CN105801676A - Mutant MspA protein monomer and expressed gene and application thereof - Google Patents
Mutant MspA protein monomer and expressed gene and application thereof Download PDFInfo
- Publication number
- CN105801676A CN105801676A CN201610228541.9A CN201610228541A CN105801676A CN 105801676 A CN105801676 A CN 105801676A CN 201610228541 A CN201610228541 A CN 201610228541A CN 105801676 A CN105801676 A CN 105801676A
- Authority
- CN
- China
- Prior art keywords
- mspa
- protein monomer
- protein
- aminoacid
- sudden change
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
- C07K14/35—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Mycobacteriaceae (F)
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/5308—Immunoassay; Biospecific binding assay; Materials therefor for analytes not provided for elsewhere, e.g. nucleic acids, uric acid, worms, mites
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
- G01N33/6803—General methods of protein analysis not limited to specific proteins or families of proteins
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
- G01N33/6803—General methods of protein analysis not limited to specific proteins or families of proteins
- G01N33/6806—Determination of free amino acids
Abstract
The invention discloses a mutant MspA protein monomer and an expressed gene and application thereof.The protein monomer is obtained by wild type MspA protein through mutation.Wild type MspA protein comprises the amino acid sequence shown in the sequence table SEQ ID NO: 1.Mutation occurs in one or more amino acids in the region from the bit 88 to the bit 116 in the sequence table SEQ ID NO: 1.The protein monomer can form nanometer holes of octamer.Compared with the prior art, the provided mutation MspA protein monomer can form a nanometer channel of octamer, the spontaneous blocking effect, generated under additional bias voltage, of the nanometer holes of the wild MspA protein can be improved obviously, the capture rate of analyte is increased, the analyte is blocked to pass through the hole channel to a certain degree, the hole passing rate is reduced, and the detection precision is improved.
Description
Technical field
The present invention relates to a kind of sudden change MspA protein monomer and expressing gene thereof and application, belong to nanosensor technical field.
Background technology
Traditional sequencing technologies depends primarily on amplification technique to produce substantial amounts of nucleic acid, and needs the fluorescence signal of the chemical substance to labelling to detect, and therefore not only speed is slow, and expensive.And nano-pore order-checking be by by DNA molecular electrophoresis by a thin and little nano-pore, due to the difference of different base physicochemical properties, its current blockade effect difference to hole, learnt the sequence information of base in DNA molecular by the resolution to blocking current.Therefore, the sequence measurement based on nano-pore has sizable advantage, including (1) non-marked, (2) need not expanding, (3) high flux, (4) are with low cost, (5) sample requirement amount is little, and (6) read long.
Character according to material, nano-pore is divided into biological nano hole and solid nano hole, and both are respectively arranged with quality.Solid nano hole has the advantage being more easy to the aspects such as preservation, chemical stability is good, size is controlled.In addition, under the variable concentrations of different solutions, solid nano hole can use the longer time, and biological nano hole can provide the structure of atomic accuracy and the potentiality of hereditary information.
Commonly using the protein doing biological nano hole except the alpha hemolysin of staphylococcus aureus, the porin (MspA) in smegmatis mycobacterium shows better application prospect.MspA porin is rotational symmetric goblet shape eight aggressiveness formed by eight mutual compact siro spinning technology of MspA monomer, each monomer is made up of 184 aminoacid, wherein 134 amino acid residue globular domains are assembled into a glass body, and other 50 amino acid residue rings form cup handle and base [FallerM., etal.Thestructureofamycobacterialouter-membranechannel.S cience, 2004,303 (5661): 1189-1192.].
MspA porin has an about wide 1.2nm, the short narrow constriction of long 0.6nm, different IPs thuja acid is made to produce to be more easy to the feature blocking current [DerringtonI.M. of resolution by this passage capable of being, etal.NanoporeDNAsequencingwithMspA.ProceedingsoftheNatio nalAcademyofSciences, 2010,107 (37): 16060-16065.].DNA molecular transposition from nano-pore under the driving of extra electric field, is then the formation of current blockade signal.Owing to the constriction of wild type MspA is enriched electronegative aminoacid, electronegative DNA molecular is difficult to pass through under normal circumstances, and can occur spontaneous obstruction Pinhole closure under high applied voltage.
[the Butler such as Butler in 2008, T.Z., etal.ProceedingsoftheNationalAcademyofSciences, 2008,105 (52): 20647-20652.] by being neutral amino acid by being in 90,91, No. 93 electronegative amino acid mutations of MspA nanopore-channel shrinking zone, MspA mutant M1MspA (D90N/D91N/D93N/) is obtained.Its expression and channel-forming activities and wild type MspA albumen do not have difference, and eliminate the negative charge of shrinking zone, electronegative ssDNA improves wild type MspA well and can produce the phenomenon of spontaneous blocking effect under higher than 180mV bias voltage, so that can realize Single Molecule Detection by this passage under applying bias voltage drives.Additionally, they will be in the 118 of passage vestibular area, 134, No. 139 electronegative amino acid mutations are positively charged aminoacid, obtain the mutant M2MspA (D90N/D91N/D93N/D118R/E139K/D134R) of MspA, owing to reducing the vestibular area electrostatic repulsion to ssDNA, and effectively prevent ssDNA to overflow from vestibular area, the capture rate of ssDNA is improve nearly 20 times by it, the Duration Ratio of the current blockade event that ssDNA transposition produces increases nearly a hundred times in M1MspA, and the required bias voltage applied of driving ssDNA molecule via is only half before.
null[the BhattacharyaS. such as Bhattacharya in 2012,etal.MolecularDynamicsStudyofMspAArginine-MutantsPredictsSlowDNATranslocationsandIonCurrentBlockadesIndicativeofDNASequence.ACSnano,2012,6 (8): 6960-6968.] then simulate, by full atom and molecule kinetics (MD), three kinds of MspA mutant: the L88R-NNN carrying out arginine sudden change on M1MspA protein-base further in passage constriction、L88R/T83R/S116R-NNN and L88R/A96R/S116R-NNN.Owing to the amido on the arginine of replacement after sudden change can form salt bridge with the phosphate on DNA skeleton, and arginic side chain can and cytosine base be superimposed together, thus having blocked DNA momently by passage, increasing the capture rate of DNA, and greatly reducing the via speed of DNA.But this research only resides within the dummy run phase, do not pass through real protein engineering experiment and be verified.
In sum, wild type MspA is not suitable for being directly used in detection of analytes, it is necessary in advance its constriction and additional aminoacid carry out corresponding construction and Functional mutations just can really apply sign.nullAnd in existing MspA protein mutation technology，Simply respectively the specific amino acids of vestibular area and constriction is replaced accordingly，Although adds somewhat to the capture rate to analyte，But，To analyte via speed controlling in actual sign process，Main still by using the motor molecules such as phi29DNA polymerase to realize [Derrington,I.M.,etal.,Subangstromsingle-moleculemeasurementsofmotorproteinsusingananopore.Naturebiotechnology,2015.33(10):p.1073-1076.]，Not only complex steps，And it is relatively costly.
Summary of the invention
Goal of the invention: in order to solve above-mentioned technical problem, the present invention is by designing and building described sudden change MspA protein monomer and change its polymeric space structure, net charge and become key or radical reaction ability with analyte, thus improving wild type MspA protein nano hole to add the spontaneous blocking effect produced under high bias voltage outside, and increase the capture rate to analyte, and to a certain degree retardation assays thing passes through its duct, reduce via speed, increase accuracy of detection.
Technical scheme: in order to realize foregoing invention purpose, the invention provides a kind of sudden change MspA protein monomer, described protein monomer is by wild type MspA protein mutation gained, described wild type MspA albumen comprises aminoacid sequence shown in sequence table SEQ IDNO:1, and the one or more aminoacid in the region of 88 to 116 in described sequence table SEQ IDNO:1 occur in described sudden change；Described protein monomer can form the nano-pore of eight aggressiveness.
The one or more amino acid mutation changes (1) space structure of protein monomer；(2) net charge；(3) key or radical reaction ability are become with analyte.
Described protein monomer can be self-assembly of eight aggressiveness nanopore-channel on the double-decker that amphipathic molecule is formed；
Described amphipathic molecule, it is possible to be phospholipid or other polymer.
As preferably, described protein monomer comprises aminoacid sequence shown in sequence table SEQ IDNO:2, SEQIDNO:3, SEQIDNO:4 or SEQIDNO:5.
As another kind preferably, sport described in: the one or more amino acid mutation increases or reduces clean positive charge.
As it is preferred that, the clean positive charge of described increase is: by introducing the aminoacid of one or more positively charged and/or neutralizing one or more negative charge and increase；Or pass through with the one or more electronegative aminoacid of one or more uncharged aminoacid replacement；Or it is neutralized by introducing the aminoacid of one or more positively charged near one or more electronegative aminoacid.
Present invention also offers the gene of coding said mutation MspA protein monomer.
As preferably, the nucleotide sequence of described gene is such as shown in sequence table SEQ IDNO:6, SEQIDNO:7, SEQIDNO:8 or SEQIDNO:9.
Present invention also offers the recombinant vector of described gene, expression cassette or recombinant bacterium.
Described recombinant vector is alternatively recombinant expression carrier, it is possible to for recombinant cloning vector.
In the present invention, the recombiant plasmid that described recombinant expression carrier obtains after being specially between the double enzyme site of expression plasmid DNA fragmentation shown in forward insertion sequence table SEQIDNO:6, SEQIDNO:7, SEQIDNO:8 or SEQIDNO:9.
Finally, invention provides described sudden change MspA protein monomer for characterizing the application of target analytes.
As preferably, described sign process is as follows:
(1) one or more described protein monomer is formed with poly-or different eight poly-aggressiveness nano-pores；
(2) described target analytes is made to contact with above-mentioned nano-pore so that target analytes moves through described nano-pore；
(3) obtaining one or more measured value relative to described nano-pore hole when analyte moves, wherein said measured value represents the one or more feature of described target analytes and thus characterizes described target analytes.
Preferred as another kind, that described target analytes is following a kind of material or many kinds of substance is formed complex: (1) metal ion；(2) inorganic salt；(3) polymer；(4) aminoacid；(5) peptide；(6) polypeptide；(7) protein；(8) nucleotide；(9) oligonucleotide；(10) polynucleotide；(11) dyestuff；(12) bleach；(13) medicine；(14) diagnostic agent；(15) drugs；(16) explosive pollutant；(17) environmental contaminants.
Gained of the present invention sudden change MspA protein monomer, by transforming the specific amino acids of constriction and the near zone thereof that target analytes identification is played a crucial role simultaneously, not only allow for the impact of charge interaction, utilize functional group to interact simultaneously, block analyte via speed to a greater degree, break away from the dependence to additional agents.
Technique effect: relative to prior art, sudden change MspA protein monomer provided by the present invention, eight aggressiveness nanochannels can be formed, can significantly improve wild type MspA protein nano hole and add the spontaneous blocking effect produced under high bias voltage outside, and increase the capture rate to analyte, and to a certain degree retardation assays thing passes through its duct, reduce via speed, increase accuracy of detection.
Accompanying drawing explanation
Fig. 1 is recombinant clone daughter colony PCR result.M:DL2000marker；1-6:pET32a-Mutantmspa plasmid；Wherein 3,5 bacterium colonies have obvious band；
Fig. 2 is positive colony double digestion the result.M: λ HindIIImarker；1:pBX2-mspa/BamHI+HindIII；2:pBX2-Mutantmspa/BamHI+HindIII；3:pET32a-tev-mspa/BamHI+HindIII；4:pET32a-tev-Mutantmspa/BamHI+HindIII；
Fig. 3 is fusion protein lab scale SDS-PAGE analysis chart: M:ProteinMarker；1: total protein before induction；2:20 DEG C of supernatant；3:20 DEG C of precipitation；4:37 DEG C of supernatant；5:37 DEG C of precipitation；
Fig. 4 is nickel agarose affinity chromatography purification SDS-PAGE analysis chart: M:Proteinmarker；1: loading；2: flow out；3:20mMImidazole elution fraction；4-6:50mMImidazole elution fraction；7-9:500mMImidazole elution fraction；
Fig. 5 is second time nickel agarose affinity chromatography purification SDS-PAGE analysis chart: M:Proteinmarker；1:500mMImidazole elution fraction；2:20mMImidazole elution fraction；3-5: flow out；6 cut after；7 cut before.
Fig. 6 is gel filtration chromatography SDS-PAGE analysis chart: M:Proteinmarker；1-10: collect component (2ml/tube)；
Fig. 7 is the final purification SDS-PAGE analysis chart of albumen: M:PrestainedMarker；1: destination protein；
Fig. 8 is fusion protein WesternBlot analysis chart: M:PrestainedMarker；Before 1:TEV enzyme action；After 2:TEV enzyme action；
Fig. 9 is BSA protein standard curve figure.
Figure 10 is patch-clamp detection system schematic；
Figure 11 is Poly (dT)100Crossing mutant MspA nano-pore schematic diagram, wherein: Cis is front (i.e. sudden change MspA protein nano hole bizet entrance towards direction), Trans is reverse side (i.e. the outlet of sudden change MspA protein nano hole root towards direction)；
Figure 12 is Poly (dT)100Cross mutant MspA nano-pore current locus and typical event figure；
Figure 13 is Poly (dT)100The scatterplot of via event and via persistent period block diagram.
Detailed description of the invention
The experimental technique used in following embodiment if no special instructions, is conventional method.
Material used in following embodiment, reagent etc., if no special instructions, all commercially obtain.
Following example are further intended to illustrate, rather than the restriction present invention.Under the premise of the spirit and principles in the present invention, any change and the changes that carry out the indivedual technical steps of invention fall within accompanying claims scope of the present invention.
Embodiment 1
(1) structure of mutant gene fragment
At mutant MspA genetic fragment Upstream plus BamHI restriction enzyme site (G/GATCC) and TEV protease recognition site (GAAAATCTGTACTTCCAAGGC), downstream adds termination codon (TAA) and HindIII restriction enzyme site (A/AGCTT), the DNA sequence built, such as shown in sequence table SEQ IDNO:10, synthesizes this sequence.
(2) suddenly change the structure of recombinant vector and qualification:
Mutant gene containing BamHI, HindIII restriction enzyme site and TEV protease recognition site and carrier pET32a plasmid BamHI and HindIII enzyme are carried out double digestion process, utilize T4DNA ligase that with the pET32a containing corresponding sticky end, the mutant gene of recovery is attached reaction, 16 DEG C of 12h afterwards.The support C a that will build2+Proceed in E.coliDH5a, and clone is carried out bacterium colony PCR checking (referring to Fig. 1, swimming lane M:DL2000marker；1-6:pET32a-Mutantmspa plasmid.Wherein 3,5 bacterium colonies have obvious band).Checking positive findings extracts plasmid, and double digestion is verified (referring to Fig. 2, swimming lane M: λ HindIIImarker；1:pBX2-mspa/BamHI+HindIII；2:pBX2-Mutantmspa/BamHI+HindIII；3:pET32a-tev-mspa/BamHI+HindIII；4:pET32a-tev-Mutantmspa/BamHI+HindIII).Will checking bacterial strain Ca2+Proceed in E.coliBL21 (DE3) and express.
(3) expression and purification of mutant protein
1. convert
Take pET32a Plastid transformation BL21 (DE3) bacterial strain (described plasmid comprises nucleotide sequence described in SEQIDNO:6) of 1 μ l restructuring, 42 DEG C of thermal shock 90s, it is coated with flat board (100 μ g/mL ampicillin), 37 DEG C of calorstat overnight incubation after standing 2min on ice.4gLBBorthAgar (the raw work in Shanghai) uses 100mLddH2O dissolves, high temperature and high pressure steam sterilizing.
2. lab scale is cultivated and is selected best inductive condition
Single bacterium colony of picking expression strain BL21 (DE3) in containing in 2.5mLLB culture medium (100 μ g/mL ampicillin) test tube, 37 DEG C, 220rpm shaking table overnight incubation.25gLBBorth powder 1LddH2O dissolves, high temperature and high pressure steam sterilizing.
The bacterium solution of cultivation being inoculated in respectively in 2.5mLLB culture medium in 1:100 ratio, add 100 μ g/mL ampicillin, 37 DEG C, 220rpm cultivates about 3h.
When OD value reaches about 0.6, add IPTG, the 220rpm of final concentration of 0.5mM, respectively 20 DEG C of overnight induction；37 DEG C induction 4h, do not add IPTG derivant as negative control.
The centrifugal 10min of 4000rpm collects thalline, abandoning supernatant, thalline suspends with 500 μ LPBS (PH7.4) buffer, ultrasonication 6min, super 0.5s stops 1.5s, the upper cleer and peaceful precipitation of centrifugal collection respectively, precipitates with 500 μ L solubilization of inclusion bodies liquid (8MUrea, 50mMTris-HCl, 150mMNaCl, PH8.0) dissolve, take 40 μ L sample and 10 μ L5 × proteinloadingbuffer mixing, boiling water bath 10min respectively.
SDS-PAGE detects, and prepares SDS-PAGE, Tris-Gly electrophoretic buffer (Tris30g, glycine 144.0g of 12%, SDS10g, is settled to 1L), applied sample amount 10 μ L, concentrate glue 80V20min, separation gel 120V60min, gel electrophoresis terminates to examine dye 20min, decolouring.Result shows, destination protein is expressed successfully (referring to Fig. 3, swimming lane M:ProteinMarker；1: total protein before induction；2:20 DEG C of supernatant；3:20 DEG C of precipitation；4:37 DEG C of supernatant；5:37 DEG C of precipitation).
3. induce in a large number
The bacterium solution activated overnight is inoculated in the LB fluid medium of 4L in 1:100 ratio, 100 μ g/mL ampicillin, 37 DEG C, 220rpm cultivates about 3h, when OD value reaches about 0.6, add final concentration of 0.5mMIPTG, 20 DEG C, 220rpm, overnight induction, centrifugal collecting cell thalline.
4. fusion protein purification
4.1 ultrasonication thalline
The microorganism collected is dissolved with broken Buffer (4MUrea, 50mMTris, 300mMNaCl, pH8.0), ultrasonication thalline in ice bath, power 400W, 15min (ultrasonic 2S, suspending 6S is a circulation).
Ultrasonic complete, 12000rpm, 4 DEG C, centrifugal 20min, supernatant does next step purification.
4.2 nickel agarose affinity chromatographies
(1) take 5mLNi-IDA, clean balance pillar, flow velocity 5mL/min with the Bindingbuffer of 10 times of bed volumes.
(2) upper prop, flow velocity is 2mL/min, collects and penetrates liquid.
The Bindingbuffer of (3) 10 times of bed volumes cleans pillar, flow velocity 10mL/min.
(4) WashBuffer washes assorted, flow velocity 5mL/min, collects eluent.
(5) ElutionBuffer eluting, flow velocity 2mL/min, collects eluent.
Note: BindingBuffer (4MUrea, 50mMTris, 300mMNaCl, pH=8.0)
Washbuffer (4MUrea, 50mMTris, 300mMNaCl, 20/50Imidazole, pH=8.0)
ElutionBuffer (4MUrea, 50mMTris, 300mMNaCl, 500mMImidazole, pH=8.0)
(6) component collected being carried out SDS-PAGE detection, carry out dialysis in 2MUrea, 50mMTris, 300mMNaCl, pH8.0 by component best for purity, add TEV protease enzyme action, 4 DEG C overnight.
Result shows, after variable concentrations imidazoles eluting, containing destination protein (referring to Fig. 4, swimming lane M:Proteinmarker in eluent；1: loading；2: flow out；3:20mMImidazole elution fraction；4-6:50mMImidazole elution fraction；7-9:500mMImidazole elution fraction).
4.3 second time nickel agarose affinity chromatographies
Sample after enzyme action in 4.2 is crossed second time nickel post, collects effluent, the component collected is carried out SDS-PAGE detection.
Result shows, after variable concentrations imidazoles eluting, containing destination protein in eluent.(referring to Fig. 5, swimming lane M:Proteinmarker；1:500mMImidazole elution fraction；2:20mMImidazole elution fraction；3-5: flow out；6 cut after；7 cut before).
4.4 gel permeation chromatographies
4.3 gained purity flow out component 10KDa super filter tube preferably be concentrated by ultrafiltration, carry out consummate with gel permeation chromatography.Filler: Sephacryls-200；Applied sample amount: 3mL；Flow velocity: 1mL/min；Often pipe collected volume: 2mL；CV:150mL (16/75)；Mobile phase: 4MUrea, 50mMTris, 300mMNacl, pH8.0.After the component collected is carried out SDS-PAGE detection, aggressiveness and monomer component are carried out dialysis in 50mMTris, 300mMNacl, PH=8.0 respectively, overnight, 0.45 μm of membrane filtration concentration subpackage, lyophilizing ,-80 DEG C of preservations.
Result shows, in outflow component, aggressiveness obtains with monomer and separates preferably (referring to Fig. 6, swimming lane M:Proteinmarker；1-9: collect component (2ml/tube)).
(4) detection of purifying protein
1.SDS-PAGE detects
Preparing SDS-PAGE, the Tris-Gly electrophoretic buffer of 12%, applied sample amount 10 μ L, concentrate glue 80V20min, separation gel 120V60min, gel electrophoresis carries out coomassie brilliant blue staining 20min after terminating, decolouring.
Result shows, purpose fusion protein successfully obtains purification.(referring to Fig. 7, swimming lane M:PrestainedMarker；1: destination protein).
2.Westernblot detects
(1) glue: preparation polyacrylamide gel: concentration glue 5%, separation gel 8%.
(2) sample preparation: applied sample amount: 1 μ g.
(3) electrophoresis: concentration glue 80V, 30min；Separation gel 120V, 60min.
(4) transferring film: wet turn, 250mA90min.
(5) close: the defatted milk powder of 5%, 37 DEG C of slow vibration 2h.
(6) primary antibodie is hatched: primary antibodie is the anti-his label of rabbit, antibody (the raw work in Shanghai, numbering: D110002) 1:500 dilution, 37 DEG C of slow vibration 60min.
(7) hatch two to resist: two resist for goat-anti rabbit, antibody (the raw work in Shanghai, numbering: D110002) 1:8000 dilution, 37 DEG C of slow vibration 60min.
(8) colour developing: TMB develops the color.
Result shows, it is thus achieved that albumen be really that target MspA mutant protein is (referring to Fig. 8, swimming lane M:PrestainedMarker；Before 1:TEV enzyme action；After 2:TEV enzyme action).Gained protein monomer comprises aminoacid sequence shown in SEQIDNO:2.
3. determination of protein concentration
With SK3071 non-interference type determination of protein concentration kit measurement protein concentration, measuring albumen volume is 20 μ l.With BSA for standard substance bioassay standard curve (referring to Fig. 9).
According to actual measured results (table 1), the fusion protein concentration bringing standard curve calculating into is 0.54mg/ml.
Table 1: record BSA albumen and the quality of MspA mutant protein
(5) DNA sample is characterized
MspA protein mutant provided by the invention is applied to DNA single Molecular Detection, is embodied as step as follows:
1, reagent prepares
(1)50mMNa3PO4Buffer (500ml):
Weighing 9.503gNa3PO4 12H2O, ultra-pure water is settled to 500ml.
(2) volume fraction is the HCl solution (500ml) of 0.1%
Take 0.5ml36-38% hydrochloric acid solution, be settled to 500ml with ddH20 dilution.
(3) 1MKCl, 25mMTris-HCl, PH8.0 (100ml)
Weighing KCl7.45g, Tris0.30285g, 60ml ultra-pure water respectively to dissolve, PH measures pH value.10%HCl adjusts PH to 8.0.
(4) 10mMTris-HCl, 100 μMs of EDTA, PH8.0 (100ml)
Weighing Tris0.12114g, EDTA0.0037223g, 60ml ultra-pure water respectively to dissolve, PH measures pH value.10%HCl adjusts PH to 8.0.
2, fluid and phospholipid brush clean
(1) fluid pool (U.S. WarnerInstruments) is taken apart put into Special beaker, add Na3PO4Washing liquid soaks ultrasonic 10min, cleans fluid pool inside and outside with defat cotton swab, and this step repeats 3 times.
(2) continue to clean according to said method with the HCl solution that volume fraction is 0.1%, neutralize alkaline matter.Repeat 3 times.
(3) ultrapure water is used three times.N2 dries up, and seals and preserves.
(4) same method cleans phospholipid brush.
3, DPhPC decane solution preparation
Take and be stored in DPhPC chloroformic solution (25mg/ml) the 50 μ l that 1.5ml peace is cutd open in bottle, dry up chloroform with N2.Adding 50 μ l decane and dissolve DPhPC, final solution concentration is 25mg/ml.
4, prepared by lipidbilayer
(1) after assembling fluid, 1mlKCl (1M is respectively added in fluid pool both sides, 25mMTris-HCl, pH8.0), connect patch-clamp 200B (U.S. MolecularDevices) electrode (detection system schematic is referring to Figure 10).
(2) appropriate DPhPC decane solution is brushed at fluid pool at fluid pool orifice position with the marten hair brush pen of No. 000, with the 1ml syringe pumping liquid from the perfusion hole of fluid made by oneself with flexible pipe suction nozzle, making liquid level drop to below aperture, then slowly noting back liquid did not have aperture.In fluid pool both sides, method according to this lifts liquid level several times repeatedly, until patch-clamp electric current registration is 0pA.
(3) with the MembraneTest Function detection membrane capacitance Cm and membrane resistance Rm of patch-clamp to judge size and the quality forming Lipid bilayer membranes.
(5) adding 100mV voltage, observing electric current registration has unchanged.Add 200,300mV voltage, observe electric current whether transship.
5, sudden change MspA nano-pore single channel assembles
(1) if Rm continues more than 1G Ω, and Cm is about 50-120pF, and adding 300mV can break up film, and namely lipidbilayer is formed.Now add the good MspA protein mutation liquid solution of 1 μ l beforehand dilution (1.08 μ g/ml), softly blow and beat with 200 μ l liquid-transfering guns, wait that single channel is formed.
(2), after single channel is formed, appropriate poly shown in SEQIDNO:11 (dT) in sequence list can be added100, add 60mV voltage, observe and tracer signal.
6. data analysis
After initial data checked by the clamfit10.3 software carried by patch-clamp, with the ThresholdSearch function automatiom information retrieval object event in EventDetection, detailed process is: open pore current is set to baseline, the open pore current of 70% is set to threshold value, it is peak swing to 0pA, monitoring is until electric current drops to namely is recorded as an object event between threshold value and peak swing continuously, and records the current amplitude value △ I and duration value △ t of this event simultaneously.
7. result and discussion
It is observed that mutant MspA nano-pore is inserted in DPhPC bilayer, under+60mV voltage, observe the stable open pore current of about 165pA.Poly (dT) is added at Tri end100After molecule, it was observed that corresponding translocation events signal, and (as shown in figure 12, wherein A is Poly (dT) in ms magnitude the persistent period of individual event100Cross the current locus figure of mutant MspA nano-pore；B is typical target event enlarged drawing).Extract the blocking current amplitude I/I of object eventoAfter via persistent period Durationtime, statistical analysis also draws scatterplot and block diagram, sees Figure 13, can obtain Poly (dT)100Mean transit time be 1212 ± 1 μ s, the ratio via time (< 50 μ s) in the sudden change MspA albumen of at present existing research extends at least 20 times.
Embodiment 2
All methods are all identical with embodiment 1, are different in that: adopt the gene comprising nucleotide sequence shown in SEQIDNO:7, finally prepare the protein monomer comprising aminoacid sequence shown in SEQIDNO:3.Gained protein monomer is utilized to carry out target analytes (protein) detection, it can form eight aggressiveness nanochannels, can enlarge markedly the capture rate to protein, and to a certain degree block protein matter passes through its duct, reduce via speed, increase accuracy of detection.
Embodiment 3
All methods are all identical with embodiment 1, are different in that: adopt the gene comprising nucleotide sequence shown in SEQIDNO:8, finally prepare the protein monomer comprising aminoacid sequence shown in SEQIDNO:4.Gained protein monomer is utilized to carry out target analytes (aminoacid) detection, it can form eight aggressiveness nanochannels, can enlarge markedly amino acid whose capture rate, and to a certain degree retardance aminoacid passes through its duct, reduce via speed, increase accuracy of detection.
Embodiment 4
All methods are all identical with embodiment 1, are different in that: adopt the gene comprising nucleotide sequence shown in SEQIDNO:9, finally prepare the protein monomer comprising aminoacid sequence shown in SEQIDNO:5.Utilizing gained protein monomer to carry out target analytes (polypeptide) detection, it can form eight aggressiveness nanochannels, can enlarge markedly the capture rate to polypeptide, and to a certain degree blocking peptides, by its duct, reduces via speed, increases accuracy of detection.
Claims (10)
1. a sudden change MspA protein monomer, it is characterized in that, described protein monomer is by wild type MspA protein mutation gained, described wild type MspA albumen comprises aminoacid sequence shown in sequence table SEQ IDNO:1, and the one or more aminoacid in the region of 88 to 116 in described sequence table SEQ IDNO:1 occur in described sudden change；Described protein monomer can form the nano-pore of eight aggressiveness.
2. sudden change MspA protein monomer according to claim 1, it is characterised in that described protein monomer comprises aminoacid sequence shown in sequence table SEQ IDNO:2, SEQIDNO:3, SEQIDNO:4 or SEQIDNO:5.
3. according to claim 1 sudden change MspA protein monomer, it is characterised in that described in sport: the one or more amino acid mutation increase or reduce clean positive charge.
4. sudden change MspA protein monomer according to claim 3, it is characterised in that the clean positive charge of described increase is: by introducing the aminoacid of one or more positively charged and/or neutralizing one or more negative charge and increase；Or by increasing with the one or more electronegative aminoacid of one or more uncharged aminoacid replacement；The clean positive charge of described minimizing is: by reducing with the aminoacid of one or more one or more positively chargeds of uncharged aminoacid replacement.
5. the gene of sudden change MspA protein monomer described in coding any one of claim 1-4.
6. gene according to claim 5, it is characterised in that its nucleotide sequence is such as shown in sequence table SEQ IDNO:6, SEQIDNO:7, SEQIDNO:8 or SEQIDNO:9.
7. contain the recombinant vector of gene described in claim 5 or 6, expression cassette or recombinant bacterium.
8. suddenly change MspA protein monomer described in any one of claim 1-4 for characterizing the application of target analytes.
9. sudden change MspA protein monomer is used for characterizing the application of target analytes according to claim 8, it is characterised in that described sign process is as follows:
(1) one or more described protein monomer is formed with poly-or different eight poly-aggressiveness nano-pores；
(2) described target analytes is made to contact with above-mentioned nano-pore so that target analytes moves through described nano-pore；
(3) obtaining one or more measured value relative to described nano-pore hole when analyte moves, wherein said measured value represents the one or more feature of described target analytes and thus characterizes described target analytes.
10. according to claim 8 sudden change MspA protein monomer for characterizing the application of target analytes, it is characterised in that the complex that described target analytes is following a kind of material or many kinds of substance is formed: (1) metal ion；(2) inorganic salt；(3) polymer；(4) aminoacid；(5) peptide；(6) polypeptide；(7) protein；(8) nucleotide；(9) oligonucleotide；(10) polynucleotide；(11) dyestuff；(12) bleach；(13) medicine；(14) diagnostic agent；(15) drugs；(16) explosive pollutant；(17) environmental contaminants.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610228541.9A CN105801676B (en) | 2016-04-13 | 2016-04-13 | Mutant MspA protein monomer and expression gene and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610228541.9A CN105801676B (en) | 2016-04-13 | 2016-04-13 | Mutant MspA protein monomer and expression gene and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105801676A true CN105801676A (en) | 2016-07-27 |
| CN105801676B CN105801676B (en) | 2020-02-18 |
Family
ID=56460535
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610228541.9A Active CN105801676B (en) | 2016-04-13 | 2016-04-13 | Mutant MspA protein monomer and expression gene and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105801676B (en) |
Cited By (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106636163A (en) * | 2017-01-12 | 2017-05-10 | 上海柏根生物科技有限公司 | Fusion protein expression purification method |
| WO2020043082A1 (en) * | 2018-08-28 | 2020-03-05 | Nanjing University | Protein nanopore for identifying an analyte |
| CN111164096A (en) * | 2019-09-29 | 2020-05-15 | 北京齐碳科技有限公司 | Mmup monomer variant and application thereof |
| CN113735948A (en) * | 2021-09-28 | 2021-12-03 | 成都齐碳科技有限公司 | Mutant of porin monomer, protein pore and application thereof |
| CN113754743A (en) * | 2021-10-12 | 2021-12-07 | 成都齐碳科技有限公司 | Mutant of porin monomer, protein pore and application thereof |
| WO2023030146A1 (en) * | 2021-08-30 | 2023-03-09 | 四川大学 | Polypeptide composition analysis method based on copper ion modified mspa nanopores |
| WO2023050031A1 (en) * | 2021-09-28 | 2023-04-06 | 成都齐碳科技有限公司 | Mutant of porin monomer, protein pore and use thereof |
| WO2023056960A1 (en) * | 2021-10-09 | 2023-04-13 | Nanjing University | Single molecule identification with a reactive hetero-nanopore |
| WO2023060422A1 (en) * | 2021-10-12 | 2023-04-20 | 成都齐碳科技有限公司 | Mutant of porin monomer, protein pore and use thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102216783A (en) * | 2008-09-22 | 2011-10-12 | 华盛顿大学 | Msp nanopores and related methods |
-
2016
- 2016-04-13 CN CN201610228541.9A patent/CN105801676B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102216783A (en) * | 2008-09-22 | 2011-10-12 | 华盛顿大学 | Msp nanopores and related methods |
| CN104710519A (en) * | 2008-09-22 | 2015-06-17 | 华盛顿大学 | Msp nanopores and related methods |
Non-Patent Citations (1)
| Title |
|---|
| BUTLER,THOMAS.: "Nanopore analysis of nucleic acids.", 《THESIS(PH.D.) UNIVERSITY OF WASHINGTON》 * |
Cited By (11)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106636163A (en) * | 2017-01-12 | 2017-05-10 | 上海柏根生物科技有限公司 | Fusion protein expression purification method |
| WO2020043082A1 (en) * | 2018-08-28 | 2020-03-05 | Nanjing University | Protein nanopore for identifying an analyte |
| CN111164096A (en) * | 2019-09-29 | 2020-05-15 | 北京齐碳科技有限公司 | Mmup monomer variant and application thereof |
| WO2023030146A1 (en) * | 2021-08-30 | 2023-03-09 | 四川大学 | Polypeptide composition analysis method based on copper ion modified mspa nanopores |
| CN113735948A (en) * | 2021-09-28 | 2021-12-03 | 成都齐碳科技有限公司 | Mutant of porin monomer, protein pore and application thereof |
| WO2023050031A1 (en) * | 2021-09-28 | 2023-04-06 | 成都齐碳科技有限公司 | Mutant of porin monomer, protein pore and use thereof |
| CN113735948B (en) * | 2021-09-28 | 2024-02-02 | 成都齐碳科技有限公司 | Mutant of porin monomer, protein hole and application thereof |
| WO2023056960A1 (en) * | 2021-10-09 | 2023-04-13 | Nanjing University | Single molecule identification with a reactive hetero-nanopore |
| CN113754743A (en) * | 2021-10-12 | 2021-12-07 | 成都齐碳科技有限公司 | Mutant of porin monomer, protein pore and application thereof |
| WO2023060422A1 (en) * | 2021-10-12 | 2023-04-20 | 成都齐碳科技有限公司 | Mutant of porin monomer, protein pore and use thereof |
| CN113754743B (en) * | 2021-10-12 | 2024-02-02 | 成都齐碳科技有限公司 | Mutant of porin monomer, protein hole and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105801676B (en) | 2020-02-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105801676A (en) | Mutant MspA protein monomer and expressed gene and application thereof | |
| CN113480620B (en) | Mutant of porin monomer, protein hole and application thereof | |
| WO2020155242A1 (en) | Mutant nfpab nanopore, test system, manufacturing method therefor and use thereof | |
| Kremser et al. | Capillary electrophoresis of biological particles: viruses, bacteria, and eukaryotic cells | |
| ES2710204T3 (en) | Chromatography matrices that include new ligands based on protein A of Staphylococcus aureus | |
| ES2576114T3 (en) | MSP nanopores and related procedures | |
| US20220056517A1 (en) | Pore | |
| US20200399693A1 (en) | Nanopore assemblies and uses thereof | |
| CN102115493A (en) | Preparation method for recombinant protein G and application of same | |
| CN104730238A (en) | ELISA detection kit for detecting porcine epidemic diarrhea virus antibody and use method and application of ELISA kit | |
| CN101556287A (en) | Novel protein molecular weight standard and preparation method thereof | |
| Beard et al. | Detection of a protein, similar to the sex pilus subunit, in the outer membrane of Escherichia coli cells carrying a derepressed F-like R factor | |
| CN107207571A (en) | MSP nano-pores and application thereof | |
| Cassidy et al. | Purification of staphylococcal alpha-toxin by adsorption chromatography on glass | |
| US20230348863A1 (en) | Purification matrices comprising aav-binding polypeptides and methods of using the same | |
| Vykydalová et al. | Combination of micropreparative solution isoelectric focusing and high-performance liquid chromatography for differentiation of biofilm-positive and biofilm-negative Candida parapsilosis group from vascular catheter | |
| CN104031134B (en) | Vector protein for gene therapy as well as preparation method and application of vector protein | |
| CN114981450A (en) | Artificial nanopores and related uses and methods | |
| CN111413383A (en) | Method for constructing double-recognition-site nanopore | |
| Brzostek et al. | The OmpC protein of Yersinia enterocolitica: purification and properties | |
| Saxena et al. | Molecular cloning and functional characterization of the Paracoccus denitrificans porin | |
| Yu | A Journey to Full-Length Protein Sensing Technology: Enzyme-Free Protein Transport Through a Biological Nanopore on a Synthetic Polymer-Based Platform | |
| CN114940716B (en) | Recombinant mycobacteriophage tail protein GP89 and application thereof | |
| WO2023060418A1 (en) | Mutant of porin monomer, protein pore, and application thereof | |
| CN113735948B (en) | Mutant of porin monomer, protein hole and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |