvite amount of mononuclear cells, table Bright therapeutical effect is not general, and the most site-specific to certain organs.Except considering mouse lung Struvite mononuclear cell and the therapeutical effect of DC, it is also contemplated that the change in other cytokine, such as cytotoxin Cd8 t cell, CD4T auxiliary cell and NK cell (NK), all may play a role in antineoplastic immune.

Figure 19 illustrates Klebsiella pneumonia antigen composition rather than PBS or bacillus coli antigen compositions cause in treatment Mouse lung in the frequency of NK cell, CD4 and cd8 cell and dramatically increasing of sum.This embodiment is our general knowledge Primary illustrate, the most generally the subcutaneous injection killing strain of induction pulmonary infection the leukocyte of pulmonary can be promoted to assemble and in this position There is not any inflammation in point.Additionally, we also illustrate that this effect specificity to target site, and it is also to treatment used Bacterial component be specific.

As shown in figure 19, combined with Klebsiella pneumonia antigen composition, bacillus coli antigen at the 0th, 2,4 and 6 days Thing or PBS process mice.At the 7th day, mice was condemned to death, and by flow cytometer measure cd4 t cell, cd8 t cell and The sum of NK cell (NK) cell.Error bars represents the standard deviation of the value obtained from 5 mices often organized.Use Student ' s t-tests, * p-value < .05

Embodiment 5C illustrates Klebsiella pneumonia (K.pneumoniae) antigen composition of heat and phenol inactivation to little The effect of the antitumor response of Mus, and the struvite mononuclear cell after the treatment carrying mice with tumor and dendritic cell State

Following method and material are for this embodiment:

Tumor cell inoculation. the Lewis lung cancer cell line being derived from C57BL/6 background is obtained from ATCC (Manassas, VA). Cell is maintained the Dulbecco ' s Modified Eagles culture medium (ATCC, Manassas, VA) comprising 10%FCS In.Cell is made to have 5%CO₂Moistening 37 DEG C of couveuses in grow.Before tumor inoculation, use 0.25% trypsin Cell is separated from culture plate with 0.53mM EDTA.Cell is washed and with 8x10 in PBS⁶Individual cell/ml settling flux, and And to mouse mainline 200 μ l (4x10⁵Individual cell).

With the treatment of antigen composition. use following further antigens compositions in this study: there is the lung of the heat inactivation of phenol Scorching klebsiella antigen composition (lot KO12) and the Klebsiella pneumonia antigen composition (lot of phenol heat inactivation KO25).The Klebsiella pneumonia of heat inactivation and the Klebsiella pneumonia of phenol inactivation are concentrated into 5.0OD600 unit.? After tumor injection 2 days start, every other day the lung of dilution 1/10 in the PBS with 0.4% phenol of subcutaneous injection 0.1ml Scorching klebsiella.

Struvite mononuclear cell, DC, T cell and the analysis of NK cell.Carry out according to the method that above-described embodiment 5B uses All analyses.

Table 18: the experiment packet of embodiment 5C and dosage

¹There is the Dulbecco phosphate buffered saline (PBS) of phenol²Have what the heat of phenol was killed³The phenol with phenol kills Go out

Obtain following results in this embodiment:

This embodiment be set as determining whether the existence of tumor affect cell to pulmonary raise and therapeutical effect at any time Between increase whether cause the further increase of recruiting cells in the case of uninterrupted treatment, thus may measure and there is prolongation control The more preferably therapeutic effect treated.Additionally, it is desirable that measure the klebsiella antigen composition ratio inactivated by phenol by heat inactivation Klebsiella pneumonia antigen composition more effective.

Figure 20 clearly indicates that, to the 9th day (that is, with 4 treatments of Klebsiella pneumonia antigen composition), is using by heat Or phenol inactivation Klebsiella pneumonia antigen composition treatment mice pulmonary in, acute inflammatory mononuclear cell, DC, The quantity existence of T cell and NK cell dramatically increases, much more many than the mouse lung treated with placebo (normal saline=PBS) Times, additionally, clearly indicate that immunity in the notable targeted cells of the pulmonary caused by the treatment of Klebsiella pneumonia antigen composition Response.At the 9th day, it is proposed that, phenol inactivation is more more effective than heat inactivation, but this trend reversed at the 16th day.But, important Ground, with reference to the cell number of the pulmonary of the 9th day and the 16th day, it will therefore be apparent that there is antibacterial treatment and tires out cell to lung recruitment Long-pending effect.Such as, in the group of the Klebsiella pneumonia antigen composition treatment inactivated with phenol, at the mouse lung of the 9th day Portion exists about 100,000 acute inflammatory mononuclear cell, and by the 16th day, this numerical value increased to 400,000 substantially, shows In the case of proceeding treatment, response substance increases.The mice treated with heat inactivation antibacterial occurs in and proceeds The same treatment response increased for the treatment of.Importantly, same other cell types all analyzed are observed controlling of this accumulation Treatment effect.In this study, the immunocyte at the Klebsiella pneumonia antigen composition inactivated with heat inactivation or phenol is raised Concentrate and there is not evincible statistically-significant difference.

As shown in figure 20, at the 0th day with 4 × 10⁵Lewis lung carcinoma cell intravenous injection mice.Subsequently, opened from the 2nd day Begin, every other day with the Klebsiella pneumonia antigen composition being inactivated by heat inactivation or phenol and being produced or treat with PBS Mice.Put to death mice at the 9th day and the 16th day, and measured (A) struvite mononuclear cell (CD11b+Gr-1 by flow cytometer +) and DC (CD11c+Iab+) or (B) cd4 t cell, cd8 t cell and the sum of NK cell (NK) cell.Bar represents respectively: PBS treatment group, the mice treated with the Klebsiella pneumonia antigen composition of heat inactivation and the pneumonia gram with phenol inactivation The mice of thunder primary Salmonella antigen composition treatment.Error bars represents the standard deviation of the value obtained from 5 mices often organized.Use Student ' s t-tests, * p-value < .05

The immunne response of the increase that the results of the study show that in the case of proceeding treatment in target tissue.

Embodiment 5D shows heat, radiation and the effect to Klebsiella pneumonia antigen composition of the phenol inactivation, including Raise to the cytokine of mouse lung, and phenol has the impact of any effect as preservative

Following method and material are for this embodiment:

Mice. these are studied, female from the C57BL/6 of Harlan Labs (Livermore, CA) predetermined 7-8 week old Mice.

Antigen composition. use in this study and there is the Klebsiella pneumonia antigen composition that the heat of phenol is killed (KO12) radiation that, not there is Klebsiella pneumonia antigen composition (KO25) that the heat of phenol kills, not there is phenol Klebsiella pneumonia antigen composition (KO24) and not there is the Klebsiella pneumonia antigen group that the phenol of phenol is killed Compound (KO25).All bacteria preparations concentration in saline is 5.0OD unit.For 1/10 dilution, the bacteria preparation of 1ml is added Enter the DPBS of 9ml, and mix immediately, the most again mix.For 1/100 dilution, by the bacteria preparation of 0.1ml Add the DPBS of 9.9ml, and mix immediately, the most again mix.For the pneumonia killed by the phenol heat of dilution Klebsiella antigen composition, uses the DPBS solution comprising 0.4% phenol (w/v), dilution executed as described above.In order to prepare The DPBS solution of the phenol of 0.4%, first passes through and is added by the Phenol,Solid (Sigma Aldrich, St.Louis, MO) of 0.5g DPBS (Hyclone, Logan, UT) to 10ml prepares the phenol solution of 5%.This solution passes through 0.22um filter (Millipore, Billerica, MA) filters and 4 DEG C of storages.The most immediately 5% phenol solution of 1ml is existed 12.5ml DPBS dilutes, and is used for preparing bacteria preparation.

With the treatment of antigen composition. with 0.1ml PBS or there is 0.4% phenol PBS in dilute 1/10 heat kill The Klebsiella pneumonia antigen composition that goes out, 0.1ml dilute in PBS 1/10 the Klebsiella pneumonia antigen of radiation Compositions, or combine with the Klebsiella pneumonia antigen of PBS or the phenol inactivation of the PBS dilution 1/10 with 0.4% phenol Thing, 5 mices that the 0th, 2,4 and 6 days subcutaneous treatment are often organized.At the 7th day, by sacrifice, and as embodiment 5B Analyze the cytokine to pulmonary to raise.

Obtain following results in this embodiment:

In this embodiment, we use the cytokine to pulmonary to raise the replacement as usefulness to compare by various sides The usefulness of the Klebsiella pneumonia antigen composition of method inactivation.Figure 21 illustrates and kills, for heat, the kerekou pneumonia killed with phenol Primary Salmonella antigen composition, raises measured as intracellular, adds and add usefulness as the phenol (0.4%) of preservative. In some embodiments, a small amount of phenol (that is, 0.4%, as preservative) can be with each component of stable bacterial cell wall, example Such as vital component in terms of spectrotype identification and the optimal targeting response of activation.Comprise as preservative comparing 3 kinds During the preparation of phenol (that is, heat is killed, phenol is killed and radiation is killed), the Klebsiella pneumonia antigen combination of radiation Thing causes raising to the acute inflammatory mononuclear cell of pulmonary, DC, NK cell and T cell maximum, the lung that followed by phenol is killed Scorching klebsiella antigen composition, and the Klebsiella pneumonia antigen composition that heat is killed causes the cell of minimum to be raised Collection.

As shown in figure 21, processed mice at the 0th, 2,4 and 6 days with Klebsiella pneumonia antigen composition, wherein said Antigen composition be (HKWP) by heat inactivation or do not have (HKnp) phenol preservative, there is phenol preservative and use phenol (PKWP) of inactivation or not there is phenol preservative and with (PKnp) of phenol inactivation or by with phenol preservative (IRWP) spoke Penetrate.Put to death mice at the 7th day, and measured (A) struvite mononuclear cell (CD11b+Gr-1+) and DC by flow cytometer Or (B) cd4 t cell, cd8 t cell and the sum of NK cell (NK) cell (CD11c+Iab+).Error bars represents from often group The standard deviation of value of 5 mices.Use Student ' s t-test, compared with the mice treated with IRWP, * p-value < .05

Embodiment 6: relate to the clinical research of advanced epithelial cancer

Treatment summary

There is the following patient's of different terminal cancer and have been carried out using the controlling of targeted bacteria antigen composition of heat inactivation Treat.For each patient comprehensively and receive written consent book (the Fully informed that knows the inside story in each case written consent).Treat and be made up of repetition (3 times/week) subcutaneous injection of the vaccine of precise volume in abdomen area.? Each patient collects dosage and is gradually increased to realize sufficient skin response (3-5cm is rubescent continues ca.24h).For each trouble Person, Case report form (CRF) have recorded and treat relevant skin response and possible clinical effect and/or side effect.Letter Describe typical and adjoint treatment and the patient response to therapy.

Patient #1:

Suffering from 53 years old male patient of advanced melanoma ICD10:C43,11/2005 diagnosis for the first time is at right big foot toenail Under damage, after 1 year, the histology of i.e. 12/2006: Advanced Malignant melanoma；Patient refuses big toe amputation；5/2008, The lymphatic vessel transfer of lower limb to the right, when the first time of targeted bacteria antigen composition treatment occurs (9/2008), lower limb girth swelling Add 100%: Ka Shi scoring 80%, treat the most in advance.

The treatment 09/2008-04/2009 of 6 months:

12 × intraperitoneal ozone (O3) is blown into；

42 × local high-frequency overheated (13.56Mhz)；

18 × appropriateness whole body is overheated 38.5 DEG C；

Treatment in 6 months is carried out with staphylococcus aureus antigen composition s.c.；

Orthomolecular medicine: high dose vitamin C inculcates (0.5g/kg/BW), vitamin D3；2.000iu/ my god, artesunate 200mg/ days, celecoxib 100mg/ days, low-dose naltrexone, treatment；Mushroom (Cordyceps, Ganoderma, Lentinus Edodes), selenium 200uc/ My god, bisdemethoxycurcumin .000mg/ days, proteolytic enzyme (Wobemugos)

Evaluation details:

PET 7/2008:SUV is 4.81 at right big toe, at knee: 5.01

PET 12/2008:SUV is 3.80 at right big toe, at knee: 4.02

We start treatment at 9/2008 end

At that time (9/2008), there is obvious inguinal lymph nodes, this does not sees on the PET of 7/2008 Observe.

05/2010: good clinical state, PET determine complete incidence graph, Ka Shi scoring 100%.

Patient #2:

Suffering from 48 years old female patient of BILATERAL BREAST CANCER ICD10:C50.9 in late period, first diagnoses in 4/2008；The group of mammary gland Knitting wellability pipe adenocarcinoma, ER/PR position, Her2 is unknown, T1/T2, N1 (sentinel node axillary fossa), M0G3；Use sodium bicarbonate Injection is repeatedly treated and two mammary gland is repeated surgical operation；Patient refuses the bilateral breast excision of suggestion and does not has Have " healthy (in sano) " excision (such as, the leaf margin of breast tumor resection art is not without tumor cell).Patient still refuses Chemotherapy and/or hormonotherapy.Ka Shi scoring 90%, does not predict material.

The treatment 03/2009-11/2009 of 8 months:

The treatment of 3 × autologous dendritic cell and following combination:

3 × long-term moderate whole body is overheated, is 40 ° in 8 hours

57 × local high-frequency to two mammary gland is overheated (13.56Mhz)；

Treatment in 6 months is carried out with staphylococcus aureus antigen composition s.c.；

Orthomolecular medicine: high dose vitamin C inculcates (0.5g/kg/BW), low-dose naltrexone, medicinal mushroom (worm summer in winter Grass, Ganoderma, Lentinus Edodes), Rhizoma Curcumae Longae 3.000mg/ days, zinc

Evaluation details:

3/2009 end starts treatment.

05/2010: both sides breast MRI shows the deformity being not detected by, good clinical state, Ka Shi marks 100%

Patient #3:

Having advanced NSCLC cancer FIGO IIc, 73 years old female patient of ICD10:C34, first diagnoses in 6/2009；Pulmonary Histology's clear cell adenocarcinoma, T4, N1, M0G3；She assists CHT through newly；Reproduction after 3 circulation new auxiliary CHT Show non-T2 tumor；But, she performs the operation through left pneumonectomy, i.e. R0 excision, and mediastinal lymphadenectomy；Ka Shi marks 90%.

The treatment 08/2009-03/2010 of 7 months:

08/2009 starts by the chemotherapy of Pu Leshi/cisplatin until 10/2009, described therapy and following combination:

4 × long-term moderate whole body is overheated, is 40 ° (1-2/2009) in 8 hours

20 × the local high-frequency overheated (13.56Mhz) (8-10/2009) of chest

10/2009 left pulmonary resection R0 excision (oncology be unequivocally opposed to other auxiliary CHT)

6 months (08/2009-02/2010) is treated with Klebsiella pneumonia antigen composition s.c.

Orthomolecular medicine: Thymosin i.m., indomethacin, cimetidine, high dose vitamin C inculcate (0.5g/kg/ BW), ALA/N scheme (low-dose naltrexone and alpha lipoic acid), medical mushroom (Ganoderma), Rhizoma Curcumae Longae 3.000mg/ days, zinc, melatonin, The suction of ionized oxygen

Evaluation details:

08/2009 end starts treatment.

05/2010:CT breast and tumor marker CEA, NSE and CYFRA show and alleviate completely, good medical condition, Ka Shi scoring 100%.

Patient #4:

There is 50 years old female patient of advanced breast cancer ICD10:C50, there is the liver and Lung metastases sent out, for the first time diagnosis In 8/1990；Histology's undifferentiated liver cirrhosis type adenocarcinoma of breast, pT1c, N1, M0G3；She in 20 years through multiple chemotherapeutics Method；11/2004 wound recurrence for the first time, 12/2004 left breast excision, 6x CHT Epitax and thoracic wall radiation；9/2005 first Secondary diagnosis dissemination liver and pulmonary's transfer: there is the 8x CHT of Epitax in addition until 3/2006.Reproduction shows to enter at this moment Row disease, she starts the treatment of targeted bacteria antigen composition.Ka Shi scoring 90%.

The treatment 03/2006-03/2010 of 4 years:

03/2006 starts to use the treatment of multi-vaccine forte vaccine, described treatment and following combination:

The treatment of 3 × autologous dendritic cell and following combination (6-8/2006):

3 × long-term moderate whole body overheated (LD-WBH), is 40 ° (1-2/2009) in 8 hours

25 × the local high-frequency overheated (13.56Mhz) (3-6/2006) of breast regulating liver-QI

The treatment (11/2008-7/2009) of 8 months is carried out with Klebsiella pneumonia antigen composition

10/2009, TM CEA and CA15/3 starts again to raise

02-03/2009 2x autologous dendritic cell therapy, unused LD-WBH

The heating ablation (Lung metastases is not changed in) of 04/2010 hepatic metastases

Orthomolecular medicine: Thymosin i.m., indomethacin, cimetidine, high dose vitamin C inculcates (0.5g/kg/ BW), Rhizoma Curcumae Longae 3.000mg/ days, zinc, proteolytic enzyme

Evaluation details:

We start treatment at 03/2006 end

05/2010:CT Thorax shows stable disease in 4 years, the PD of hepatic metastases, good clinical shape State, Ka Shi scoring 100%.

Patient #5:

Suffer from 66 years old male patient of advanced prostate cancer ICD10:C61, there is dissemination bone and lymph metastasis, first Secondary diagnosis 01/1997；The undifferentiated adenocarcinoma of prostate of histology, pT3, N1, M1G3；He in 13 years through repeatedly hormone and CHT； Patient is in clinical shape body well, and self diagnosis comes into existence metastatic prostate cancer 13 years；Ka Shi scoring 90%.

The treatment 11/1999-05/2010 of 11 years:

13 years androgen antagonist, use buserelin, Zoladex, Kang Shi get, Trenantone, depend on vertical suitable, cupreol

The bacterial vaccine that 06/2006-12/2007 starts with multi-vaccine forte vaccine carries out mixing is treated

From the beginning of 03/2008, every 3-4 week Taxotere 140mg carries out regular chemotherapy

50 × moderate whole body generates heat, 39 ° (1999-2009) in 3 hours

The treatment (11/2008-05/2010, uninterrupted) of 18 months is carried out with staphylococcus aureus antigen composition

05-06/2009 2x autologous dendritic cell therapy, does not has moderate WBH 39 °, 3h

Orthomolecular medicine: Radix Aneurolepidii, cimetidine, select Thailand, high dose vitamin C inculcates (0.5g/kg/BW), Rhizoma Curcumae Longae 3.000mg/ days, boswellia serrata (India), 400mg 4x4/ days, zinc, proteolytic enzyme

Evaluation details:

We start treatment at 1999 ends

05/2010: bone scanning shows stable disease；PSA 89ng/ml at present, good medical condition, Ka Shi marks 90%.

Patient #6:

Suffering from 52 years old female patient of advanced primary peritoneal cancer ICD10:C48.2, have dissemination peritoneal cancer, first examines Break in 06/2003；Histology's undifferentiated peritoneum adenocarcinoma pT3, N1, M1G3；She is through by both sides ovariectomy and uterus The debulk operation OP of excision, and use the adjuvant chemotherapy of paclitaxel/carboplatin: PD, and change according to SD Ramulus et folium taxi cuspidatae ketone/carboplatin, until 8/2008；PD has Disseminated peritoneum LK transfer, and uses the 3rd line of carboplatin CHT, and start treatment with targeted bacteria antigen composition；Patient is in medical condition well；Ka Shi scoring 100%.

The treatment 05-09/2009 of 4 months

5x carboplatin chemotherapy (the 3rd line), then:

5 × long-term moderate whole body overheated (LD-WBH), is 40 ° (05-09/2009) in 8 hours

20 × the local high-frequency overheated (13.56Mhz) (05-09/2009) of abdominal part

The treatment (05-07/2009) of 2 months is carried out with escherichia coli (colon) antigen composition

Orthomolecular medicine: high dose vitamin C is inculcated (0.5g/kg/BW), the Carlina acaulis of high dose extracts with flying water silibin Thing (liver)

Evaluation details:

We start treatment at 5/2009 end

04/2010:CT abdominal part and tumor marker show to alleviate completely, good clinical state, Ka Shi scoring 100%

Patient #7:

Suffer from 50 years old female patient of inoperable cancer of pancreas ICD10:C25.9, and cancer infiltrates main blood vessel；Super Acoustic image and CT evidence show to invade superior mesenteric vein, and first diagnoses in 02/2009；The undifferentiated pancreas adenocarcinoma of histology PT3, N1, M1G3, and there is peritoneal cancer；She through partial radiation and low dosage capecitabine as radiosensitizer；When her When our clinic starts to treat, cancer is the most unresectable；Ka Shi scoring 100%.

The treatment 06-07/2009:(escherichia coli SSI of 2 months continues 11 months)

The dendritic cells in treatment of 1 × autologous NDV-activation and following combination:

1 × long-term moderate whole body is overheated, is 40 ° (7-10/2009) in 8 hours

4 × appropriateness whole body is overheated 38.5 °；

15 × the local high-frequency overheated (13.56Mhz) (06-07/2009) of abdominal part

With escherichia coli (colon) antigen composition carry out 11 months treatment (06/2009 until today, and continue into OK)

Orthomolecular medicine: Thymosin i.m；Medical mushroom (Ganoderma, Cordyceps, Lentinus Edodes)；High dose vitamin C is inculcated (0.5g/kg/BW), high dose Proteolytic enzyme enzymotherapy (wobenzym phlogenzym), cimetidine.

Evaluation details:

We start treatment at 6/2009 end

05/2010: complete incidence graph, NED；PET 02/2010 shows do not have glucose uptake；The normal CA19/ of tumor marker 9:4；Good clinical state, Ka Shi scoring 100%

Embodiment 7: dose study (QB28 research)

In order to detect the effect of dosage, Klebsiella pneumonia antigen composition or PBS control by various dose process Mice.All mices (C57BL/6) began to use at-10 ,-8 ,-6 ,-4 and-2 days Klebsiella pneumonia antigen composition or The treatment of PBS, uses (the injection for the first time: the right groin of abdominal part of following injection site；Second time injection: the right axillary fossa of abdominal part, the 3rd Secondary injection: the left axillary fossa of abdominal part；The 4th is injected: the left groin of abdominal part etc.).Then, all mices enter mice by intravenous injection Lateral tail vein and accept 3x10⁵The tumor inoculation dosage of each Lewis lung cancer cell.The dosage of antigen composition or PBS is as follows: i) PBS 0.1ml；Ii) Klebsiella pneumonia, the OD600=1.67 of 0.1mL；Iii) Klebsiella pneumonia, 0.1mL's OD600=0.5.Mice accepts Klebsiella pneumonia antigen composition or PBS, treats at the 2nd, 4,6 and 8 days.? Within 10 days, terminate experiment；Putting to death all mices, ophthalmic surgical removes their pulmonary, cleans, weigh, be then placed in water Bouins liquid is for fixing and 24 hours subsequently countings.As shown in figure 22, each data point represents from a mice Tumor nodule quantity.Picture from these typical pulmonarys tested figure 23 illustrates.Figure 23 illustrates at PBS control of using by oneself The pulmonary of the mice of reason goes out substantial amounts of tuberosity.By comparing, Figure 23 illustrates Klebsiella pneumonia antigen combination of using by oneself The pulmonary of the mice that thing processes goes out less tuberosity, suitable with the ratio shown in Figure 22.

QB30 research, in other research to Klebsiella pneumonia antigen composition dosage effect, also shows if lung The dosage of scorching klebsiella antigen composition is too low, then it is invalid for treatment pulmonary carcinoma.In these are studied, its knot Fruit figure 24 illustrates, and all mices (C57BL/6) began to use Klebsiella pneumonia to resist at-10 ,-8 ,-6 ,-4 and-2 days Former compositions or the treatment of PBS, use (the injection for the first time: the right groin of abdominal part of following injection site；Second time injection: abdominal part Right axillary fossa, third time injection: the left axillary fossa of abdominal part；The 4th is injected: the left groin of abdominal part etc.).Then, all mices pass through vein It is injected into the lateral tail vein of mice and accepts 3x10⁵The tumor inoculation dosage of individual Lewis lung cancer cell.Antigen composition or PBS Dosage as follows: i) PBS 0.1ml；Ii) Klebsiella pneumonia, the OD600=0.5 of 0.1mL；Iii) e coil k 1 pneumonia Bacterium, the OD600=0.05 of 0.1mL.Mice continues to accept Klebsiella pneumonia antigen composition or PBS, the 2nd, 4,6,8, 10, within 12,14 and 16 days, treat.Experiment is terminated at the 18th day；Putting to death all mices, ophthalmic surgical removes their pulmonary, Water cleans, weighs, be then placed into Bouins liquid for fixing and 24 hours subsequently countings.As shown in figure 24, often One data point represents the tumor nodule quantity from a mice.

Result from QB28 and QB30 shows that the Klebsiella pneumonia antigen composition of extremely high dose is invalid, Perhaps owing to the overstimulation of host immune system.Also indicate that low dosage is invalid, perhaps from this result also studied Insufficient stimulation owing to host immune system.

Embodiment 8: cisplatin effect research

In order to detect the effect between cisplatin and chemotherapy and Klebsiella pneumonia antigen composition dosage, complete QB38 studies.In short, all mices accept 3 × 10 in the entering lateral tail vein by intravenous injection on the 0th day of research⁵Individual The tumor inoculation dosage of Lewis lung cancer cell.After this inoculation, all mices are incorporated in a cage, divide the most at random Allocate the cage of each of which into control deviation data.In+2 days mornings of this research, the mice in cisplatin group is noted by intraperitoneal Penetrate this medicine of 10mg/kg.Control mice is injected with comparison (PBS).Hereafter, at+2 afternoons of this research, mice accepts Klebsiella pneumonia antigen composition or PBS, continued these injections at the 4th, 6,8,10 and 12 days.Terminated grinding at the 14th day Study carefully；Hereafter, putting to death all mices, ophthalmic surgical removes their pulmonary, cleans, weigh, be then placed into Bouins in water Liquid is for fixing and 24 hours subsequently countings.As shown in figure 25, each data point represents that the tumor from a mice is tied The quantity of joint, whether described mice uses PBS, Klebsiella pneumonia antigen composition and the pneumonia of cisplatin combination based on mice Klebsiella antigen composition or only treat with cisplatin.The result summed up in fig. 25 shows, and only with cisplatin, only use lung Scorching klebsiella antigen composition or PBS control process those compare, with Klebsiella pneumonia antigen composition and suitable There is less tuberosity in the mice of platinum treatment.

Other experiment is set as measuring whether Klebsiella pneumonia antigen composition therapy can be used for and change based on platinum Learn therapy synergism, carry the survival of the mice of pulmonary's Lewis lung tumor with extension.4 groups of 5 C57BL/6 female mices All accept 10 intravenous injection in the 0th day⁵Individual Lewis lung cancer cell.At the 2nd day, the 3rd and 4 group of lumbar injection ground accepted single The 10mg/kg cisplatin of dosage.Starting at the 4th day, mice accepts Klebsiella pneumonia or placebo (PBS) for every 2 days until dead Die.Figure 26 illustrates the survival of all mices, and indicates the p value of the various survival curves using logarithm order measuring and calculation. Only add the survival of the mice with lung tumors with the mice of plus cisplatin in treatment, and median survival is from increasings in 16 days of PBS group Add to 23 days of PBS+ cisplatin group.Compared with PBS, the treatment only carried out with Klebsiella pneumonia also add the survival of mice (the survival meansigma methods of Klebsiella pneumonia 19 days to PBS 16 days).The most important thing is, cisplatin chemotherapy is together with pneumonia gram Thunder primary Salmonella therapy has the treatment benefit (median survival is 32 days) of maximum, shows in the mouse model of pulmonary carcinoma, based on platinum Chemotherapy and antigen composition therapy between synergism.The p-value of the data produced in this QB45 studies is following Shown in table 19.

Table 19. survival data (QB45)

As shown in this embodiment, antigen composition can use or after cisplatin administration a period of time on the same day with cisplatin Use.As used herein, term " antigen composition " refers to the compositions of the antigen comprising one or more microbial species.As Used herein, term " microbial species " can relate to viral pathogen or bacterial pathogens or fungal pathogens, such as this paper institute Describe in detail.

Other research is set as exploring for the pneumonia of mice is treated, at chemotherapy based on platinum and kerekou pneumonia Whether synergism is there is between primary Salmonella antigen composition.All mices accept 10 intravenous injection in the 0th day⁵Individual Lewis Pulmonary carcinoma.From the beginning of the 0th day, mice notch graft in every 2 days is by antigen composition or PBS.At the 12nd day, use cisplatin i. p internal therapy (10mg/kg) some mices.Subsequently (the 13rd day), 3 mices from each group are drawn blood, and contaminates with anti-CD11b antibody Color hemocyte by facs analysis.The curve of Figure 27 shows the frequency of the CD11b+ myeloid cell in the blood of the 13rd day.Often A little represent single mice.The results of the study show that, antigen composition therapy can increase at blood when giving together with cisplatin The frequency of the myeloid cell (mononuclear cell, macrophage, granulocyte, dendritic cell) of liquid.This can be by providing greater amount These congenital myeloid cells strengthen the immunity of animal, wherein said myeloid cell can carry out response to tumor or pathogen. Additionally, because bone marrow depression is chemotherapeutical important side effect clinically, and result is myeloid cell in blood Reducing, this can cause chemotherapeutic delay/termination or the impact of susceptible, uses antigen composition to treat between chemotherapy stage Method strengthens myeloid cell, and this can aid in the risk reducing chemotherapeutic this important and clinically relevant side effect.

Embodiment 9: macrophage research (MOA13 research)

In order to detect the macrophage effect to embodiment of the present invention, complete MOA13 research.In short, mouse inoculation 3 ×10⁵Individual Lewis lung cancer cell or be injected the HBSS as vehicle control.Little for inoculate with Lewis lung cancer cell Mus, they are incorporated in single cage, and wherein they are transferred to the cage of each of which the most randomly.Hereafter, the 2nd, 4,6 With 8 days, treat mice with Klebsiella pneumonia antigen composition or PBS.Hereafter, all mices were put to death at the 9th day.For obtaining About bone marrow and the information of NK cell frequencies, 20 mices (5 from each group) are removed their lung by surgical operation, and And use release enzyme and deoxyribonuclease to digest pulmonary.After digestion and cell are prepared, obtain cell suspension individually. Hereafter, a part of cell is transferred to 96 hole round bottom plates to use bone marrow specific antibody (CD11b+, NK1.1+) and NK special Property antibody (NK1.1+, CD11b+) dyes.For former cell type, valve plate (gate) for only select CD11b+ and NK1.1-cell population.Hereafter, BD FACSCalibu is used to carry out cell data acquisition and use FlowJo to be analyzed. Use Excel and GraphPad Prism to carry out statistical analysis and figure represents.Result figure 28 illustrates.In short, use lung The treatment of scorching klebsiella antigen composition causes the myeloid cell in so pulmonary of the mice for the treatment of (may be that monokaryon is thin Born of the same parents and macrophage) and the increase of CD11b+NK cell.

For the information relevant to generation cytokine in lung tissue, carry out following experiments.Mouse inoculation 3 × 10⁵Individual Lewis lung cancer cell or be injected the HBSS as vehicle control.For the mice inoculated with Lewis lung cancer cell, they Being incorporated in single cage, wherein they are transferred to the cage of each of which the most randomly.Hereafter, at the 2nd, 4,6 and 8 days, Mice Klebsiella pneumonia antigen composition or PBS treat.Hereafter, mice was put to death at the 9th day.In order to obtain in lung tissue The information of cytokine, lung carries out bronchoalveolar lavage.Hereafter, lung is the most surgically removed Portion, and be placed in the preweighted bottle comprising PBS and protease inhibitor.Hereafter, make lung tissue homogenize, be centrifuged, And supernatant is coated on ELISA kit (eBioscience)；Guide according to manufacturer carries out elisa assay.Use Excel and GraphPad Prism carries out statistical analysis and figure represents.The pg that tables of data is shown as the original lung tissue of every mg is thin Intracellular cytokine.Each data point position in Figure 29 is from the numerical value of single mice.As shown in figure 29, Klebsiella pneumonia antigen is used The treatment of compositions causes the increase that antitumor (IL-12, MCP-1, GMCSF, IL-6) cytokine of lung tissue produces.

For producing relevant information to the cytokine at bronchoalveolar lavage (BAL) liquid, carry out following experiments.Little Mus inoculation 3 × 10⁵Individual Lewis lung cancer cell or be injected the HBSS as vehicle control.For connecing with Lewis lung cancer cell Kind mice, they are incorporated in single cage, and wherein they are transferred to the cage of each of which the most randomly.Hereafter, exist The 2nd, 4,6 and 8 days of experiment, treat mice with Klebsiella pneumonia or PBS.Hereafter, all mices were put to death at the 9th day.For Obtain and produce relevant information to the cytokine in pulmonary, the pulmonary of mice carries out bronchoalveolar lavage.Will be from The liquid of lavation puts into bottle, and-80 DEG C of storages, until when carrying out elisa assay.Hereafter, according to the finger of manufacturer South carries out elisa assay.Use Excel and GraphPad Prism to carry out statistical analysis and figure represents.Tables of data is shown as The pg/ml of irrigating solution, as shown in figure 30.Each data point represents the numerical value obtained from a mice.As shown in figure 30, pneumonia is used The treatment of klebsiella antigen composition is produced without effect to the cytokine in BAL liquid.

For checking the M1/M2 macrophage phenotype of model as described herein, pulmonary monitors NOS2 and Arg1 level. Experiment is carried out as follows: in short, mouse inoculation 3x10⁵Individual Lewis lung cancer cell or be injected the HBSS as vehicle control. For the mice inoculated with Lewis lung cancer cell, they are incorporated in single cage, and wherein they are transferred to it the most randomly Respective cage.Hereafter, at the 2nd, 4,6 and 8 days of experiment, treat mice with Klebsiella pneumonia or PBS.Hereafter, exist Within 9th day, put to death all mices.For obtaining the information relevant to NOS2 and Arg1 gene expression, 20 mices (from each group 5 Only) its pulmonary is made surgically to remove.Hereafter, use aseptic technique to cut the sub-fraction of these lungs, and put into RNAlater is so that RNA material settling out, thus for further gene analysis.Use the test kit from Qiagen, from lung Tissue extraction total serum IgE, and use according to manufacturer's scheme.CDNA test kit is for being converted into cDNA by a certain amount of RNA (Qiagen), the explanation by being provided by manufacturer converts again.Using and cause son to carry out qPCR, described initiation sets For specificity method Nos2 and Arg1 (Nos2: forward CGCTTTGCCACGGACGAGA；Reversely AGGAAGGCAGCGGGCACAT；Arg1: forward-GGTCCACCCTGACCTATGTG；Reversely GCAAGCCAATGTACACGATG).Excel and GraphPad Prism is used to carry out statistical analysis.As shown in figure 31, lung is used The treatment of scorching klebsiella antigen composition causes the increase of the Nos2/Arg1 ratio of pulmonary, itself and the antitumor response increased Association.

For studying the M1/M2 response in In vivo model as herein described, the expression of monitoring CD206 (mannitol receptor). In short, mouse inoculation 3 × 10⁵Individual Lewis lung cancer cell or be injected the HBSS as vehicle control.For with Lewis The mice of lung carcinoma cell inoculation, they are incorporated in single cage, and wherein they are transferred to the cage of each of which the most randomly Son.Hereafter, at the 2nd, 4,6 and 8 days of experiment, treat mice with Klebsiella pneumonia or PBS.Hereafter, institute was put to death at the 9th day There is mice.Expressing relevant information for obtaining to CD206,20 mices (5 from each group) make its pulmonary surgery hands Art removes, and uses release enzyme TL and deoxyribonuclease to digest.After digestion and cell are prepared, obtain individually Ground cell suspension.The cell of a part is transferred to 96 hole round bottom plates to use CD206 specific antibody (clone MR5D3) to carry out Dyeing, described antibody derives from Cedarlane Labs (Burlington, ON).Because CD206 is positioned at intracellular and extracellular, institute To fix cell first by paraformaldehyde, and use antibody staining in saturatingization solution.FlowJo is used to be analyzed.Use Excel and GraphPad Prism carries out statistical analysis and figure represents.Result figure 32 illustrates.As shown in figure 32, lung is used The treatment of scorching klebsiella causes there is (PBS+LL2 and Klebsiella pneumonia 1/10X+LL2) in lung tumor or not existing In the case of (PBS and Klebsiella pneumonia 1/10X), the reduction that the CD206 on pulmonary's macrophage expresses.Deposit in pulmonary carcinoma In case, the frequency that Klebsiella pneumonia antigen composition makes CD206 express is reduced to from about 20% (PBS+LL2 group) About 10% (Klebsiella pneumonia 1/10X+LL2 group).There is no any pulmonary carcinoma (PBS and Klebsiella pneumonia 1/10X) The animal of Klebsiella pneumonia treatment observes the similar reduction that CD206 expresses.

For studying the M1/M2 phenotype in In vivo model as herein described, the expression of monitoring F4/80+ macrophage.Letter speech It, mouse inoculation 3 × 10⁵Individual Lewis lung cancer cell or be injected the HBSS as vehicle control.For with Lewis lung cancer The mice of cell inoculation, they are incorporated in single cage, and wherein they are transferred to the cage of each of which the most randomly. Hereafter, at the 2nd, 4,6 and 8 days of experiment, treat mice with Klebsiella pneumonia or PBS.Hereafter, all execution in the 9th day Mice.Expressing relevant information for obtaining to the F4/80+ of macrophage, 20 mices (5 from each group) make its pulmonary Surgically remove, and use release enzyme TL and deoxyribonuclease to digest.After digestion and cell are prepared, Obtain cell suspension individually.The cell of a part is transferred to 96 hole round bottom plates to use F4/80 monoclonal antibody to contaminate Color.BD FACSCalibur is used to carry out the acquisition of cell data.FlowJo is used to be analyzed.Use Excel and GraphPad Prism carries out statistical analysis and figure represents.As shown in figure 33, with Klebsiella pneumonia antigen composition Treatment causes the reduction of F4/80+ macrophage in pulmonary.This reduction is considered to associate with the reduction of M2-sample macrophage.

Embodiment 10: site-specific Journal of Sex Research (MOA14 research)

For the M1/M2 phenotype of the In vivo model described herein that research and antigen composition described herein are used together, enter Row following experiments.In short, at the 0th, 2,4 and 6 days, with PBS, escherichia coli colon antigen composition or Klebsiella pneumonia Antigen composition processes 5 mices often organized.At the 7th day of experiment, put to death mice and carry out bronchoalveolar lavage.With After, remove pulmonary and proximal colon and by enzymatic digestion.After digestion, the cell that washing is collected, and with to following special The antibody staining of property: I-A/I-E FITC (MHC II type；M5/114.15.2)；Anti-Gr-1PE (RB6-8C5_；Anti-CD11b PerCP-Cy5(M1/70)；Anti-CD11c APC (N418).All antibody is obtained from eBioscience (San Diego, CA). To lung count with the sum (colon is for counting, because we do not remove the colon of equivalent at sample room) measuring cell. After dyeing 20 minutes, washed cell and use facs analysis.The each data point illustrated accordingly at Figure 34 represents each little Mus sets a frequency for the CD11b+Gr-1+ cell of screening in real time.As shown in figure 34, lead with the treatment of bacillus coli antigen compositions The frequency of struvite monocytic increase in the colon of the mice causing treatment.

In addition and as shown in figure 35, when mononuclear cell based on experimental technique detailed in this article detection pulmonary, find to the greatest extent Pipe escherichia coli and Klebsiella pneumonia antigen composition increase the monocytic frequency of mouse lung, but when to total amount meter During number, Klebsiella pneumonia antigen composition is more effective.With reference to Figure 35, the figure of the leftmost side represents the CD11b+Gr-1+ of pulmonary The frequency of (struvite mononuclear cell) cell；The figure of the rightmost side represents the total amount of the CD11b+Gr-1+ cell of pulmonary.

In order to detect the phenotype of macrophage present in the tumor, use and be used together with antigen composition described herein In vivo model described herein, detection M1-sample and M2-sample macrophage.As shown in figure 36, this illustrates after tumour transplatation 8 days, M1-sample (seeing the left figure of Figure 36) TAM (organizational relationship macrophage) in subQ 4T1 tumor or M2-sample (ginseng See the right figure of Figure 36) frequency.As described herein, M1-sample macrophage is defined as senior CD11b+/Gr-1-/MHC II type；M2-sample macrophage is defined as rudimentary CD11b+/Gr-1-/MHC II type.

Embodiment 11: indomethacin usefulness and anti-inflammatory agent research

In order to detect the usefulness of antigen composition treatment and indomethacin combination.In short, contrived experiment, wherein there is institute Having 10 or 11 mices in each group of state process 4 groups, the 4th day after tumor inoculation starts.Described mice was at the 0th day Notch graft is by 50,000 4T1 mammary tumour cells.Hereafter, following 4 groups: 1 is processed) indomethacin (in drinking water) once a day + within every two days, subcutaneous give PBS；2) each indomethacin of being bestowed by heaven (in quoting water)+every two days is subcutaneous gives Staphylococcus aureus Bacterium antigen composition；3) compare that vehicle (in drinking water)+every two days is subcutaneous gives PBS once a day；And 4) every day one Secondary comparison vehicle (in drinking water)+every two days is subcutaneous gives staphylococcus aureus antigen composition.For Figure 37, figure The figure of the leftmost side represents the gross tumor volume of each group the 15th day tested.The figure of the rightmost side shows swelling the 11st day tested The frequency of CD11b+ cell and composition in tumor.Compared with the control, the frequency of CD11b+ cell in two groups that indomethacin processes Rate dramatically increases.These results show staphylococcus aureus antigen composition and anti-inflammatory medicaments, the group of such as indomethacin The usefulness closed.In addition and as shown in this paper Figure 38, at the time point of the 22nd day, treatment effect of indomethacin caused the increasing of CD11b+ cell Add.

For detection antigen composition treatment further and indomethacin usefulness in combination, design studies.In short, every group Four groups of 10-11 Balb/c mice notch graft in the 0th day by 10,000 4T1 cancerous cell.Hereafter, treatment is as follows: first Group started to accept indomethacin (aqueous solutions of 14 μ g/ml)+accepted PBS at the 4th, 6,8 days etc. from the 4th day；Second group at the 4th day Start to accept indomethacin (aqueous solutions of 14 μ g/ml) and the staphylococcus aureus antigen composition [0.5OD of 0.1 ml 600nm stock solution]+accepted PBS at the 4th, 6,8 days etc.；3rd group started to accept PBS at the 4th, 6,8 days etc.；And the 4th group 4,6,8 days etc. staphylococcus aureus antigen composition [the 0.5OD 600nm stock solution of 0.1ml] is accepted.At the 15th, 19 and 22 days Carry out gross tumor volume measurement, and these data represent in the Figure 39 for four (4) group mices.Show in the data shown in Figure 39 Synergism is there is before antigen composition treatment and anti-inflammatory medicaments (such as indomethacin) in subcutaneous cancerous model.

The 11st day of test detailed above, tumor resection and digesting.Hereafter, swelling with anti-CD11b dyeing digestion Tumor and with facs analysis (often group mice n=3).Result is described in this paper Figure 40, and shows 11 days after inoculation, indole In the tumor of the mice of Mei Xin treatment, the frequency of CD11b+ cell increases.

The 22nd day of test detailed above, tumor resection and digesting.Hereafter, swelling with anti-CD11b dyeing digestion Tumor and with facs analysis (often group mice n=7).Result is described in this paper Figure 41, and shows 22 days after inoculation, indole The frequency of the increase of CD11b+ cell in the tumor of the mice of Mei Xin treatment.Additionally, Figure 42 shows that treatment effect of indomethacin induction is swollen The increase of CD11b+CD94+ myeloid cell in tumor, as after inoculation 22 days find.

The most relevant to anti-inflammatory agent response for detection antigen composition treatment further, at the 22nd day of above-mentioned experiment, Full tumor sample is made to carry out quantitative PCR by known method.Targeted gene product Fizz1 and Ym1.Fizz1 and Ym1 it is reported with M2 macrophage is relevant (see, e.g. Wong et al. (2010) Eur.J.Immunol.40 (8): 2296-307).Result exists Herein described in Figure 43.As shown in figure 43, the relative expression of Fizz1 and Ym1 increases in tumor, wherein exist indomethacin and The treatment of antigen composition (such as with only with compared with the treatment of indomethacin).

At the 22nd day of experiment, the tumor and spleen of mice detect the relative expression levels of Arg1 and Fizz1.Such as figure Shown in 44, in the spleen of the mice treated with indomethacin and antigen composition, Arg1 and Fizz1 expresses increase.In experiment The 22nd day, in the tumor and spleen of mice detect Nos2 and Ym1 relative expression levels.For four (4) group mices, relatively Expression is described in this paper Figure 45.

In order to detect the anti-inflammatory agent response relevant to antigen composition treatment, following contrived experiment further.In short, At the 0th day, mice was given Lewis lung tumor [PBS and Klebsiella pneumonia antigen composition] or is not given to tumor [PBS (not having tumor) or Klebsiella pneumonia antigen composition (not having tumor)].Lung is accepted the 2nd, 4,6,8 days mices Scorching klebsiella antigen composition [the 0.5OD500nm stock solution of 0.1ml] or PBS.The 9th day put to death mice, and remove and Homogenize their pulmonary.Use ELISA, lung homogenate is measured IFN γ.Result is shown in this paper Figure 46.By pneumonia gram The treatment of thunder primary Salmonella antigen composition reduces and produces with or without the IFN γ in the pulmonary of the mice of lung tumor.

In order to detect the anti-inflammatory agent response relevant to antigen composition treatment further, design following experiments.In short, Bone marrow macrophage in culture medium or the culture medium that is supplemented with LPS or is being supplemented with Klebsiella pneumonia antigen composition Overnight incubation in culture medium.IL-12 and IL-10 of test media.Result is shown in Figure 47 herein, and shows IL- 12 are not determined.As shown in figure 47, bite carefully with the Klebsiella pneumonia antigen composition incubated overnight bone marrow of IL-10 generation is huge Born of the same parents.IL-10 is known relevant to anti-inflammatory agent response (see, e.g. Bazzoni et al. (2010) Eur.J.Immunol.40 (9):2360-8)。

In order to detect the anti-inflammatory agent response relevant to antigen composition treatment further, design following experiments.In short, 4T1 tumor model is used for measuring staphylococcus aureus (SA) antigen composition therapy work collaborative with anti-inflammatory medicaments indomethacin Effect.In this study, at four (4) 10 Balb/c female mices of group notch graft in the 0th day by 50,000 4T1 mammary gland Cancerous cell.First group started notch graft in every two days by PBS at the 4th day.Second group started notch graft in every two days by SA at the 4th day [0.1ml of 0.5OD 600nm].3rd group and the 4th group started to connect in their drinking water respectively for every two days at the 4th day By the indomethacin (indo) of 14ug/ml and notch graft by PBS and SA.At the 22nd day, by sacrifice, and gather from often The tumor of 7-8 mice of group, and be placed in RNA preserving agent.Subsequently, we are by the IL-10's of real-time PCR analysis tumor Express.The result of Figure 48 shows that the mice processed with indomethacin and PBS has significantly increasing in terms of the IL-10 expression of tumor Add.Even result in more substantial IL-10 with the treatment of indomethacin and SA, show that SA adds indole in this tumor model beautiful Pungent anti-inflammatory effect.Because widely known IL-10 is anti-inflammatory cytokine, so these results show that SA is with anti-inflammatory Mode plays a role synergistically with indomethacin.It is important that, it is noted that the tumor in PBS group is maximum, followed by SA group Close Indo-PBS group.At the 22nd day, the tumor of Indo-SA group was minimum.Anti-inflammatory effect detailed in this article can be used for pin To various diseases associated with inflammation (seeing table 20 herein).

The list of table 20. chronic inflammation disease

Embodiment 12: inflammatory bowel disease is studied

This embodiment offers and comprise the colibacillary antigen preparation killed and within the trimestral course for the treatment of, treatment is suffered from The clinical effective purposes of the patient of Crohn disease.During the course for the treatment of, patient becomes asymptomatic, and stops using anti-inflammatory Medicine.

Patient is originally provided in the pain report in large intestine region, simultaneously with prednisone and Imuran^TMTreatment.

Treatment, described bacterial strain is started with the most colibacillary subcutaneous vaccination killing reagent being derived from coli strain Collect from the patient suffering from escherichia coli colon infections.Dosage regimen includes every two days subcutaneous administrations, by 0.05ml dosage, It is gradually increased volume, until at injection site, realizing the lightpink/redness skin of a diameter of 2 inches after injection in 24 hours Skin response.Realizing the finally required dosage of this skin response is 0.09-0.11ml in this patient, and this dosage is as maintenance Dosage and continue every two days once.

Starting with the one week after entirely killing colibacillary antigen preparation treatment, patient reported pain's disappearance.At about 2 In month, patient stops using the treatment of prednisone, and continues 150mgImuran every day^TMDosage.Subsequently, patient also stops using Imuran^TM。

After starting with the treatment of escherichia coli compositions 2 months, patient every other day oneself gave 0.09-0.11ml Escherichia coli preparation.This dosage of patient's self regulation is to cause local inflammation response, and it is by site of administration the most about 2 It diameter is about the pink colour speckle of 2 inches and proves.

Embodiment 13: fungal studies

Carrying out the test using pulmonary's mouse system detailed in this article, it determines and has accepted by specific fungal species The mice of the water that (penicillium Marneffei) pollutes shows the tumor load of reduction, as demonstrate,proved by antibacterial pulmonary pathogen part Bright and discussion, wherein penicillium Marneffei is known induces respiratory system infection in mice and the mankind.

The various organ or tissues that many known and lower lists 21 of fungal species are described in detail are relevant, wherein have also appeared by fungus The water of species infection.And based on test principle detailed in this article, prove herein is relevant to antibacterial and viral pathogen therefore Specificity should extend to fungal pathogens equally.

Table 21. fungal species and with the associating of organ-/ tissue

Other embodiment

Although disclosed herein is various embodiments of the present invention, but can know according to the routine of those skilled in the art Know, carry out many adjustment and amendment within the scope of the invention.It is known etc. that this kind of amendment includes for any aspect of the present invention The replacement of jljl, thus realize identical result in substantially the same manner.Digital scope includes the numeral of the range of definition.Saying In bright book, word " comprises (comprising) " and uses with open-ended term form, is essentially identical to wording and " includes but do not limit In ", and word " comprises (comprises) " and has suitable implication.The quoting should not be construed as and recognize so of document herein Document be the prior art of the present invention.The all publications (the most each independent publication) being incorporated herein by are bright Really and represent it is to be incorporated herein by the way of completely listing herein independently.The present invention includes more than the most such as Described and reference example and all embodiments of accompanying drawing and change.

Claims (10)

1. the antigen preparation of effective dose is being positioned at individuality pulmonary associated with the chemotherapeutics of preparation and the platiniferous of effective dose, for treatment Cancer medicine in purposes, it is the anti-of one or more pathogenic microbial species that described antigen preparation is included in pulmonary Former determiner,

Wherein said microbial species is selected from viral pathogen, bacterial pathogens and fungal pathogens,

Wherein said viral pathogen is selected from influenza virus, adenovirus, respiratory syncytial virus and parainfluenza virus,

Wherein said bacterial pathogens selected from Streptococcus, Moraxella, Mycoplasma, Kleb, haemophilus, Staphylococcus, chlamydiaceae and Legionella,

Wherein said fungal pathogens is selected from Aspergillus fumigatus, blastomyces, coccidioides immitis, Coccidiodes posadasii, Novel hidden Coccus, lattice spy cryptococcus, Fusarium spp., Histoplasma capsulatum, Paecilomyces varioti, Paracoccidioides brasiliensis, penicillium Marneffei, Family name's lung pityrosporion ovale, Bo Yide puppet Allescheriasis, Scedosporium apiospermum, rhizopus, mucormycosis, colter are mould, Cunninghamella sp, many Educate the many spores of match, stachybotrys chartarum, long shoot Trichoderma spp. and trichosporon bacteria.

2. purposes as claimed in claim 1, wherein said antigenic determinant includes the full microbial pathogens killed.

3. purposes as claimed in claim 2, wherein said antigen preparation uses or subcutaneous use for Intradermal.

4. purposes as claimed in claim 3, wherein said antigen preparation was used within the administration persistent period at least one week, with The dosing interval of one hour to one month gives successive doses and uses.

5. purposes as claimed in claim 1, wherein said bacterial pathogens is selected from streptococcus pneumoniae, moraxelle catarrhalis, pneumonia Mycoplasma, bacillus canalis capsulatus, hemophilus influenza, staphylococcus aureus, Chlamydia pneumoniae and bacillus legionnaires,pneumophila.

6. purposes as claimed in claim 1, the chemotherapeutics of wherein said platiniferous is selected from cisplatin, carboplatin and oxaliplatin.

7. method as claimed in claim 3, wherein said chemotherapeutics is cisplatin.

8. pharmaceutical composition, is included in the antigenic determinant that pulmonary is one or more pathogenic microbial species, with preparation With the chemotherapeutics of the platiniferous of effective dose associated with, be positioned at the medicine of the cancer of individual pulmonary for treatment,

Wherein said microbial species is selected from viral pathogen, bacterial pathogens and fungal pathogens,

Wherein said viral pathogen is selected from influenza virus, adenovirus, respiratory syncytial virus and parainfluenza virus,

Wherein said bacterial pathogens selected from Streptococcus, Moraxella, Mycoplasma, Kleb, haemophilus, Staphylococcus, chlamydiaceae and Legionella,

Wherein said fungal pathogens is selected from Aspergillus fumigatus, blastomyces, coccidioides immitis, Coccidiodes posadasii, Novel hidden Coccus, lattice spy cryptococcus, Fusarium spp., Histoplasma capsulatum, Paecilomyces varioti, Paracoccidioides brasiliensis, penicillium Marneffei, Family name's lung pityrosporion ovale, Bo Yide puppet Allescheriasis, Scedosporium apiospermum, rhizopus, mucormycosis, colter are mould, Cunninghamella sp, many Educate the many spores of match, stachybotrys chartarum, long shoot Trichoderma spp. and trichosporon bacteria.

9. pharmaceutical composition as claimed in claim 8, the chemotherapeutics of wherein said platiniferous is selected from cisplatin, carboplatin and Ao Shali Platinum.

10. pharmaceutical composition as claimed in claim 9, wherein said chemotherapeutics is cisplatin.