CN105802923B - A kind of recombining spinal cord grey matter disease virus sample particle and the preparation method and application thereof - Google Patents

A kind of recombining spinal cord grey matter disease virus sample particle and the preparation method and application thereof Download PDF

Info

Publication number
CN105802923B
CN105802923B CN201610232296.9A CN201610232296A CN105802923B CN 105802923 B CN105802923 B CN 105802923B CN 201610232296 A CN201610232296 A CN 201610232296A CN 105802923 B CN105802923 B CN 105802923B
Authority
CN
China
Prior art keywords
gene
virus
poliovirus
sample particle
dual
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201610232296.9A
Other languages
Chinese (zh)
Other versions
CN105802923A (en
Inventor
饶子和
孙瑶
王祥喜
杨盼
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Institute of Biophysics of CAS
Original Assignee
Institute of Biophysics of CAS
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Institute of Biophysics of CAS filed Critical Institute of Biophysics of CAS
Priority to CN201610232296.9A priority Critical patent/CN105802923B/en
Publication of CN105802923A publication Critical patent/CN105802923A/en
Application granted granted Critical
Publication of CN105802923B publication Critical patent/CN105802923B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N7/00—Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/12—Viral antigens
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86—Viral vectors
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/525—Virus
    • A61K2039/5258—Virus-like particles
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/545—Medicinal preparations containing antigens or antibodies characterised by the dose, timing or administration schedule
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/14011—Baculoviridae
    • C12N2710/14041—Use of virus, viral particle or viral elements as a vector
    • C12N2710/14043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vectore
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011—Details
    • C12N2770/32011—Picornaviridae
    • C12N2770/32023—Virus like particles [VLP]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011—Details
    • C12N2770/32011—Picornaviridae
    • C12N2770/32034—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Abstract

The invention belongs to field of biotechnology, and in particular to a kind of I type of recombinant poliovirus, II type and III virus-like particle, and further disclose preparation method and its in the application for preparing pharmaceutical vaccine field.The method of preparation and reorganization poliovirus sample particle of the present invention, I type of polio, II type and III virus-like particle are successfully prepared in insect expression system, and I type of the polio, II type and III virus-like particle can be effectively used for preparing the polio vaccine based on virus-like particle.

Description

A kind of recombining spinal cord grey matter disease virus sample particle and the preparation method and application thereof
Technical field
The invention belongs to field of biotechnology, and in particular to a kind of I type of recombinant poliovirus, II type and III type virus-like Particle, and further disclose preparation method and its in the application for preparing pharmaceutical vaccine field.
Background technique
Polio (Poliomyelitis) is one kind caused by poliovirus (Poliovirus, PV) Acute infectious disease can seriously endanger the health of children.Poliovirus invades the nervous system of people, can be in a few hours Inside body is caused to paralyse completely；Poliovirus can also be entered in vivo by oral cavity and be bred in enteron aisle, caused Initial symptoms can behave as that fever, out of strength, headache, vomiting, neck is stiff and limbs pain.It is nearly all in not immune crowd May be infected polio per capita has a few peoples to will appear paralysis symptom in the infected, since the symptom is apt to occur in infant, Therefore it is commonly called as infantile paralysis again.Every 200 cases of infection just have an example to lead to irreversible paralysis (paralysis of usually two legs), In paralysis case, there are about the patients of 5-10% can death due to paralysis of respiratory muscle.
Poliovirus belongs to the enterovirus genus of picornavirus (Picornaviridae) (Enterovirus).Poliovirus structure is positive icosahedral structure of virus, and diameter is about 27-30nm, no capsule structure. The genome of poliovirus is single-stranded positive RNA, by 5 ' noncoding regions, the area P1, the area P2, the area P3 and 3 ' non-coding district's groups At.Wherein, the structural proteins P1 precursor of P1 coding virus can be cut into VP0, VP1 and VP3 by the protease precursor 3CD of virus Structural proteins.These three albumen and viral RNA form virion, and VP0 is further cracked into VP2 and VP4 in assembling, complete The assembling of mature virion.
Poliovirus is divided into I type, II type and III type according to serotype.Wherein I type polio is in 3 types Most neural invasion in type, most polio are popular and endemic conditions case is caused by I type polio , it is secondly respectively III type and II type, and Cross immunogenicity effect is had no between three kinds of serotypes.
Currently, what is mainly taken is based on vaccine inoculation clinically for the treatment of polio there is no specific drug Precautionary measures.What is generally used both at home and abroad at present has inactivated vaccine (Inactivated for the vaccine that guards against poliomyelities Poliovirus vaccine, IPV) and oral attenuated vaccine (Oral poliovirus vaccine, OPV).Wherein IPV is The mixture being made of 3 seed type polioviruses by cell culture, harvest supernatant, purifying and formalin-inactivated etc. and The vaccine of preparation.It is good that IPV vaccine compares OPV immunological safety, but apparent enteron aisle local immunity cannot be formed by being inoculated with IPV, And cost is significantly higher than OPV.Since IPV needs mass propgation live virus, in laboratory and preparatory phase, there is also let out The danger of dew.Primary rhesus macaque also malicious (SV40) containing monkey disease in IPV simultaneously, in vaccine early stage production and use process Nephrocyte studies have shown that SV40 can be such that the cell of culture converts, and can lead to animal and generate tumour.And OPV is to use ridge Marrow poliovirus attenuated strain manufactured white solid sugar-pill for guarding against poliomyelities after being cultivated, harvesting virus liquid, Its advantage is that cheap, but its there are gene reversion and it is pathogenic the problems such as.The widely used vaccine in China is at present OPV vaccine, clinic display, main adverse reaction relevant to OPV is Vaccine-associated paralytic poliomyelitis (VAPP).Nian Ping The disease incidence of equal VAPP is that every 1,000,000 population occurs 0.14, and the risk highest of VAPP occurs in immune deficiency crowd.
1988, the World Health Organization the whole world start " Poliomyelitis Eradication " action, by implement disease surveillance, The strategies such as immunity inoculation, China are the circulation blocking for realizing Polio vaccine virus from nineteen ninety-five.It 2000, is defended through the world Raw tissue confirmation, the West Pacific region including China has realized no ridge ash target substantially；To 2010, the whole world was only The country for having 4 native country ridges ashes popular, wherein 3 and China border on, i.e. India, Pakistan and Afghanistan, to China's sufferer Prevention and treatment also constitute certain hidden danger.Until today, the target of global Poliomyelitis Eradication still do not reach, only exist 2005-2009, Nigeria there have been Acute Flaccid Paralysis caused by 3660 Infected With Polioviruses In Vitros, I type polio street strain Introduced cases epidemic situation also had occurred in autonomous region, Xinjiang of China Uygur in 2011.As it can be seen that China pair The prevention and treatment of polio is not allowed still to loosen.
With the fast development of modern biotechnology, recombinant vaccine becomes new virus preventative vaccine in recent years Main development trend.Wherein, the recombinant vaccine based on virus-like particle (Virus-like particles, VLPs) is standby It is concerned.Virus-like particle is the hollow bead without viral nucleic acid that is formed by viral capsid proteins self assembly, have with The same or similar steric configuration of natural viral capsid protein and epitope have very strong immunogenicity, can effective stimulus Body generates humoral immunity and cellullar immunologic response.And since virus-like particle is free of virulent genome, do not have Standby replication capacity, safety is better than traditional attenuated live vaccine and inactivated vaccine, so the appearance of virus sample particle vaccines A new opportunity is provided to research and develop safer effective vaccine.
Summary of the invention
For this purpose, technical problem to be solved by the present invention lies in provide a kind of I type of recombinant poliovirus, II type and III type Virus-like particle, and further disclose preparation method and its in the application for preparing pharmaceutical vaccine field.
In order to solve the above technical problems, the preparation method of recombining spinal cord grey matter disease virus sample particle of the present invention, packet Include following steps:
(1) the P1 gene and 3CD gene for taking poliovirus are cloned into coexpression vector respectively, then by turning Change the recombinant viral vector that competent cell obtains to express poliovirus sample particle；
(2) the recombinant viral vector transfection insect cell obtained with step (1) is obtained after culture containing coding virus-like The recombinant virus of corpuscular protein gene；
(3) recombinant virus infection to the host cell that step (2) obtain is expanded to improve virus titer, with being followed by The recombinant virus of kind high titre infects insect cell, to express above-mentioned P1 gene and 3CD gene, and obtains according to conventional purification method Obtain poliovirus sample particle.
Preferably, in the step (1), the P1 gene and the 3CD gene are the Preference according to host cell Carry out the gene of codon optimization.
The codon optimization, which refers to, is not changing wild poliovirus P1 albumen and 3CD Argine Monohydrochloride sequence Under the premise of column, the codon of wild poliovirus P1 gene and 3CD gene is replaced with into insect cell preference Codon.
In the step (1): the poliovirus includes I type, II type or III type virus, the polio Virus I-form, II type, the P1 gene of III type virus and 3CD gene are belonging respectively to the Mahoney of wild poliovirus Strain, MEF-1 plants and Saukett plants.
More specifically, the poliovirus is I type virus, and the P1 gene of optimization has such as SEQ ID NO:1 Shown in nucleotide sequence, optimization 3CD gene have the nucleotide sequence as shown in SEQ ID NO:2；
The poliovirus is II type virus, and the P1 gene of optimization has the core as shown in SEQ ID NO:3 The 3CD gene of nucleotide sequence, optimization has the nucleotide sequence as shown in SEQ ID NO:4；
The poliovirus is III type virus, and the P1 gene of optimization has the core as shown in SEQ ID NO:5 The 3CD gene of nucleotide sequence, optimization has the nucleotide sequence as shown in SEQ ID NO:6.
In the step (1), the coexpression vector is to be inserted respectively into the P1 gene and the 3CD gene pFastBacTMRespectively by a promoter driving transcription at two multiple cloning sites of Dual carrier or Dual-CMV transformation carrier Obtained recombinant plasmid；
The Dual-CMV transformation carrier is in pFastBacTMP10 promoter engineering is opened for CMV on the basis of Dual carrier The transformation carrier that mover obtains.
In the step (1), the P1 gene and the 3CD gene are respectively started by one in the recombinant expression carrier Son driving transcription drives the promoter direction of the P1 gene contrary with the promoter of the 3CD gene is driven.
In the step (1), the competent cell is DH10Bac competent cell, the recombinant virus obtained Carrier is recombinant baculovirus carrier.
In the step (2), the purpose insect cell is selected from Spodopterafrugiperda ovary cell line sf9, sf21 and powder Autographa spp embryo cell line High Five.
The invention also discloses recombining spinal cord grey matter disease virus sample particles prepared by the above method.Further, The recombining spinal cord grey matter disease virus sample particle is I type of poliovirus, II type or III virus-like particle.
The invention also discloses the neutralizing antibody test results of the recombining spinal cord grey matter disease virus sample particle.As a result table Bright poliovirus sample particle prepared by the present invention has preferable immunogenicity, grinds to the pharmaceutical vaccine of polio Hair has broad application prospects.
The method of preparation and reorganization poliovirus sample particle of the present invention, successfully makes in insect expression system For I type of polio, II type and III virus-like particle, shown in the immune neutrality test result of animal level, it is pure Changing the poliovirus sample particle obtained has higher immunogenicity, and since it does not contain viral nucleic acid, safety It can be better than traditional attenuation and inactivated vaccine, therefore I type of the polio, II type and III virus-like particle can be applied effectively In polio vaccine of the preparation based on virus-like particle.
Detailed description of the invention
In order to make the content of the present invention more clearly understood, it below according to specific embodiments of the present invention and combines Attached drawing, the present invention is described in further detail, wherein
Fig. 1 is I-P1-Dual, II-P1-Dual and III-P1-Dual plasmid and digestion qualification result；
Fig. 2 is I-P13CD-Dual, II-P13CD-Dual and III-P13CD-Dual plasmid and digestion qualification result；
Fig. 3 is Dual-CMV plasmid and digestion qualification result；
Fig. 4 is I-P1-CMV, II-P1-CMV and III-P1-CMV plasmid and digestion qualification result；
Fig. 5 is I-P13CD-CMV, II-P13CD-CMV and III-P13CD-CMV plasmid and digestion qualification result；
Fig. 6 is recombination Poliovirus I sample particle 120KV negative staining electron microscope；
Fig. 7 is II virus-like particle 120KV negative staining electron microscope of recombinant poliovirus；
Fig. 8 is III virus-like particle 120KV negative staining electron microscope of recombinant poliovirus.
Specific embodiment
The selection of 1 expressing gene of embodiment and the optimization design of codon
Saukett plants of Mahoney plants of I type of polio, MEF-1 plants of II type and III type, each virus are chosen respectively The P1 albumen of strain and the DNA sequence dna of 3CD albumen referring to GenBank, be respectively as follows: NC_002058.3, AY238473.1 and L23845.1。
It is transformed by Jin Sirui company using wild-type DNA-sequence of the software to above-mentioned coding P1 albumen and 3CD albumen, Codon avoids the transcription factor that may influence gene expression using the higher codon of frequency of use in insect cell Combined area, repetitive sequence and RNA higher structure.
P1 protein expression after the optimization of 5 ' end of design and 3 ' ends respectively containing III restriction enzyme site of I restriction enzyme site of EcoR and Hind Sequence simultaneously carries out gene chemical synthesis, obtains the gene order such as SEQ ID NO of coding I Mahoney plants of P1 albumen of type of polio: Shown in 1；The gene order of coding II MEF-1 plants of P1 albumen of type of polio is obtained as shown in SEQ ID NO:3；It is encoded The gene order of III Saukett plants of P1 albumen of type of polio is as shown in SEQ ID NO:5.
3CD protein expression sequence after the optimization of 5 ' end of design and 3 ' ends respectively containing I restriction enzyme site of I restriction enzyme site of Nco and Kpn Gene chemical synthesis is arranged and carried out, the gene order such as SEQ ID NO:2 of coding I Mahoney plants of 3CD albumen of type of polio is obtained It is shown；The gene order of coding II MEF-1 plants of 3CD albumen of type of polio is obtained as shown in SEQ ID NO:4；It is encoded The gene order of III Saukett plants of 3CD albumen of type of polio is as shown in SEQ ID NO:6.
The building of embodiment 2 poliovirus P1 gene and 3CD gene co-expressing carrier
(1)pFastBacTMThe building of Dual coexpression P1 gene and 3CD gene
It is handled respectively using I enzyme of EcoR and III enzyme of Hind (being purchased from NEB) double digestion above-mentioned such as sequence SEQ ID NO:1, SEQ The P1 protein gene and pFastBac of sequential structure shown in ID NO:3 and SEQ ID NO:5TMDual vector plasmid, in 37 DEG C of water After bath reaction 4 hours, segment recycling is carried out using the quick plastic recovery kit of miniprep dna segment (being purchased from vast Tyke).By enzyme After cutting three kinds of P1 nucleotide fragments respectively with pFastBac after digestionTMDual carrier is mixed according to the ratio of molar ratio 9:1, is added 2 × Solution I ligase (is purchased from Dalian treasured bioengineering Co., Ltd), and reaction system is 10 μ L, connects in 16 DEG C of water-baths Overnight.It takes 10 μ L connection products to convert bacillus coli DH 5 alpha competent cell, and is coated on the LB solid fine jade containing ammonia benzyl resistance Rouge plate, in 37 DEG C incubator culture 16 hours.It picks from the plate single colonie and is inoculated into the liquid LB training containing 5mL ammonia benzyl resistance It supports in base, the overnight incubation in the shaking table that 37 DEG C of revolving speeds are 200rpm.It (is purchased from vast using small amount plasmid rapidly extracting kit Tyke) recombinant plasmid is extracted, obtain I-P1-Dual, II-P1-Dual and III-P1-Dual (plasmid race glue the result is shown in Figure 1, difference Corresponding swimming lane 1,4,6).Double digestion identification is carried out using I enzyme of EcoR and III enzyme of Hind respectively, result respectively corresponds figure after digestion Swimming lane 2,5,7, are consistent with expected results in 1.Sequencing company is sent to be sequenced above-mentioned recombinant plasmid, sequencing result is further demonstrate,proved Real construction of recombinant plasmid success.
It is handled respectively using I enzyme of Nco and I enzyme of Kpn (being purchased from NEB) double digestion above-mentioned such as sequence SEQ ID NO:2, SEQ The 3CD protein gene of sequential structure shown in ID NO:4 and SEQ ID NO:6 and I-P1-Dual, the II-P1-Dual of above-mentioned acquisition With III-P1-Dual plasmid, in 37 DEG C after water-bath 4 hours, the quick plastic recovery kit of miniprep dna segment is used to carry out piece Duan Huishou.By three kinds of 3CD nucleotide fragments after digestion respectively with I-P1-Dual, II-P1-Dual and III-P1-Dual after digestion Carrier is mixed according to the ratio of molar ratio 9:1,2 × Solution I ligase is added, reaction system is 10 μ L, in 16 DEG C of water-baths Connection is overnight.10 μ L connection products are taken to convert bacillus coli DH 5 alpha competent cell, and it is solid to be coated on the LB containing ammonia benzyl resistance Body agar plate, in 37 DEG C incubator culture 16 hours.It picks from the plate single colonie and is inoculated into the liquid containing 5mL ammonia benzyl resistance In LB culture medium, the overnight incubation in the shaking table that 37 DEG C of revolving speeds are 200rpm.It is extracted using small amount plasmid rapidly extracting kit Recombinant plasmid, obtaining I-P13CD-Dual, II-P13CD-Dual and III-P13CD-Dual, (plasmid runs cementing fruit and sees Fig. 2, respectively Corresponding swimming lane 1,4,6).Double digestion identification is carried out using I enzyme of Nco and I enzyme of Kpn respectively, result, which respectively corresponds in Fig. 2, after digestion swims Road 2,5,7, is consistent with expected results.Sequencing company is sent to be sequenced above-mentioned recombinant plasmid, sequencing result further confirms altogether Expression vector establishment success.
(2) it is based on pFastBacTMThe transformation of Dual coexpression vector and the building of coexpression vector
In order to further increase the expression yield of poliovirus sample particle, we are by pFastBacTMDual carrier P10 promoter replace for CMV promoter.Using the primer of the sequence as shown in SEQ ID NO:7 and SEQ ID NO:8, with PcDNA3.0 plasmid is template, obtains CMV promoter Insert Fragment (sequential structure such as SEQ ID NO:9 institute by PCR amplification Show).Above-mentioned amplification is handled respectively and is obtained using SmaI enzyme and Sna I enzyme (being purchased from Dalian treasured bioengineering Co., Ltd) double digestion CMV promoter Insert Fragment and pFastBacTMDual, it is quick using miniprep dna segment in 37 DEG C after water-bath 4 hours Plastic recovery kit carries out segment recycling.By the CMV promoter nucleotide fragments after digestion and pFastBac after digestionTMDual is carried Body is mixed according to the ratio of molar ratio 9:1, and 2 × Solution I ligase is added, and reaction system is 10 μ L, is connected in 16 DEG C of water-baths Take over night.It takes 10 μ L connection products to convert bacillus coli DH 5 alpha competent cell, and is coated on the LB solid containing ammonia benzyl resistance Agar plate, in 37 DEG C incubator culture 16 hours.It picks from the plate single colonie and is inoculated into the liquid LB containing 5mL ammonia benzyl resistance In culture medium, the overnight incubation in the shaking table that 37 DEG C of revolving speeds are 200rpm.Weight is extracted using small amount plasmid rapidly extracting kit Group plasmid obtains Dual-CMV transformation carrier (plasmid runs cementing fruit and sees Fig. 3, corresponding swimming lane 1).SmaI enzyme and Sna are used respectively I enzyme carries out double digestion identification, and 3 swimming lane 3 of result corresponding diagram, is consistent with expected results after digestion.Send above-mentioned recombinant plasmid to sequencing Company is sequenced, and sequencing result further confirms CMV promoter transformation vector construction success.
Above-mentioned Dual-CMV is handled using EcoR I enzyme and Hind III enzyme double digestion, carrier is transformed, in 37 DEG C of water-baths After 4 hours, segment recycling is carried out using the quick plastic recovery kit of miniprep dna segment.By three kinds of P1 nucleosides after digestion in (1) Acid fragment is mixed with the Dual-CMV transformation carrier after above-mentioned digestion according to the ratio of molar ratio 9:1 respectively, and addition 2 × Solution I ligase, reaction system are 10 μ L, overnight in 16 DEG C of water-bath connections.10 μ L connection products are taken to convert Escherichia coli DH5 α competent cell, and be coated on the LB solid agar plate containing ammonia benzyl resistance, in 37 DEG C incubator culture 16 hours.From flat Picking single colonie is inoculated into the LB liquid medium containing 5mL ammonia benzyl resistance on plate, in the shaking table that 37 DEG C of revolving speeds are 200rpm Middle overnight incubation.Recombinant plasmid is extracted using small amount plasmid rapidly extracting kit, obtains I-P1-CMV, II-P1-CMV and III- P1-CMV (plasmid runs cementing fruit and sees Fig. 4, respectively correspond swimming lane 1,3,6).It is carried out respectively using EcoR I enzyme and Hind III enzyme Double digestion identification, result respectively corresponds Fig. 4 swimming lane 2,4,7 after digestion, is consistent with expected results.Send above-mentioned recombinant plasmid to sequencing Company is sequenced, and sequencing result further confirms construction of recombinant plasmid success.
Using three kinds of 3CD protein gene described in (1) as template, NheI is introduced at segment both ends by PCR amplification respectively The restriction enzyme site of enzyme and KpnI enzyme.Wherein,
PCR upstream primer is 5 '-CTAGCTAGCATGGGACCAGGTTTCGACTA -3 '；
PCR downstream primer is respectively as follows:
5'–CGGGGTACCTTAGAAAGAGTCCAACCAAC–3'(I-3CD)；
5'–CGGGGTACCTTAGAAGGAGTCCAACCAAC–3'(II-3CD)；
5’–CGGGGTACCTTAGAAACTGTCCAACCATC–3’(III-3CD)。
Using NheI enzyme and KpnI enzyme double digestion handle respectively 3CD protein gene that above-mentioned amplification obtains and I-P1-CMV, II-P1-CMV and III-P1-CMV plasmid after water-bath 4 hours, use the quick glue reclaim reagent of miniprep dna segment in 37 DEG C Box carries out segment recycling.By three kinds of 3CD nucleotide fragments after digestion respectively with I-P1-CMV, II-P1-CMV and III-after digestion P1-CMV carrier is mixed according to the ratio of molar ratio 9:1,2 × Solution I ligase is added, reaction system is 10 μ L, in 16 DEG C water-bath connection is overnight.It takes 10 μ L connection products to convert bacillus coli DH 5 alpha competent cell, and is coated on containing ammonia benzyl resistance LB solid agar plate, in 37 DEG C incubator culture 16 hours.Single colonie is picked from the plate to be inoculated into containing 5mL ammonia benzyl resistance LB liquid medium in, in 37 DEG C of revolving speeds be 200rpm shaking table in overnight incubation.Use small amount plasmid rapidly extracting reagent Box extracts recombinant plasmid, obtain I-P13CD-CMV, II-P13CD-CMV and III-P13CD-CMV (plasmid runs cementing fruit and sees Fig. 5, Respectively correspond swimming lane 1,3,6).Double digestion identification is carried out using NheI enzyme and KpnI enzyme respectively, result respectively corresponds Fig. 5 after digestion Swimming lane 2,4,7, is consistent with expected results.Sequencing company is sent to be sequenced above-mentioned recombinant plasmid, sequencing result further confirms Improved coexpression vector constructs successfully.
The expression of 3 recombinant poliovirus baculoviral of embodiment and purification process
By the I-P13CD- of carrier of expression poliovirus sample granule protein described in previous embodiment 1 and 2 Dual/CMV, II-P13CD-Dual/CMV and III-P13CD-Dual/CMV are respectively according to the Bac-to-Bac table of Invitrogen Up to system specification, conversion passes through blue hickie after 37 DEG C of incubator culture 48h to competent escherichia coli cell DH10Bac Screening obtains recombination bacillary viral vector.
The recombination bacillary viral vector that previous step is obtained is transfected using the Cellfectin transfection reagent of Invitrogen Sf9 insect cell obtains corresponding first generation recombinant baculovirus, i.e. recombinant poliovirus baculoviral, is respectively designated as I- V1-Dual/CMV, II-V1-Dual/CMV and III-V1-Dual/CMV.Continue to carry out amplification cultivation to above-mentioned generation poison, until obtaining Obtain I-V3-Dual/CMV of three generations's virus, II-V3-Dual/CMV and the III-V3-Dual/CMV of high virus titer.
The expression of 4 poliovirus sample particle of embodiment and purification process
By I-V3-Dual/CMV of recombinant poliovirus baculoviral, II-V3-Dual/CMV made from embodiment 3 and III-V3-Dual/CMV connects poison amount infection sf9 suspension cell respectively with 10MOI, with the ESF921 of Expression Systems Insect cell medium is suspension medium, harvests viral supernatants after being to cultivate 3-4 days in 100rpm shaking table in 27 DEG C of revolving speeds.
The culture supernatant being harvested by centrifugation is concentrated 10 times using 100kD film packet after 0.22 μm of filter membrane filters removal impurity Concentrate derived above.20% (W/V) sucrose solution of 8mL is added in ultracentrifugation bottom of the tube, concentrate is added in sucrose upper layer. Supernatant is outwelled after ultracentrifugation 3h, ultracentrifugation precipitation is resuspended with PBST (1 ‰ Tween-20) solution and obtains re-suspension liquid.It will Re-suspension liquid carries out high speed centrifugation and supernatant is taken to carry out 15%-45% (W/V) sucrose density gradient centrifugation, by ultracentrifugation 5h, from It is successively taken out under saccharose gradient component (the 600 every pipe of μ L), virus-like particle is rich and in 8-10 component.It collects corresponding Component carries out concentration desugar processing with 100kD concentration tube to get the poliovirus sample granule protein sample of purifying. pFastBacTMDual and the expression of improved Dual-CMV carrier are consistent with the method for purified virus sample particle, and by starting The yield of the virus-like particle of the improved Dual-CMV carrier expression of son is under equal conditions more modified than not pFastBacTMDual improves four times or more.
The Electronic Speculum inspection of 5 poliovirus sample particle VLPs of embodiment
5 μ L are taken to be added in I type of polio, II type and III virus-like particle that purify in embodiment 4 respectively 1min is adsorbed in plating carbon support film (being purchased from middle mirror tech) uses ddH after filter paper blots plating carbon support film surface residual liquid2O is clear It washes plating carbon and supports film surface twice, blot ddH2O adds 5 μ L, 2% phosphotungstic acid (being purchased from middle mirror tech) to dye 40s, blots plating carbon It supports film surface raffinate, uses its morphosis of 120KV transmission electron microscope observation after being placed at room temperature for drying, as a result see respectively attached Shown in Fig. 6-8.Negative staining electron microscope is the result shows that I type of polio (Fig. 6), II type (Fig. 7) and III type (Fig. 8) virus-like particle are pure Change the presence of sample virus-like particle of visible diameter about 30nm or so under Electronic Speculum.Result of this example indicate that carrying The recombinant expression carrier of polio P1 gene and 3CD gene after codon optimization is in insect baculovirus expression system In, it can successfully pack out the virus-like particle of I type of polio, II type and III type.
The measurement of 6 poliovirus sample particle immunogenicity of embodiment
The poliovirus sample particle prepared in dilution embodiment 4, and Al (OH) is added3Adjuvant mixing.Utilize with The I virus-like particle of upper purifying was immunized rat twice at first week and third Zhou Jinhang respectively, every time every immune 10 μ g Or 25 μ g.Import IPV inactivated vaccine is set simultaneously as positive control and the vehicle control without containing virus-like particle sample.Four To rat, blood was collected after week, collects serum, freezen protective after packing.
Doubling dilution rat blood serum sample, and is diluted to 100TCID50Polio attenuated strain Sabin I mixing it is equal It is even, it is incubated for 1 hour in 37 DEG C of incubators.It takes the neutralizer of 100 μ l to be added in 96 hole Vero cells, is incubated in 37 DEG C of incubators It educates 3-4 hours, observes cytopathic effect, that is, CPE.The polio I type virus-like of each 10 μ g is immunized twice as the result is shown The experimental group of grain can protect completely cell not by virus attack when serum dilutes 1024 times；The spinal cord of each 25 μ g is immunized twice The experimental group of poliomyelitis I virus-like particle can protect completely cell not by virus attack when serum dilutes 2048 times；Two The secondary positive controls that fifty-fifty import IPV inactivated vaccine is immunized serum dilute 4096 times when can protect completely cell not by Virus attack.As it can be seen that the effect of the virus-like particle is preferable and the space of its purifying and optimization is bigger, and virus-like particle There is higher safety compared to attenuated vaccine and inactivated vaccine.
Obviously, the above embodiments are merely examples for clarifying the description, and does not limit the embodiments.It is right For those of ordinary skill in the art, can also make on the basis of the above description it is other it is various forms of variation or It changes.There is no necessity and possibility to exhaust all the enbodiments.And it is extended from this it is obvious variation or It changes still within the protection scope of the invention.

Claims (7)

1. a kind of preparation method of recombining spinal cord grey matter disease virus sample particle, which comprises the steps of:
(1) the P1 gene and 3CD gene for taking poliovirus are cloned into coexpression vector respectively, then pass through conversion sense Obtained to express the recombinant viral vector of poliovirus sample particle by state cell；
(2) the recombinant viral vector transfection insect cell obtained with step (1) is obtained after culture containing coding virus-like particle egg The recombinant virus of white gene；
(3) recombinant virus infection to the host cell that step (2) obtain is expanded to improve virus titer, then inoculation is high The recombinant virus of titre infects insect cell, to express above-mentioned P1 gene and 3CD gene, and obtains ridge according to conventional purification method Marrow poliovirus sample particle；
The P1 gene and the 3CD gene are the gene that codon optimization is carried out according to the Preference of host cell；
Wherein, the poliovirus is I type virus, and the P1 gene order of optimization is excellent as shown in SEQ ID NO:1 The 3CD gene order of change is as shown in SEQ ID NO:2；
Alternatively, the poliovirus be II type virus, optimization P1 gene order as shown in SEQ ID NO:3, The 3CD gene order of optimization is as shown in SEQ ID NO:4；
Alternatively, the poliovirus be III type virus, optimization P1 gene order as shown in SEQ ID NO:5, The 3CD gene order of optimization is as shown in SEQ ID NO:6.
2. the preparation method of recombining spinal cord grey matter disease virus sample particle according to claim 1, which is characterized in that the step Suddenly in (1), the coexpression vector is that the P1 gene and the 3CD gene are inserted respectively into pFastBacTMDual carrier Or the recombinant plasmid respectively obtained by a promoter driving transcription at two multiple cloning sites of Dual-CMV transformation carrier；
The Dual-CMV transformation carrier is in pFastBacTMOn the basis of Dual carrier by p10 promoter engineering be CMV promoter The transformation carrier of acquisition.
3. the preparation method of recombining spinal cord grey matter disease virus sample particle according to claim 2, which is characterized in that the step Suddenly in (1), the P1 gene and the 3CD gene are respectively transcribed by a promoter driving in the recombinant expression carrier, are driven The promoter direction for moving the P1 gene is contrary with the promoter of the 3CD gene is driven.
4. the preparation method of recombining spinal cord grey matter disease virus sample particle according to claim 1 to 3, which is characterized in that In the step (1), the competent cell is DH10Bac competent cell, and the recombinant viral vector obtained is attached most importance to Group insect baculovirus carrier.
5. the preparation method of recombining spinal cord grey matter disease virus sample particle according to claim 4, which is characterized in that the step Suddenly in (2), insect cell is selected from Spodopterafrugiperda ovary cell line sf9, sf21 and cabbage looper embryo cell line High Five。
6. the recombining spinal cord grey matter disease virus sample particle being prepared by any the method for claim 1-5.
7. recombining spinal cord grey matter disease virus sample particle as claimed in claim 6 is used to prepare prevention and treats the epidemic disease of polio Purposes in seedling drug.
CN201610232296.9A 2016-04-14 2016-04-14 A kind of recombining spinal cord grey matter disease virus sample particle and the preparation method and application thereof Active CN105802923B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201610232296.9A CN105802923B (en) 2016-04-14 2016-04-14 A kind of recombining spinal cord grey matter disease virus sample particle and the preparation method and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201610232296.9A CN105802923B (en) 2016-04-14 2016-04-14 A kind of recombining spinal cord grey matter disease virus sample particle and the preparation method and application thereof

Publications (2)

Publication Number Publication Date
CN105802923A CN105802923A (en) 2016-07-27
CN105802923B true CN105802923B (en) 2019-07-16

Family

ID=56460320

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201610232296.9A Active CN105802923B (en) 2016-04-14 2016-04-14 A kind of recombining spinal cord grey matter disease virus sample particle and the preparation method and application thereof

Country Status (1)

Country Link
CN (1) CN105802923B (en)

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108130332A (en) * 2016-12-01 2018-06-08 上海泽润生物科技有限公司 Recombinant poliovirus type III virus-like particle
CN108130333A (en) * 2016-12-01 2018-06-08 上海泽润生物科技有限公司 I virus-like particle of recombinant poliovirus
CN109865133B (en) * 2017-12-01 2021-07-09 上海桀蒙生物技术有限公司 Method for preparing personalized cancer vaccine

Family Cites Families (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102559615B (en) * 2010-12-23 2016-09-28 上海泽润生物科技有限公司 EV71 vaccine preparation method and the vaccine prepared by the method
AU2012360168C1 (en) * 2011-11-03 2017-09-28 Sentinext Therapeutics Sdn Bhd Vaccines directed against human Enteroviruses
US20150044257A1 (en) * 2012-03-23 2015-02-12 Fred Hutchinson Cancer Research Center Baculovirus-based enterovirus 71 vlp as a vaccine
CN102876688A (en) * 2012-10-15 2013-01-16 北京工业大学 Method for preparing recombinant polio I virus-like particles
CN102876707B (en) * 2012-10-15 2014-05-28 北京工业大学 Preparation method of recombinant poliovirus I-type virus-like particles
CN103993032A (en) * 2014-05-05 2014-08-20 上海博唯生物科技有限公司 Method for preparing recombinant poliovirus-like particles
CN104480143B (en) * 2014-12-04 2017-07-04 广东华南联合疫苗开发院有限公司 A kind of preparation method of the carrier and poliovirus sample particle for expressing poliovirus sample granule protein

Also Published As

Publication number Publication date
CN105802923A (en) 2016-07-27

Similar Documents

Publication Publication Date Title
EP3290050B1 (en) Vaccines directed against human enteroviruses
CN102834507B (en) For generating the construct of sky picornavirus housing
CN103122353B (en) Porcine O-type foot-and-mouth disease virus recombinant baculovirus as well as preparation method and application thereof
CN104480143B (en) A kind of preparation method of the carrier and poliovirus sample particle for expressing poliovirus sample granule protein
CN106867975B (en) Newcastle disease virus chimeric virus-like particle, vaccine and preparation method
CN101695569A (en) Univalent and bivalent gene engineered subunit vaccine for hand-foot-and-mouth disease and preparation method thereof
CN103740758B (en) Recombinant baculovirus vector, virus like particle, preparation method and use
CN106834352A (en) The polyhedrosis method of parcel carp herpesviral II type antigens is prepared based on baculovirus expression system
CN105802923B (en) A kind of recombining spinal cord grey matter disease virus sample particle and the preparation method and application thereof
CN114854697B (en) Trivalent inactivated vaccine of porcine rotavirus G4-G5-G9 and preparation method and application thereof
CN107236747A (en) Foot and mouth disease virus recombinant virus like-particles and its preparation method and application
CN112048004B (en) Coxsackie virus B5 type virus-like particle, and preparation method and application thereof
CN109601007A (en) A kind of foot and mouth disease virus sample particle vaccines and preparation method thereof
CN109234241A (en) A kind of Coxsackie virus CVA16 type velogen strain CVA16-B6-714 and its application
CN110423269A (en) A kind of 2 type Cap protein of recombinant porcine circovirus and its application of Dominant Epitopes of connecting
CN111647087B (en) Chimeric virus-like particle vaccine and preparation method and application thereof
CN107227311A (en) Recombination porcine parvovirus like-particles and its preparation method and application
CN110256539A (en) O-shaped foot and mouth disease virus novel gene engineering subunit vaccine
CN109207441A (en) 3 type Cap protein of recombinant baculovirus expression pig circular ring virus and its construction method and primer
CN110129348A (en) Efficiently recombinant DNA carrier, application and the vaccine of preparation foot and mouth disease virus sample particle
CN110305852A (en) Express the building of Porcine epidemic diarrhea virus S1 genetic recombination pseudorabies virus
TW201100545A (en) Method for preparing enterovirus virus-like particle and use thereof
CN112500458B (en) Novel variant subunit vaccine of chicken infectious bursal disease virus, preparation method and application thereof
CN103789274A (en) Rabbit hemorrhagic disease virus recombinant subunit vaccine and preparation method thereof
CN108888761A (en) Express the recombinant baculovirus inactivated vaccine and the preparation method and application thereof of H7N9 subtype avian influenza virus hemagglutinin

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant