CN105802964B - The detection and its application of a kind of cRNA-FUT8 for hepatocellular carcinoma examination - Google Patents
The detection and its application of a kind of cRNA-FUT8 for hepatocellular carcinoma examination Download PDFInfo
- Publication number
- CN105802964B CN105802964B CN201610251595.7A CN201610251595A CN105802964B CN 105802964 B CN105802964 B CN 105802964B CN 201610251595 A CN201610251595 A CN 201610251595A CN 105802964 B CN105802964 B CN 105802964B
- Authority
- CN
- China
- Prior art keywords
- hepatocellular carcinoma
- crna
- fut8
- kit
- circular rna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6834—Enzymatic or biochemical coupling of nucleic acids to a solid phase
- C12Q1/6837—Enzymatic or biochemical coupling of nucleic acids to a solid phase using probe arrays or probe chips
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/118—Prognosis of disease development
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Molecular Biology (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- General Health & Medical Sciences (AREA)
- Immunology (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- Analytical Chemistry (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- Biomedical Technology (AREA)
- Pathology (AREA)
- Plant Pathology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Hospice & Palliative Care (AREA)
- Oncology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates generally to a kind of detection and its application of the cRNA FUT8 for hepatocellular carcinoma examination, specific method is with biochip technology, by carrying out cancer and cancer beside organism's cell cRNA FUT8 express spectra variance analyses, screen the circular rna of an apparent high expression in Human Hepatocellular Carcinoma Tissues, cRNA FUT8.Compared with Carcinoma side normal tissue, the circular rna significantly high expression in Human Hepatocellular Carcinoma Tissues, and further confirm expression quantity of the cRNA FUT8 in Human Hepatocellular Carcinoma Tissues apparently higher than normal structure with real-time quantitative PCR, Northern Blot experiments.This cRNA FUT8 studied recently will provide new visual angle for hepatocellular carcinoma recurrence and the research of metastasis, also be the diagnosis of hepatocellular carcinoma, prognosis and treatment provide new evaluation index and intervene target spot.
Description
Technical field
The present invention ranges oncomolecularbiology field, is mainly used for the detection and application of a kind of circular rna, specific next
It says, the present invention even treats hepatocellular carcinoma on a kind of circular rna, i.e. cRNA-FUT8 in preparation auxiliary diagnosis, prognosis evaluation
Related preparations in application.
Background technology
Hepatocellular carcinoma (Hepatocellular carcinoma, HCC) (abbreviation liver cancer) is that the whole world is most common pernicious swollen
One of knurl, in the cancer cause of the death of male, liver cancer comes second, and lung cancer is only second to more than stomach cancer, and its incidence is steady
It is fixed to rise, and the liver cancer patient number of the infected in China accounts for the total half of whole world morbidity.Liver cancer has " early diagnosis is difficult ", " answers
The problem of hair rate height ", " poor prognosis ", rapid concealment of falling ill, making a definite diagnosis for most of liver cancer patient is late.At this time except
Operation is outer, and often without available therapy, and operative effect is extremely limited, and median survival time is only the several months.This
Outside, HCC high recurrence rates, the postoperative rate of Patients on Recurrence in two years may be up to 62%-82%.
Hepatocellular carcinoma early stage efficient diagnosis is difficult, tumor development is hidden rapidly, high recurrence rate, and the therapeutic effects such as operation have
Therefore limit, it is particularly important as diagnosis of hepatoma and the target spot for the treatment of to excavate novel tumor markers.Circular rna
(circularRNA, circRNA) is called annular RNA, is the special non-coding RNA (non-of the one kind confirmed for nearly 2 years
CodingRNA, ncRNA) molecule, over 2 years, circRNA rapidly becomes the research hotspot in non-coding RNA family.circRNA
It is a kind of annular RNA molecule being mainly made of 2 and above extron, is largely present in eukaryocyte, there is certain group
It knits, sequential and disease specific.The byproduct that early stage circRNA is considered as wrong alternative splicing and is formed, belongs to nature
A kind of middle extremely rare phenomenon.With the fast development of the technologies such as the big flux sequencings of RNA, people are in broad scale research transcript profile data
Shi Faxian, circ RNA are largely present in eukaryocyte.There are a kind of reversed alternative splicings in eucaryote so that base
Reversely connection forms annular RNA to the exon sequence of cause from beginning to end.The study found that circRNA may act as miRNA sponges, it is competitive
Inhibit the transcription of miRNA, so as to participate in post-transcriptional control.In addition, circRNA may also be combined with rna binding protein or with
Other RNA pass through base pair complementarity.The miRNA of circRNA and disease association interactions are adjusted so as to be played in disease
Control acts on.Therefore, cricoid expression progress and the prognosis out of control that may influence even to determine tumour.Based on this point or can probe into
Marker that circRNA is diagnosed as clinical tumor or even its can be excavated become the biological targets of oncotherapy.
The content of the invention
Present invention chip gene expression profile technology carries out differential expression spectrum to cancer and cancer beside organism's cell cyclic and divides
Analysis filters out the circRNA in the high expression of human hepatocellular carcinoma.CircRNA transcript regions are located at No. 14 chromosomes, overall length 431bp.
Compared with Carcinoma side normal tissue, circRNA high expression in human liver cell cancer cell, and with real-time quantitative PCR, Northern
Blot experiments further confirm expression quantity of the circRNA in human hepatocellular carcinoma interstitial cell apparently higher than normal structure.This
New cRNA-FUT8 will provide new visual angle for hepatocellular carcinoma recurrence and the research of metastasis, also examining for hepatocellular carcinoma
Disconnected, prognosis and treatment provide new evaluation index and intervene target spot.
The 3 pairs of hepatocellular carcinomas and cancer beside organism that inventor provides, pass through the TRIZOL reagent (article No.s of SIGMA companies
T9424 after step extraction total serum IgE needed for), the ArrayStar companies acted on behalf of using upper Haikang into bioengineering Co., Ltd
CRNA-FUT8 chip products (Human cRNA-FUT8Microarray V3.0 Service) are detected, and filter out one
The cRNA-FUT8 of significantly high expression in Tissues of Hepatocellular Carcinoma is named as cRNA-FUT8, nucleotide sequence such as SEQ ID
Shown in No.1.Later stage is verified by 28 pairs of human hepatocellular carcinomas and cancer beside organism's sample fluorescence quantitative PCR, finds in 26 pairs of samples,
The cRNA-FUT8 of tumor tissues is significantly higher than cancer beside organism.Novel targets of the cRNA-FUT8 as hepatocellular carcinoma are hepatocellular carcinoma
Clinical treatment and drug development provide fundamental basis.
Specifically, the first aspect of the invention provides a kind of cRNA-FUT8 of expression high in Tissues of Hepatocellular Carcinoma,
The nucleotide sequence of its entitled cRNA-FUT8, corresponding cDNA such as SEQ ID No.1 (5 ' → 3 ' direction) or its complementary sequence
Shown in row.The cRNA-FUT8 can be separated and/or artificial synthesized.
CRNA-FUT8 described in the second aspect of the invention offer the first aspect of the present invention is used to prepare diagnosis liver cell
The drug of cancer or the purposes of kit.Additionally provide can test right requirement 1 described in circular rna (cRNA-FUT8) table
Purposes of the reagent (such as target its specific primer to) reached in the diagnosticum of diagnosing hepatocellular carcinoma or kit is prepared.
In a preferred embodiment, the cRNA-FUT8 is used for the auxiliary diagnosis of hepatocellular carcinoma.
The third aspect of the invention provides a kind of kit for diagnosing hepatocellular carcinoma, including：
1) it is used to expand the specific primer pair of cRNA-FUT8；
2) standard DNA template (such as sample cDNA from hepatic tissue)；
3) PCR reaction solution.
In a preferred embodiment, the specific primer draws to including sense primer and anti-sense primer, upstream
Object sequence is SEQ ID No.2, and downstream primer sequence is SEQ ID No.3.
In a further preferred embodiment, the kit is fluorescent quantificationally PCR detecting kit, and the primer is fitted
For SYBR Green, the detection of TaqMan probe, molecular beacon, double cross probe, combined probe.
In a further preferred embodiment, the PCR reaction solution in the kit is fluorescence quantitative PCR reaction solution,
And further include fluorescent dye.
In a further preferred embodiment, the fluorescence quantitative PCR reaction solution includes dNTP, Mg2+, Taq enzyme and
Buffer buffer solutions, the fluorescent dye are SYBR Green II, and Taq enzyme is thermal starting enzyme.
The present invention PCR kit for fluorescence quantitative be suitable for presently, there are in the market all types fluorescent quantitation gene expansion
Increase instrument, high sensitivity, specificity is good, has a good application prospect.
The fourth aspect of the invention provides a kind of method for detecting long-chain non-coding RNA, and the described method includes following steps
Suddenly：
1) sample total serum IgE is extracted；
2) sample cDNA is prepared；
3) cRNA-FUT8 is expanded.
In a preferred embodiment, described method includes following steps：
1) sample total serum IgE is extracted：It is carried according to reagent and step needed for the TRIZOL reagents (article No. T9424) of SIGMA companies
Total serum IgE is taken, then adjusts quantitative instrument quantitative (Applied Biosystems AB) with 7300 real-time PCR systems and quantifies what is extracted
The purity and concentration of RNA.
2) sample cDNA is prepared：Using Beijing Kang Run Cheng Ye bio tech ltd StarScript II One-step
RT-PCR kit (article No. A215-01) synthesizes cDNA to the total serum IgE reverse transcription of extraction.
The first step opens RNA secondary structures, and reaction system and condition are as follows：
| Reagent | Dosage |
| Oligo dT | 1ul |
| RNA | 1-2ug |
| DEPC water | Polishing is to 20ul |
To 70 degree of reaction 5min and then ice bath 10min after the above components are mixed
Second step reverse transcription reaction, reaction system and condition are as follows：
| Reagent | Dosage |
| 2.5mM dNTP | 2.5ul |
| 5×RT buffer | 6ul |
| HPR (RNase inhibitor) | 0.6ul |
| MLV (reverse transcriptase) | 0.4ul |
By said components 42 DEG C of incubation 1h after mixing, then 10min are inactivated to get to cDNA for 70 degree.
3) cRNA-FUT8 is expanded：Using Beijing Kang Run Cheng Ye bio tech ltd 2 × RealStar Power
SYBR Mixture UNG fluorescence quantitative kits (article No. A312) carry out quantitative fluorescent PCR by template of the cDNA of reverse transcription
Amplification.
Quantitative fluorescent PCR system：
| Reagent | Dosage |
| 2×MIX | 10ul |
| 50×ROX | 2ul |
| Primer | Each 1ul |
| DNA profiling | 1ul |
| RNase Free ddH2O | Polishing is to 20ul |
Quantitative fluorescent PCR program：95 DEG C of 30s pre-degenerations connect 40 Xun Huans：95 DEG C of 30s, 60 DEG C of 30s.
By the detection to positive, quantification kit Detection accuracy of the present invention is found as 83%-87%, continuous 3
Secondary to repeat to test, experimental result is stablized.
The fifth aspect of the invention provides a kind of method for aiding in detection hepatocellular carcinoma, and the described method includes following steps
Suddenly：
1) sample total serum IgE is extracted；
2) sample cDNA is prepared；
3) quantitative amplification cRNA-FUT8, and judged according to relative quantification result.
The cRNA-FUT8 that the sixth aspect of the invention provides described in the first aspect of the present invention is used as hepatocellular carcinoma drug
Novel targets purposes.
It is glimmering the invention also discloses a kind of application method for the dye class PCR kit for fluorescence quantitative for detecting hepatocellular carcinoma
Fluorescent Quantitative PCR system：
Sense primer；Each 1ul of anti-sense primer (10uM)；DNA profiling cDNA 1ul；50XROX 2ul；2×SYBR Green
II 10uL add ionized water to 5uL.Quantitative fluorescent PCR program：95 DEG C of 30s pre-degenerations connect 40 Xun Huans：95 DEG C of 30s, 60 DEG C
30s。
Description of the drawings
Fig. 1 .cRNA-FUT8 chip dendrograms show 6 pairs of hepatocellular carcinomas and the cRNA-FUT8 of cancer beside organism's differential expression
Chip clusters.
Fig. 2 are surveyed for row agarose gel electrophoresis after 1 pair of specific primer PCR amplification of the sequence design of cRNA-FUT8
Try the effect of primer.
The cRNA-FUT8 verification qRT-PCR testing results of .28 hepatocellular carcinoma clinical samples of Fig. 3.
Specific embodiment
Embodiment 1：Human hepatocellular carcinoma and the cRNA-FUT8 chip expression analysis of cancer beside organism
First, material and method
1. material
Tissue samples come from 3 pairs of patients with hepatocellular carcinoma inpatient's surgery excision sample (all tissue samples come
From upper marine mountain hospital liver tumour surgery), each pair includes Tissues of Hepatocellular Carcinoma and the Carcinoma side normal tissue of pairing.
2. method
(1) extraction of tumor tissues and normal structure total serum IgE：By the RNA extracts kits (RNeasy of Qiagen companies
Micro Kit, article No. 74004) specification extraction Tissues of Hepatocellular Carcinoma and cancer beside organism total serum IgE.
(2) to sample RNA progress Cy5 fluorescent markers, (Haikang is carried out into bioengineering Co., Ltd in commission
Service is marked in " ArrayStar Human cRNA-FUT8 Microarray V3.0 Service ")
(3) reverse transcription synthesizes the first chain cDNA：Using Total RNA as starting, the Oligo (dT) containing T7 promoter sequences
Primer (going up Haikang into bioengineering Co., Ltd) is primer, and (Haikang is gone up into the limited public affairs of bioengineering using CbcScript enzymes
Department) the first chain cDNA of synthesis.
(4) the second chain cDNA is synthesized：Archaeal dna polymerase (upper Haikang into bioengineering Co., Ltd) using RNA segments as primer,
The second chain cDNA is synthesized, and purifies double-strand cDNA.
(5) in-vitro transcription synthesis cRNA：Using cDNA as template, using T7 Enzyme Mix, (upper Haikang has into bioengineering
Limit company) synthesis cRNA.
(6) random primed reverse transcription：1ug cRNA are taken, reverse transcription is carried out with random primer.
(7) hybridization and cleaning：CDNA is dissolved in 45 in hybridization solution (25% formamide, 5 × SSC, 0.1%SDS, 0.5%BSA)
DEG C hybridized overnight is washed 5 minutes in the liquid of SSC (upper Haikang into bioengineering Co., Ltd), can be used to after slide drying
Scanning.
(8) chip scanning, graphical analysis, differential gene screening：Chip Agilent Microarray Scanner
(Agilent p/n G2565BA) is scanned, and is converted into digital signal.Initial data is input to 6eneSpring GX
In software, differential gene screening is carried out.
2nd, result
Fig. 1 is shown in circular rna chip cluster analysis on human hepatocellular carcinoma.Chip examination finds a plurality of up-regulated expression and table
Up to the circular rna of downward.Wherein cRNA-FUT8 is shown expresses significantly up-regulation in cancerous tissue, in view of it may be thin in people liver
There are specific expressed in the cancerous tissue of born of the same parents' cancer, the present invention is by following embodiment using extensive sample in batches into row index
Repeated authentication.
Embodiment 2：Differences of the qRT-PCR preliminary identifications cRNA-FUT8 in the cancerous tissue and cancer beside organism of hepatocellular carcinoma
Expression
First, experiment material
Selection 28 is to the cancerous tissue of (sample for being different from chip testing) human hepatocellular carcinoma (by upper marine mountain hospital liver tumour
Surgery provides) and pairing cancer beside organism, qRT-PCR verifications are carried out to the differential expression of cRNA-FUT8.
2nd, experimental method and result
1. primer specificity is identified
(1) design of specific primer:The relevant transcript sequences of cRNA-FUT8 are extracted from Ensemble databases, and
Primer is designed by the design of primers instrument (Primer BLAST) of NCBI with the sequence according to transcript；
Primer sequence after design is as follows：
Sense primer：SEQ ID No.2
Anti-sense primer：SEQ ID No.3
(2) by Human Hepatocellular Carcinoma Tissues and cancer beside organism according to needed for the TRIZOL reagents (article No. T9424) of SIGMA companies
Reagent and step extraction total serum IgE, then adjust quantitative instrument with 7300 real time PCR system and quantify (Applied
Biosystems AB) quantitative extracted RNA purity and concentration.
(3) Beijing Kang Run Cheng Ye bio tech ltd StarScript II One-step RT-PCR reagents are used
Box (article No. A215-01) synthesizes cDNA to the total serum IgE reverse transcription of extraction.
The first step opens RNA secondary structures, and reaction system and condition are as follows：
| Reagent | Dosage |
| Oligo dT | 1ul |
| RNA | 1-2ug |
| DEPC water | Polishing is to 20ul |
To 70 degree of reaction 5min and then ice bath 10min after the above components are mixed
Second step reverse transcription reaction, reaction system and condition are as follows：
| Reagent | Dosage |
| 2.5mM dNTP | 2.5ul |
| 5×RT buffer | 6ul |
| HPR (RNase inhibitor) | 0.6ul |
| MLV (reverse transcriptase) | 0.4ul |
By said components 42 degree of incubation 1h after mixing, then 10min are inactivated to get to cDNA for 70 degree.
(4) amplification of cRNA-FUT8：Using Beijing Kang Run Cheng Ye bio tech ltd 2 × RealStar Power
SYBR Mixture UNG fluorescence quantitative kits (article No. A312) carry out quantitative fluorescent PCR by template of the cDNA of reverse transcription
Amplification.
Quantitative fluorescent PCR system：
| Reagent | Dosage |
| 2×MIX | 10ul |
| 50×ROX | 2ul |
| Primer | Each 1ul |
| DNA profiling | 1ul |
| RNase Free ddH2O | Polishing is to 20ul |
Quantitative fluorescent PCR program：95 DEG C of 30s pre-degenerations connect 40 Xun Huans：95 DEG C of 30s, 60 DEG C of 30s.
(5) electrophoresis detection selects DM2000 DNA Marker (Beijing CoWin Bioscience Co., Ltd., article No.
CW0632).The results are shown in Figure 2：Amplified fragments size is identical with expection, and amplified production only has a band.The primer pair meets
Above-mentioned standard.The specific primer of upstream, sequence are shown in sequence table SEQ ID No.2, the specific primer in downstream, and sequence is shown in
Sequence table SEQ ID No.3.
2. the extraction of sample total serum IgE：
Using liquid nitrogen grinding method, extracted according to reagent needed for the TRIZOL reagents (article No. T9424) of SIGMA companies and step
The Total RNA of Tissues of Hepatocellular Carcinoma or tumour.Main operational steps are as follows：
(1) fresh tissue sample is put into rapidly in the mortar equipped with liquid nitrogen and is ground, and final grinding is into powdered；
(2) 1ml TRIZOL reagents are added in each mortar, continues grinding 3-5 minute, until into being homogenized shape；
(3) above-mentioned homogenate is transferred in the sterile no enzyme centrifuge tubes of 1.5ml, 0.2ml chloroforms is added in every 1 part of homogenate.It is mixed
12000g is centrifuged 10 minutes after even.RNA is present in upper strata aqueous phase；
(4) draw upper strata aqueous phase (about 200-300ul) to be transferred in the sterile no new pipes of enzyme of 1.5ml, 0.5ml isopropanols mix
Even, 12000g is centrifuged 10 minutes；
(5) supernatant is abandoned, RNA precipitate is washed once with 75% ethyl alcohol, is dissolved several times with water piping and druming of the 20ul without RNase
RNA is stored in -80 DEG C of low temperature refrigerators.
3. the preparation of standard DNA template
According to cRNA-FUT8 base sequences (its nucleotide sequence is as shown in sequence table SEQ ID No.1), the life of commission Shanghai
Work synthesizes.
Sample 2ul synthetic products, be connected to pUC-T TA cloning vectors (Beijing CoWin Bioscience Co., Ltd.,
Article No. CW0801), it is then transformed into DH5a competent cells.Pass through the spy that sequence is SEQ ID No.2 and SEQ ID No.3
Specific primer screening positive clone, extracts Plasmid DNA, and Plasmid DNA adjusts quantitative instrument with 7300 real time PCR system
It is quantitative, and do 10 times and be serially diluted as standard curve that (standard DNA template concentration range is 102-106Copy/ul).
4. sensitivity experiments
Standard DNA template plasmid is diluted to 10 in proportion2、103、104、105、106Copy/ul carries out fluorescent quantitation
PCR, detection sensitivity.Concentration limit is 102Copy/ul.
5. synthesize cDNA templates
It takes above-mentioned 28 pairs of Tissues of Hepatocellular Carcinoma and matches the total serum IgE of cancer beside organism, using the sincere industry biotechnologies of Beijing Kang Run
Co., Ltd's StarScript II One-step RT-PCR kits (article No. A215-01) close the total serum IgE reverse transcription of extraction
Into cDNA.
The first step opens RNA secondary structures, and reaction system and condition are as follows：
| Reagent | Dosage |
| Oligo dT | 1ul |
| RNA | 1-2ug |
| DEPC water | Polishing is to 20ul |
To 70 degree of reaction 5min and then ice bath 10min after the above components are mixed
Second step reverse transcription reaction, reaction system and condition are as follows：
| Reagent | Dosage |
| 2.5mM dNTP | 2.5ul |
| 5×RT buffer | 6ul |
| HPR (RNase inhibitor) | 0.6ul |
| MLV (reverse transcriptase) | 0.4ul |
By said components 42 degree of incubation 1h after mixing, then 10min are inactivated to get to cDNA for 70 degree.
6. fluorescence quantitative PCR detection cRNA-FUT8 expression quantity
It is glimmering using Beijing Kang Run Cheng Ye bio tech ltd 2X RealStar Power SYBR Mixture UNG
Light quantification kit (article No. A312) carries out fluorescent quantitative PCR by template of the cDNA of reverse transcription.
Quantitative fluorescent PCR system：
| Reagent | Dosage |
| 2×MIX | 10ul |
| 50×ROX | 2ul |
| Primer | Each 1ul |
| DNA profiling | 1ul |
| RNase Free d H2O | Polishing is to 20ul |
Quantitative fluorescent PCR program：95 DEG C of 30s pre-degenerations connect 40 Xun Huans：95 DEG C of 30s, 60 DEG C of 30s.
According to the relative quantification formula of qRT-PCR：2-△Ct, cRNA-FUT8 is calculated respectively in patients with hepatocellular carcinoma cancer group
The expression in (T) and cancer beside organism (N) is knitted, the results are shown in Figure 3：Expressions of the cRNA-FUT8 in cancer beside organism
It is concentrated mainly between 0.42-4.76, and the expression quantity of the cRNA-FUT8 in cancerous tissue is concentrated mainly between 1.28-12.7,
Apparently higher than normal structure.It these results suggest that, cRNA-FUT8 universal high expression in tumor tissues.This experimental result is shown：
CRNA-FUT8 is in 28 pairs of hepatocellular carcinomas and cancer beside organism, 23 up-regulations, positive rate=up-regulated expression number of cases/total detection
Number of cases × 100%=23/28=82.1%.CRNA-FUT8 can be as one new tumor markers of hepatocellular carcinoma or available
In the examination and diagnosis of hepatocellular carcinoma.
Embodiment 3：Examination is carried out to Tissues of Hepatocellular Carcinoma using the differential expression of cRNA-FUT8
First, experiment material
100 parts of Human Hepatocellular Carcinoma Tissues and 100 parts of cancer beside organisms's (being provided by Shanghai Ren Ji hospitals) are chosen, to cRNA-
The differential expression of FUT8 carries out qRT-PCR detections.
2nd, experimental method and result
1. primer specificity is identified
(1) following specific primer sequence is used：
Sense primer：SEQ ID No.2
Anti-sense primer：SEQ ID No.3
(2) by Human Hepatocellular Carcinoma Tissues and cancer beside organism according to needed for the TRIZOL reagents (article No. T9424) of SIGMA companies
Reagent and step extraction total serum IgE, then quantify (Applied with 7300 real time PCR system nucleic acid quantifications instrument
Biosystems AB) quantitative extracted RNA purity and concentration.
(3) Beijing Kang Run Cheng Ye bio tech ltd StarScript II One-step RT-PCR reagents are used
Box (article No. A215-01) synthesizes cDNA to the total serum IgE reverse transcription of extraction.
The first step opens RNA secondary structures, and reaction system and condition are as follows：
| Reagent | Dosage |
| Oligo dT | 1ul |
| RNA | 1-2ug |
| DEPC water | Polishing is to 20ul |
To 70 degree of reaction 5min and then ice bath 10min after the above components are mixed
Second step reverse transcription reaction, reaction system and condition are as follows：
| Reagent | Dosage |
| 2.5mM dNTP | 2.5ul |
| 5×RT buffer | 6ul |
| HPR (RNase inhibitor) | 0.6ul |
| MLV (reverse transcriptase) | 0.4ul |
By said components 42 degree of incubation 1h after mixing, then 10min are inactivated to get to cDNA for 70 degree.
(4) amplification of cRNA-FUT8：Using Beijing Kang Run Cheng Ye bio tech ltd 2 × RealStar Power
SYBR Mixture UNG fluorescence quantitative kits (article No. A312) carry out quantitative fluorescent PCR by template of the cDNA of reverse transcription
Amplification.
Quantitative fluorescent PCR system：
| Reagent | Dosage |
| 2×MIX | 10ul |
| 50×ROX | 2ul |
| Primer | Each 1ul |
| DNA profiling | 1ul |
| RNase Free ddH2O | Polishing is to 20ul |
Quantitative fluorescent PCR program：95 DEG C of 30s pre-degenerations connect 40 Xun Huans：95 DEG C of 30s, 60 DEG C of 30s.
2. the extraction of sample total serum IgE：
Using liquid nitrogen grinding method, carried according to reagent and step needed for the TRIZOL reagents (article No. T9424) of SIGMA companies
Take Tissues of Hepatocellular Carcinoma or the Total RNA of tumour.Main operational steps are as follows：
(1) fresh tissue sample is put into rapidly in the mortar equipped with liquid nitrogen and is ground, and final grinding is into powdered；
(2) 1ml TRIZOL reagents are added in each mortar, continues grinding 3-5 minute, until into being homogenized shape；
(3) above-mentioned homogenate is transferred in the sterile no enzyme centrifuge tubes of 1.5ml, 0.2ml chloroforms is added in every 1 part of homogenate.It is mixed
12000g is centrifuged 10 minutes after even.RNA is in upper strata aqueous phase；
(4) draw upper strata aqueous phase (about 200-300ul) to be transferred in the sterile no new pipes of enzyme of 1.5ml, 0.5ml isopropanols mix
Even, 12000g is centrifuged 10 minutes；
(5) supernatant is abandoned, RNA precipitate is washed once with 75% ethyl alcohol, is dissolved several times with water piping and druming of the 20ul without RNase
RNA is stored in -80 DEG C of low temperature refrigerators.
3. synthesize cDNA templates
Above-mentioned 100 Tissues of Hepatocellular Carcinoma and the total serum IgE of 100 cancer beside organisms are taken, using the sincere industry biology sections of Beijing Kang Run
Total serum IgE reverse transcription of the skill Co., Ltd StarScript II One-step RT-PCR kits (article No. A215-01) to extraction
Synthesize cDNA.
The first step opens RNA secondary structures, and reaction system and condition are as follows：
| Reagent | Dosage |
| Oligo dT | 1ul |
| RNA | 1-2ug |
| DEPC water | Polishing is to 20ul |
To 70 degree of reaction 5min and then ice bath 10min after the above components are mixed
Second step reverse transcription reaction, reaction system and condition are as follows：
| Reagent | Dosage |
| 2.5mM dNTP | 2.5ul |
| 5×RT buffer | 6ul |
| HPR (RNase inhibitor) | 0.6ul |
| MLV (reverse transcriptase) | 0.4ul |
By said components 42 degree of incubation 1h after mixing, then 10min are inactivated to get to cDNA for 70 degree.
4. fluorescence quantitative PCR detection cRNA-FUT8 expression quantity
It is glimmering using Beijing Kang Run Cheng Ye bio tech ltd 2X RealStar Power SYBR Mixture UNG
Light quantification kit (article No. A312) carries out fluorescent quantitative PCR by template of the cDNA of reverse transcription.
Quantitative fluorescent PCR system：
| Reagent | Dosage |
| 2×MIX | 10ul |
| 50×ROX | 2ul |
| Primer | Each 1ul |
| DNA profiling | 1ul |
| RNase Free d H2O | Polishing is to 20ul |
Quantitative fluorescent PCR program：95 DEG C of 30s pre-degenerations connect 40 Xun Huans：95 DEG C of 30s, 60 DEG C of 30s.
Testing result：
Clinical Sensitivity, which can be used to weigh certain testing inspection, to be gone out to have the ability of patient, and sensitivity is by actual ill people
Correctly it is determined as the ratio of true positives.
This experiment sensitivity=90/ (90+10) × %=90%.
Clinical specificity is the ability that balancing tests correctly judge no patient, and specificity is that actual disease-free people is correct
Ground is determined as the ratio of true negative.
This experiment specificity=85/ (15+85) × %=85%.
Significantly, since RNA is very unstable in extracellular environment, therefore, if it is present in tissue, by force
It is strong prompting this at there are tumours.Member of the circular rna as non-coding RNA family uniqueness, is not likely to become hepatocellular carcinoma singly
The tumor markers of examination and diagnosis, and be expected to become hepatocellular carcinoma therapy target, there is important scientific meaning, physiology to anticipate
Justice and clinical meaning.
SEQ ID No.1
CRNA-FUT8 sequences：
TTCCTACCCATGAGCATGGAATGTTCTTCCATTTGTTTGTATCCTCTTTTATTTCATTGAGCAGTGGTT
TGTAGTTCTCCTTGAAGAGGTTCTTCATGTCCCTTGTAAGTTGGATTCCTAGGTATTTTATTCTCTTTGAAGCAATT
GTGAATGGGAGTTCACTCATGATTTGGCTCTCTGTTTGTCTGTTATTGGTGTATAAGAATGCTTGTGATTTTTGTAC
ATTGATTTTGTATCCTGAGACTTTGCTAAAGTTGCTTATCAGCTTAAGGAGATTTTGGGCTGAGACAATGGGGTTTT
CTAGATATACAATCATGTCATCTGCAAACAGGGACAATTTGACTTCCTCTTTTCCTAAGTGAATACCCTTTATTTCC
TTCTCCTGCCTAATTGCCCTGGCCAGAACTTCCAACACTATGTTGAATAGGAGT
SEQ ID No.2
Sense primer：5’-ATGGAATGTTCTTCCATTTG-3’
SEQ ID No.3
Anti-sense primer：5’-CCAGAACTTCCAACACTATG-3’ .
Claims (9)
1. a kind of circular rna, entitled cRNA-FUT8, corresponding cDNA sequence such as SEQ ID No.1 or its complementary series institute
Show.
2. circular rna according to claim 1 is expressed in Tissues of Hepatocellular Carcinoma compared with Carcinoma side normal tissue is high.
3. circular rna described in claim 1 is used to prepare the diagnosticum of diagnosing hepatocellular carcinoma or the purposes of kit.
4. can test right requirement 1 described in circular rna expression reagent prepare the diagnosticum of diagnosing hepatocellular carcinoma or
Purposes in kit.
5. a kind of kit for diagnosing hepatocellular carcinoma, including：
1) it is used to expand the specific primer pair of circular rna described in claim 1；
2) standard DNA template；With
3) PCR reaction solution.
6. kit according to claim 5, wherein the specific primer is to including sense primer and anti-sense primer,
Middle and upper reaches primer sequence is SEQ ID No.2, and downstream primer sequence is SEQ ID No.3.
7. kit according to claim 5, wherein the kit is fluorescent quantificationally PCR detecting kit, it is described to draw
Object is suitable for the detection of SYBR Green, TaqMan probe, molecular beacon, double cross probe and/or combined probe.
8. kit according to claim 5, wherein the PCR reaction solution in the kit is reacted for quantitative fluorescent PCR
Liquid, and further include fluorescent dye.
9. kit according to claim 8, wherein the fluorescence quantitative PCR reaction solution includes dNTP, Mg2+, Taq enzyme and
Buffer solution, the fluorescent dye is SYBR Green II and/or Taq enzyme is thermal starting enzyme.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610251595.7A CN105802964B (en) | 2016-04-21 | 2016-04-21 | The detection and its application of a kind of cRNA-FUT8 for hepatocellular carcinoma examination |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610251595.7A CN105802964B (en) | 2016-04-21 | 2016-04-21 | The detection and its application of a kind of cRNA-FUT8 for hepatocellular carcinoma examination |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105802964A CN105802964A (en) | 2016-07-27 |
| CN105802964B true CN105802964B (en) | 2018-05-22 |
Family
ID=56457417
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610251595.7A Expired - Fee Related CN105802964B (en) | 2016-04-21 | 2016-04-21 | The detection and its application of a kind of cRNA-FUT8 for hepatocellular carcinoma examination |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105802964B (en) |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106222170B (en) * | 2016-08-05 | 2019-05-07 | 广州永诺生物科技有限公司 | Circular rna circ-CCNY and application thereof |
| CN107022625B (en) * | 2017-05-09 | 2020-06-19 | 中南大学 | Long-chain non-coding RNA related to occurrence and development of human hepatocellular carcinoma, amplification detection method and application |
| CN109234394A (en) * | 2018-09-30 | 2019-01-18 | 深圳市南山区人民医院 | A kind of diagnosing cancer of liver marker and its screening technique |
| CN111733243A (en) * | 2020-06-29 | 2020-10-02 | 中山大学孙逸仙纪念医院 | Method for improving accuracy of CircRNA detection |
| CN113943798B (en) * | 2020-07-16 | 2023-10-27 | 中国农业大学 | Application of circRNA as hepatocellular carcinoma diagnosis marker and therapeutic target |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104357443A (en) * | 2014-11-25 | 2015-02-18 | 中国科学院生物物理研究所 | Detection method and application of long-chain non-coded RNA for screening bladder cancer |
-
2016
- 2016-04-21 CN CN201610251595.7A patent/CN105802964B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104357443A (en) * | 2014-11-25 | 2015-02-18 | 中国科学院生物物理研究所 | Detection method and application of long-chain non-coded RNA for screening bladder cancer |
Non-Patent Citations (3)
| Title |
|---|
| Long Non-coding RNAs are Differentially Expressed in Hepatocellular Carcinoma Cell Lines with Differing Metastatic Potential;Ting Ting Fang等;《Asian Pacific Journal of Cancer Prevention》;20141231;第15卷(第23期);第10513-10524页 * |
| 环状RNA与肿瘤的研究进展;闫宁宁等;《世界华人消化杂志》;20151218;第5670-5676页 * |
| 血浆LncRNA-HEIH表达水平与肝癌发病风险的关联分析;杨哲锋等;《现代肿瘤医学》;20150128;第23卷(第1期);第80-84页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105802964A (en) | 2016-07-27 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105802964B (en) | The detection and its application of a kind of cRNA-FUT8 for hepatocellular carcinoma examination | |
| CN104357443B (en) | A kind of detection of the long-chain non-coding RNA for bladder cancer examination and its application | |
| Chen et al. | Prostate cancer in Asia: a collaborative report | |
| CN103952474B (en) | A kind of esophagus cancer diagnosis marker and its application method | |
| CN103952476B (en) | A kind of detection and application of long-chain non-coding RNA | |
| CN103923983B (en) | Detection and application of long-chain non-coding RNA of remarkable up regulation in esophageal squamous carcinoma | |
| CN107674916B (en) | Application of circular RNA in colorectal cancer biomarker | |
| CN109666744B (en) | CircRNA and its preparing the application in diagnosis of cervical cancer reagent | |
| CN106148498A (en) | KRAS gene mutation detection kit and application thereof | |
| CN109055563A (en) | The related cyclic annular rna gene of colorectal cancer, colorectal cancer molecular marker and its application | |
| CN106011139A (en) | Method for detecting circular RNA for bladder cancer screening and application thereof | |
| CN108103198A (en) | A kind of and the relevant blood plasma miRNA marker of cancer of pancreas auxiliary diagnosis and its application | |
| CN108950003B (en) | miRNA marker for diagnosing breast cancer and application of miRNA thereof | |
| CN106148497A (en) | BRAF gene mutation detection kit and application thereof | |
| CN110241214A (en) | Application of the LOC100505874 in the early diagnosis of larynx squamous carcinoma | |
| CN109371022A (en) | A kind of circular rna hsa_circKPNA2_002 and its specificity amplification primer and application | |
| CN109735622A (en) | LncRNA relevant to colorectal cancer and its application | |
| CN109022583A (en) | Hsa_circ_0021977 is preparing the application on Diagnosis of Breast cancer product | |
| CN109182528B (en) | Glioblastoma multiforme auxiliary diagnosis and prognosis evaluation kit based on ITGB5 gene and use method thereof | |
| CN103627705A (en) | PiRNA biomarker related to bladder cancer and application thereof | |
| CN106148494A (en) | The application in colorectal cancer biomarker of a kind of circular rna | |
| CN112226507B (en) | Papillary thyroid carcinoma serum marker and application | |
| CN101423873A (en) | Kit for detecting human prostate cancer specific gene DD3<PCA3> by loop-mediated isothermal amplification | |
| WO2021159562A1 (en) | Circulating mirna and carcino-embryonic mirna marker related to pan-tumor auxiliary diagnosis, and use thereof | |
| CN107604068A (en) | A kind of kit that carcinoma of urinary bladder is detected using long-chain non-coding RNA |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20180522 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |