CN105803089A - Multi-PCR primer for identifying periplaneta americana and identifying method thereof - Google Patents
Multi-PCR primer for identifying periplaneta americana and identifying method thereof Download PDFInfo
- Publication number
- CN105803089A CN105803089A CN201610290365.1A CN201610290365A CN105803089A CN 105803089 A CN105803089 A CN 105803089A CN 201610290365 A CN201610290365 A CN 201610290365A CN 105803089 A CN105803089 A CN 105803089A
- Authority
- CN
- China
- Prior art keywords
- primer
- periplaneta americana
- identifying
- authentication method
- pcr amplification
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/16—Primer sets for multiplex assays
Abstract
The invention discloses a multi-PCR primer for identifying periplaneta americana and an identifying method thereof. The multi-PCR primer comprises a first primer pair and a second primer pair, wherein the first primer pair comprises a KLPERF28S1F and KLPERF28S1R; the sequence number of the KLPERF28S1F is SEQ ID NO.1; the sequence number of the KLPERF28S1R is SEQ ID NO.2; the second primer pair comprises KLND6F and KL12SRNAR; the sequence number of the KLND6F is SEQ ID NO.3; the sequence number of the KL12SRNAR is SEQ ID NO.4. The periplaneta americana can be simply and conveniently identified, so that the target of being simply, feasibly, economically and practically identifying the periplaneta americana is achieved.
Description
Technical field
The invention belongs to technical field of biological, be specifically related to a kind of multiple PCR primer for identifying periplaneta americana and authentication method thereof.
Background technology
Along with going deep into of means of taxonomic research, taxonomic foundation is maked rapid progress.Currently, molecular biological means are utilized to carry out Taxonomic analysis, it has also become one of necessary means.The classification foundation of traditional taxonomy is based on apparent, and morphological characters feature carries out species identification, but owing to most of class conditions are harsher, if sample is germling or defect, corrupt tissue etc., it is difficult to from the kind judging species from morphological feature.Then occurring in that the method utilizing qualification that DNA sequence carries out species, it is biological classification, the protection of Endangered species, and screening has the species of economic worth to provide conveniently, fast, and means accurately.
Periplaneta americana (Periplanetaamericana) be again ship Lian, croton bug etc., belongs to Insecta, Pterigota, Blattaria, Blattidae, the insecticide that the volume of Periplaneta is maximum.Becoming polypide to be about as about 30mm, in periplaneta americana being classified as in Shennong's Herbal, product are used as medicine, meaning " taste: salty, cold: to control: blood stain disease heavily fortified point cold and heat, removing mass are poly-, laryngopharynx closes, endogenous cold loss of fecundity ".It has a very wide distribution, and originates in Africa northern, mainly comprises the kind of Perenniporia martius, but its distribution extends to the north, temperate zone.In China Liaoning, Henan, Jiangsu, Shanghai, Zhejiang, Fujian, etc. economize.Owing to American-cockroach-extract can be applicable in fractures medicine.Its extract can promote that callus generates and fracture site skin healing；And shorten treatment time, cheap, evident in efficacy, provide a kind of new selection for clinical treatment fracture.And the effective site of periplaneta americana has significantly suppression herpes simplex virus activity, it is possible to suppress herpes simplex infections for preparing and prevent and treat medicine or the health product of relevant disease or symptom.
Therefore to identify periplaneta americana accurately, easy to use, Molecular tools is imperative accurately.But utilize molecule sequence measurement to carry out identifying species, it is necessary to great amount of cost.Vertebrates mitochondrial genome has the feature that molecular weight is little, sequence in the gene is tight, it does not have gene redundancy phenomenon, strict maternal inheritance, inorganization specificity and evolutionary rate are fast, but there is also Ji You Sudden change region, codon site slower in evolution and conservative region.Current mitochondrial DNA has been widely used as molecular marker for species identification.RRNA in eukaryotic gene group has hereditary conservation.
Summary of the invention
According to above the deficiencies in the prior art, the technical problem to be solved is to propose a kind of multiple PCR primer for identifying periplaneta americana and authentication method thereof, it is therefore intended that utilize specific multiple PCR primer, it is possible to when saving cost, quickly, periplaneta americana is identified exactly.
In order to solve above-mentioned technical problem, the technical solution used in the present invention is:
A kind of multiple PCR primer for identifying periplaneta americana, described multiple PCR primer includes the first primer pair and the second primer pair, described first primer pair includes KLPERF28S1F that serial number is SEQIDNO.1 and serial number is the KLPERF28S1R of SEQIDNO.2, and described second primer pair includes KLND6F that serial number is SEQIDNO.3 and serial number is the KL12SRNAR of SEQIDNO.4.
The present invention also provides for the authentication method of the multiple PCR primer for identifying periplaneta americana, and described authentication method comprises the steps:
A, extract testing sample complete genome DNA；
B, adopt described multiple PCR primer in step a extract complete genome DNA carry out pcr amplification；
C, take the pcr amplification product obtained in step b and carry out agarose gel electrophoresis detection；And judged by the band number of swimming lane appearance in agarose gel electrophoresis figure.
Wherein pcr amplification adopts polymerase chain reaction, is that a kind of for amplifying the Protocols in Molecular Biology expanding specific DNA fragmentation, it is considered as the special DNA replication dna of in vitro, and the maximum feature of PCR, is to be significantly increased by the DNA of trace.
Band number described in step c is two, and length respectively 2600bp and the 260bp of DNA fragmentation contained in two band.In the agarose gel electrophoresis figure of step c gained, if the swimming lane containing the product obtained of b in steps occurs two band, then judge that described testing sample is the sample from periplaneta americana, if the swimming lane containing the product obtained of b in steps occurs without two band, then judge that described testing sample is not from the sample of periplaneta americana.
The extraction of complete genome DNA adopts phenol, chloroform extraction method to extract.
Pcr amplification described in step b is that the concentration of every primer respectively 1.1 μ l (concentration of primer is one of successful most important point of this patent), the consumption of template complete genome DNA is 1 μ l with the PCR amplification system of 25 μ l for benchmark.Wherein, can be this area typical polymerization enzyme and buffer for the polymerase of pcr amplification and buffer.This kind of consumption mode is adopted to be to reach better pcr amplification effect so that the agarose gel electrophoresis figure obtained is apparent visible, it is simple to determine experimental result better.
In the process of pcr amplification described in step b, annealing temperature is 53-55 DEG C (annealing time is also one of successful most important point of the present invention), and annealing time is 40s-1min (annealing time is also one of successful most important point of the present invention).Pcr amplification with this understanding is obtained in that better expanding effect.It addition, be, for the Denaturing in pcr amplification, extension condition and the isoparametric setting of period, the setting that this area is conventional.
In order to reach the pcr amplification effect of the best, described annealing temperature the best is 54 DEG C, and described annealing time the best is 1min.
Specifically, the multi-PRC reaction system adopted: 10*Ex-taqbuffer2.5 μ l, every each 1.1 μ l of primer, the dNTPMix of 2 μ l, the Ex-Taq enzyme of 0.13 μ l and the complete genome DNA of 1 μ l, the BSA (bovine serum albumin) of the DMSO (dimethyl sulfoxide) of 1 μ l, 1 μ l, and with distilled water polishing to 25 μ l.
PCR reaction condition is: 95 DEG C of denaturation 5min；Then carrying out 30 circulations, this circulation includes: 94 DEG C degeneration 1min, 53-60 DEG C annealing 40s-1min and 72 DEG C of extension 3min；Finally remake 72 DEG C and extend 7min.Carry out pcr amplification under the above-described reaction conditions.Product after amplification is carried out agarose gel electrophoresis, and electrophoresis result is (swimming lane is numbered 1) as shown in Figure 1.
The medicine have the advantages that the present invention passes through two groups of PCR primer of design, the method utilizing multiplexed PCR amplification, to testing sample by once general pcr amplification, show again through the band in agarose gel electrophoresis figure and determine whether these species are periplaneta americana, and template used can extract from the tissue such as the fur of animal, muscular tissue, internal organs shell, greatly reduce the difficulty of sampling, and the method can identify periplaneta americana quickly and easily, thus having reached simple and easy to do, the economical and practical purpose identifying periplaneta americana exactly.
Accompanying drawing explanation
Below the content expressed by this specification accompanying drawing and the labelling in figure are briefly described:
Fig. 1 is the agarose gel electrophoresis figure of various embodiments of the present invention and comparative example.
Wherein, swimming lane 1 is from periplaneta americana muscle samples, swimming lane 5 is from the muscle samples of Peroplaneta fluligginosa, swimming lane 9 is from the muscle samples of Doby Asia Blatta seu periplaneta, swimming lane 13 is from the muscle samples of bright cherry-red Blatta seu periplaneta, swimming lane 17 is from the muscle samples of star head Picus canus, swimming lane 18 is from the muscle samples of little woodpie, swimming lane 19 is from the muscle samples of Circus aeruginosus, swimming lane 20 is from the muscle samples of Grusgrus (Linnaeus), swimming lane 21 is from the muscle samples of little egret, swimming lane 22 is from the muscle samples of night heron, swimming lane 23 is from the muscle samples of long-tail minivet, swimming lane 24 is from the muscle samples of yellow abdomen titmouse, swimming lane M is molecular weight marker.
Detailed description of the invention
Below against accompanying drawing, by the description to embodiment, manufacturing process that the specific embodiment of the present invention is such as involved and operate with method etc., it is described in further detail, to help those skilled in the art that the inventive concept of the present invention, technical scheme are had more complete, accurate and deep understanding.
It is necessary to clarify that, the primer of the present invention is 5umol by the synthesis of general biological system (Anhui) company limited and primer concentration, the commercially available product that PCR raw material is Takara company such as dNTPMix used in the present invention, all the other chemical reagent used are conventional commercial analytical reagent, and are all purchased from Shanghai Sheng Gong biological engineering company limited.nullIn the present invention, institute's employing instrument specifically includes that Eppendorf refrigerated centrifuger 5415D、High speed refrigerated centrifuge Allegrax-22R、Bio-radPCR instrument Icycler、Common desktop centrifuge TGL-16B、Drying baker DGX-9143BC-1、Bio-rad gel imaging system GELDOCXR、High-pressure sterilizing pot LDZX-50KBS、Micropipettor EPPENDORF (2.5 μ L、10μL、20μL、100μL、200μL、1000μL、5mL)、Superclean bench SW-CJ-2FD、Large-scale double-deck constant-temperature table SKY2012C、Electric constant-temp incubator DHP-360、Electric-heated thermostatic water bath DK-S28、Electronic balance FA1104B、-40 DEG C/-20 DEG C/4 DEG C refrigerators (U.S. of middle section Pedicellus et Pericarpium Trapae) etc...
Drawing materials of sample: 2 periplaneta americanaes, 2 Peroplaneta fluligginosas, 2 Doby Asia Blatta seu periplanetaes, 2 bright cherry-red Blatta seu periplanetaes, 1 star head Picus canus, 1 little woodpie, 1 Circus aeruginosus, 1 Grusgrus (Linnaeus), 1 little egret, 1 night heron, 1 long-tail minivet, 1 yellow abdomen titmouse.
Embodiment 1
1) extraction of complete genome DNA: adopt phenol, chloroform extraction method, take about 100mg periplaneta americana muscular tissue sample as testing sample, be numbered 1 (see table 1 below), shreds the EP pipe being placed on a sterilized 2.0ml；
2) in EP pipe, add the DNA extraction liquid of 1ml and the RNaseA (ribonuclease) of 4 μ l20mg/ml, shake up and be placed on water-bath 1h in 37 DEG C of water-baths；
3) taking out EP pipe, add the E.C. 3.4.21.64 of 5 μ l20mg/ml, shake up and be placed in 50 DEG C of water-baths water-bath and be about 2-3h, until muscle catapepsis, period shakes up up and down every 10min；
4) taking out EP pipe, after being cooled to room temperature, add isopyknic saturated phenol, gentleness shakes up up and down about 7 minutes until aqueous phase is mixed into emulsion mutually with phenol；
5) 10000rPm, centrifugal 15min at 10 DEG C, take out upper strata aqueous phase to another 20mlEP pipe；
6) repeat step 4) phenol extraction one to secondary；
7) adding isopyknic CI (chloroform isoamyl alcohol), gentleness shakes up about centrifugal 15min at 7min, 10000rPm, 10 DEG C up and down, takes out upper strata aqueous phase to another 2.0mlEP pipe；
8) again add isopyknic CI and shake up about centrifugal 15min at 7min, 10000rPm, 10 DEG C up and down, taking out upper strata aqueous phase and (be dispensed in two pipes, often pipe 300 μ l) to another 1.5mlEP pipe
9) adding the 3mol/lNaAC of 1/5 volume and the dehydrated alcohol of 2 times of volume pre-coolings, room temperature jog EP pipe is placed in-20 DEG C of refrigerator-freezers freezing 3h；
10) from refrigerator-freezer, take out EP pipe, 12000rPm, 4 DEG C of centrifugal 15min, and abandon supernatant；
11) add 500 μ l75% ethanol rinse, 12000rPm, 4 DEG C of centrifugal 15min, and abandon supernatant；
12) add 500 μ l75% ethanol rinse, 12000rPm, 4 DEG C of centrifugal 15min, and abandon supernatant, rear air-dry precipitation；
13) 100 μ l1*TE (buffer solution by Tris and EDTA configuration) dissolving DNA is added；
14) take 2 μ lDNA solution and carry out agarose gel electrophoresis；
15) complete genome DNA is placed in-40 DEG C of refrigerator-freezers and stores.
16) PCR reaction: add 10*Ex-taqbuffer2.5 μ l in the sample cell of PCR instrument, every each 1.1 μ l (see table 2 below) of primer, the dNTPMix of 2 μ l, the Ex-Taq enzyme of 0.13 μ l and the complete genome DNA of 1 μ l, the DMSO (dimethyl sulfoxide) of 1 μ l, the BSA (bovine serum albumin) of 1 μ l, and with distilled water polishing to 25 μ l.
PCR reaction condition is: 95 DEG C of denaturation 5min；Then carrying out 30 circulations, this circulation includes: 94 DEG C of degeneration 1min, 54 DEG C of annealing 1min and 72 DEG C of extension 3min；Finally remake 72 DEG C and extend 7min.Carry out pcr amplification under the above-described reaction conditions.Product after amplification is carried out agarose gel electrophoresis, and electrophoresis result is (swimming lane is numbered 1) as shown in Figure 1.
17) agarose gel electrophoresis step:
(1) melting: prepare 1% agarose gel, weigh 0.5g agarose and be placed in conical flask, add 1 × TAE50mL, seal with preservative film, microwave-oven-heating boils and all melts to agarose, shakes up.
(2) making sheet: glue plate is placed in horizontal level, and puts comb well in fixed position.Treat that gel is cooled to about 65 DEG C, add 0.5ul ethidium bromide, mixing, in the glued membrane that the people that fallen in time, carefully by glue makes, allow coagulant liquid slowly launch, make whole glue plate surface form uniform glue-line.Note removing the bubble in gel in time.Room temperature stands, and after gel solidifies completely, vertically gently pulls out comb, takes off adhesive tape, gel and inside groove is put in full 1xTAE electrophoretic buffer electrophoresis tank.
(3) application of sample: application of sample takes the mixed liquor sample of DNA and bromophenol blue and 2ul15000bpDNALadderMarker (TaKaRa, Code:D515A) sample on point template.Respectively sample is added with pipettor in the sample sulculus of offset plate, often add a sample, a feed head should be changed, with anti-pollution.The gel face around sample well (noting: first to write down the order of application of sample during application of sample) is not broken during application of sample.
(4) electrophoresis: after electrophoresis application of sample, gel is energized electrophoresis immediately, and voltage 110V, sample is moved to positive extreme direction by negative pole.Voltage is more high, and DNA migration rate is more big.
(5) observe electrophoresis complete, take out gel, take pictures under gel imaging system, save backup.
Embodiment 2
It is operated according to the method for embodiment 1, the difference is that, testing sample Peroplaneta fluligginosa is numbered 5 (see table 1 below), the consumption of every primer is 1.1 μ l, the consumption of complete genome DNA is 1 μ l, annealing temperature is 53 DEG C, and annealing time is 40s, and electrophoresis result is (swimming lane is numbered 5) as shown in Figure 1.
Embodiment 3
It is operated according to the method for embodiment 1, the difference is that, Blatta seu periplaneta is numbered 9 (see table 1 below) in testing sample Doby Asia, the consumption of every primer is 1.1 μ l, the consumption of complete genome DNA is 1 μ l, annealing temperature is 54 DEG C, and annealing time is 1min, electrophoresis result and embodiment 1 identical (swimming lane is numbered 9).
Embodiment 4
It is operated according to the method for embodiment 1, the difference is that, the bright cherry-red Blatta seu periplaneta of testing sample is numbered 13 (see table 1 below), the consumption of every primer is 1.1 μ l, the consumption of complete genome DNA is 1 μ l, annealing temperature is 55 DEG C, and annealing time is 1min, and electrophoresis result is (swimming lane is numbered 13) as shown in Figure 1.
Comparative example 1
By the complete genome DNA of the star head Picus canus that is numbered 17 in table 1, carrying out expanding and agargel electrophoresis according to the method for embodiment 1, electrophoresis result is (swimming lane is numbered 17) as shown in Figure 1.
Comparative example 2
It is operated according to the method for embodiment 1, the difference is that, the little woodpie of testing sample is numbered 18 (see table 1 below), and electrophoresis result is (swimming lane is numbered 18) as shown in Figure 1.
Comparative example 3
It is operated according to the method for embodiment 1, the difference is that, testing sample Circus aeruginosus is numbered 19 (see table 1 below), and electrophoresis result is (swimming lane is numbered 19) as shown in Figure 1.
Comparative example 4
It is operated according to the method for embodiment 1, the difference is that, testing sample Grusgrus (Linnaeus) is numbered 20 (see table 1 below), and electrophoresis result is (swimming lane is numbered 20) as shown in Figure 1.
Comparative example 5
It is operated according to the method for embodiment 2, the difference is that, testing sample little egret is numbered 21 (see table 1 below), and electrophoresis result is (swimming lane is numbered 21) as shown in Figure 1.
Comparative example 6
It is operated according to the method for embodiment 2, the difference is that, testing sample night heron numbering 22 (see table 1 below), electrophoresis result is (swimming lane is numbered 22) as shown in Figure 1.
Comparative example 7
It is operated according to the method for embodiment 2, the difference is that, testing sample long-tail minivet is numbered 23 (see table 1 below), and electrophoresis result is (swimming lane is numbered 23) as shown in Figure 1.
Comparative example 8
It is operated according to the method for embodiment 2, the difference is that, testing sample Huang abdomen titmouse is numbered 24 (see table 1 below), and electrophoresis result is (swimming lane is numbered 24) as shown in Figure 1.
PCR primer obtained to the various embodiments described above and comparative example is delivered to general biological system (Anhui) company limited check order.
The sample message of embodiment 1-3 and comparative example 1-8 such as table 1 below
| Numbering | Species | Sample type | Locality |
| 1 | Periplaneta americana (Periplaneta americana) | Muscle | Wuhu |
| 5 | Peroplaneta fluligginosa (Periplaneta fuliginosa) | Muscle | Wuhu |
| 9 | Doby Asia Blatta seu periplaneta (Blaptica dubia) | Muscle | Shanghai |
| 13 | Bright cherry-red Blatta seu periplaneta (Blatta lateralis) | Muscle | Qingdao |
| 17 | Star head Picus canus (Dendrocopos canicapillus) | Muscle | Yancheng, Jiangsu Province |
| 18 | Little woodpie (Dendrocopos minor) | Muscle | Yancheng, Jiangsu Province |
| 19 | Circus aeruginosus (Grus monacha) | Muscle | Liter Jinhu County, Anhui |
| 20 | Grusgrus (Linnaeus) (Grus grus) | Muscle | Harbin Zoo |
| 21 | Little egret (Egretta garzetta) | Muscle | Xuancheng Profile, anhui Province |
| 22 | Night heron (Nycticorax nycticorax) | Muscle | Anhui Chizhou City |
| 23 | Long-tail minivet (Pericrocotus ethologus) | Muscle | Wuhu |
| 24 | Yellow abdomen titmouse (Parus venustulus) | Muscle | Xuancheng Profile, anhui Province |
The primer such as table 2 below that the various embodiments described above adopt with comparative example
| NO | Primer | Sequence | Base number | Nucleic acid type | |
| NO.1 | KLPERF28S1F | TGCTCTCCCGACCCGTCTTGAA | 22 | DNA | Artificial |
| NO.2 | KLPERF28S1R | TCAGAATCGCTGCGGACCTCCA | 22 | DNA | Artificial |
| NO.3 | KLND6F | AGGACCTCTACGACAAATAA | 20 | DNA | Artificial |
| NO.4 | KL12SRNAR | GAGGGTGACGGGCGGTGTGT | 20 | DNA | Artificial |
nullBe can be seen that by the electrophoretogram shown in the sample message of table 1 and Fig. 1，The present invention is by designing two groups of PCR primer，To testing sample only by once common pcr amplification，Show again through the band in agarose gel electrophoresis figure and judge whether these species are periplaneta americana，And electrophoresis result and sample message comply fully with，Confirm the reliability of this authentication method，Simultaneously，Deliver to after in the sequence of the DNA fragmentation that general biological system (Anhui) company limited carries out checking order and data base, the sequence of the periplaneta americana species that oneself exists is compared，The comparison result obtained shows that the homology of the sequence of the sequence of the DNA fragmentation of this order-checking and the periplaneta americana species of oneself existence is more than 97%，So also further demonstrate that the species of this testing sample are periplaneta americana，And in this experiment，Template used can from the fur of animal、Muscular tissue、Internal organs、The tissue such as shell extracts，Greatly reduce the difficulty of sampling，And the method can identify periplaneta americana quickly and easily，Thus having reached simple and easy to do，The economical and practical purpose identifying periplaneta americana exactly.
Above in conjunction with accompanying drawing, the present invention is exemplarily described; the obvious present invention implements and is not subject to the restrictions described above; as long as have employed the improvement of the various unsubstantialities that the design of the method for the present invention carries out with technical scheme; or the not improved design by the present invention and technical scheme directly apply to other occasion, all within protection scope of the present invention.Protection scope of the present invention should be as the criterion with claims protection defined.
Claims (6)
1. the multiple PCR primer being used for identifying periplaneta americana, it is characterized in that, described multiple PCR primer includes the first primer pair and the second primer pair, described first primer pair includes KLPERF28S1F that serial number is SEQIDNO.1 and serial number is the KLPERF28S1R of SEQIDNO.2, and described second primer pair includes KLND6F that serial number is SEQIDNO.3 and serial number is the KL12SRNAR of SEQIDNO.4.
2. according to claim 1 for identifying the authentication method of the multiple PCR primer of periplaneta americana, it is characterised in that described authentication method comprises the steps:
A, extract testing sample complete genome DNA；
B, adopt described multiple PCR primer in step a extract complete genome DNA carry out pcr amplification；
C, take the pcr amplification product obtained in step b and carry out agarose gel electrophoresis detection；And judged by the band number of swimming lane appearance in agarose gel electrophoresis figure.
3. authentication method according to claim 2, it is characterised in that band number described in step c is two, and length respectively 2600bp and the 260bp of DNA fragmentation contained in two band.
4. authentication method according to claim 2, it is characterised in that pcr amplification described in step b is that the concentration of every primer is 1.1 μ l respectively, and the consumption of template complete genome DNA is 1 μ l with the PCR amplification system of 25 μ l for benchmark.
5. authentication method according to claim 2, it is characterised in that in the process of pcr amplification described in step b, annealing temperature is 53-55 DEG C, and annealing time is 40s-1min.
6. authentication method according to claim 5, it is characterised in that described annealing temperature is 54 DEG C, and described annealing time is 1min.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610290365.1A CN105803089A (en) | 2016-05-05 | 2016-05-05 | Multi-PCR primer for identifying periplaneta americana and identifying method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610290365.1A CN105803089A (en) | 2016-05-05 | 2016-05-05 | Multi-PCR primer for identifying periplaneta americana and identifying method thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN105803089A true CN105803089A (en) | 2016-07-27 |
Family
ID=56456133
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610290365.1A Pending CN105803089A (en) | 2016-05-05 | 2016-05-05 | Multi-PCR primer for identifying periplaneta americana and identifying method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105803089A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107177680A (en) * | 2017-06-08 | 2017-09-19 | 四川好医生攀西药业有限责任公司 | American cockroach specific COI primer, the kit containing it and application |
| CN108950022A (en) * | 2018-09-03 | 2018-12-07 | 大理大学 | A kind of DNA bar code standard detection segment 16S rRNA, kit and its application method identifying American cockroach |
| CN109022595A (en) * | 2018-09-03 | 2018-12-18 | 大理大学 | A kind of DNA bar code standard detection segment, kit and its application method identifying American cockroach |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104059978A (en) * | 2014-06-27 | 2014-09-24 | 安徽师范大学 | Multi-polymerase chain reaction (PCR) primer and method for identifying clouded leopard and application of primer or method in identification of clouded leopard |
| CN104059979A (en) * | 2014-06-27 | 2014-09-24 | 安徽师范大学 | Multiplex PCR (polymerase chain reaction) primers and method for identifying Panthera pardus, and application thereof in identifying Panthera pardus |
| CN104651486A (en) * | 2014-08-12 | 2015-05-27 | 岳巧云 | Method and kit for visually identifying American cockroaches |
| CN105441547A (en) * | 2015-12-18 | 2016-03-30 | 安徽师范大学 | Multiple PCR primer used for identifying hynobius amjiensis, method and application |
-
2016
- 2016-05-05 CN CN201610290365.1A patent/CN105803089A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104059978A (en) * | 2014-06-27 | 2014-09-24 | 安徽师范大学 | Multi-polymerase chain reaction (PCR) primer and method for identifying clouded leopard and application of primer or method in identification of clouded leopard |
| CN104059979A (en) * | 2014-06-27 | 2014-09-24 | 安徽师范大学 | Multiplex PCR (polymerase chain reaction) primers and method for identifying Panthera pardus, and application thereof in identifying Panthera pardus |
| CN104651486A (en) * | 2014-08-12 | 2015-05-27 | 岳巧云 | Method and kit for visually identifying American cockroaches |
| CN105441547A (en) * | 2015-12-18 | 2016-03-30 | 安徽师范大学 | Multiple PCR primer used for identifying hynobius amjiensis, method and application |
Non-Patent Citations (1)
| Title |
|---|
| 王秀丹: "中国弯翅蠊亚科分类研究", 《中国优秀硕士学位全文数据库(电子期刊)基础科学辑》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107177680A (en) * | 2017-06-08 | 2017-09-19 | 四川好医生攀西药业有限责任公司 | American cockroach specific COI primer, the kit containing it and application |
| CN107177680B (en) * | 2017-06-08 | 2019-02-05 | 四川好医生攀西药业有限责任公司 | American cockroach specific COI primer, the kit containing it and application |
| CN108950022A (en) * | 2018-09-03 | 2018-12-07 | 大理大学 | A kind of DNA bar code standard detection segment 16S rRNA, kit and its application method identifying American cockroach |
| CN109022595A (en) * | 2018-09-03 | 2018-12-18 | 大理大学 | A kind of DNA bar code standard detection segment, kit and its application method identifying American cockroach |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Schwartz et al. | Isolation and partial characterization of the multiple forms of deoxyribonucleic acid-dependent ribonucleic acid polymerase in the mouse myeloma, MOPC 315 | |
| CN107177680B (en) | American cockroach specific COI primer, the kit containing it and application | |
| CN104450920B (en) | MicroRNA trace detection method based on exponential non-enzymatic amplification and electrochemiluminescence principle | |
| CN103397091A (en) | Polymerase chain reaction (PCR) method for identifying sex of young pigeons | |
| CN106801109B (en) | RT-PCR detection specific primer, kit and detection method for swine atypical pestivirus | |
| CN105803089A (en) | Multi-PCR primer for identifying periplaneta americana and identifying method thereof | |
| Miao et al. | Analysis of the transcriptional regulation of cancer-related genes by aberrant DNA methylation of the cis-regulation sites in the promoter region during hepatocyte carcinogenesis caused by arsenic | |
| CN105648087A (en) | Specific primers and probes for bovine-derived real-time fluorescent PCR (polymerase chain reaction) detection | |
| CN104673935A (en) | Detection method and detection kit of gene II type grass carp reovirus | |
| CN105671167A (en) | Specific primer-probe set for porcine-derived real-time fluorescent PCR (polymerase chain reaction) detection | |
| CN107904232A (en) | A kind of method of the rapid extraction nucleic acid from sputum | |
| CN103333958B (en) | Method for detecting telomerase through washing-free anchored-extension and telomeric-binding amplification and kit | |
| CN102115743A (en) | Novel method and kit for extracting high-quality RNA (Ribose Nucleic Acid) from paraffin-embedded tissue | |
| Pascual-Ahuir et al. | Genome-wide location analysis of the stress-activated MAP kinase Hog1 in yeast | |
| Nachaliel et al. | A cAMP-regulated RNA-binding protein that interacts with phosphoenolpyruvate carboxykinase (GTP) mRNA. | |
| CN106011276B (en) | For identifying that the species specificity PCR of the balcony frog identifies primer and method and application | |
| CN107604077B (en) | A kind of multiple PCR primer and method of Rapid identification Blattaria insect species | |
| Fimia et al. | Double-stranded internucleosomal cleavage of apoptotic DNA is dependent on the degree of differentiation in muscle cells | |
| CN107828872A (en) | The detection reagent of Pygo2 gene expressions in Wnt signal paths based on peptide nucleic acid probe | |
| Zhang et al. | Retracted: MicroRNA‐132 protects H9c2 cells against oxygen and glucose deprivation‐evoked injury by targeting FOXO3A | |
| CN104561379A (en) | Detection method and detection kit of genotype I grass carp reovirus | |
| Powell et al. | Control of feather keratin synthesis by the availability of keratin mRNA | |
| CN103160496B (en) | Method for extracting and purifying total RNA (ribonucleic acid) of blood of large-scale experimental animal | |
| CN102108420A (en) | Fluorescence quantitative polymerase chain reaction (PCR) kit for detecting dengue virus type 1 | |
| CN102586237B (en) | A kind of Polynucleotide molecule and its application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20160727 |
|
| RJ01 | Rejection of invention patent application after publication |