CN105801675A - High-activity chitosanase controlling gene csn and method for producing high-activity chitosanase through gene - Google Patents

Abstract

The invention belongs to the technical field of bioengineering, and provides a high-activity chitosanase controlling gene csn and a method for producing the high-activity chitosanase through the gene.The high-activity chitosanase controlling gene csn comes from bacillus cereus of which the preservation number is CGMCC No.6129, a heterologous expression vector is constructed through the high-activity chitosanase controlling gene csn and transferred into Escherichia coli BL21 of a host, and experiments show that the high-activity chitosanase can be obtained by performing high-density fermentation through the Escherichia coli BL21, and the enzyme activity is 500,000 U/g or above; in addition, the production technology is simple, the controllability is high, and the method is suitable for industrialized production.

Description

A kind of High-activity chitosanase controls gene csn and the method utilizing this gene to produce High-activity chitosanase

Technical field

The invention belongs to technical field of bioengineering, it is provided that a kind of High-activity chitosanase controls gene csn and the method utilizing this gene to produce High-activity chitosanase.

Background technology

Chitin is to be only second to cellulosic second largest natural family macromolecule compound on the earth, is chitosan through deacetylation afterproduct.Chitosan contains free amine group, is unique alkaline polysaccharide in natural polysaccharide, but due to chitosan poorly water-soluble, it is difficult to play its due biological activity, greatly limit the range of application of chitosan.The catabolite oligochitosan of discovered in recent years chitosan has the physiological function of uniqueness, oligochitosan is connected by glycosidic bond by 2-20 monosaccharide, there is the advantage such as good water solubility, biologic activity strong (being more than ten times of equal quality chitosan), it is described as " the sixth-largest biological element " by scientific circles, in field of medicaments, field of food, agriculture field, filed of daily-use chemical industry, biological veterinary field and feed additive field, there is potential using value widely.Therefore, it is subject to the great attention of vast researcher about the research of oligochitosan and production, also achieves great successes.

The common production method of current oligochitosan has physical degradation methods and chemical degradation method.Physical degradation methods is sonication commonly, oligochitosan is prepared by ultrasonic degradation chitosan, course of reaction is gentle, can carry out at low temperatures, environmental pollution is less, but low-molecular-weight water-soluble products yield is very low in end product, add this method high cost, so physical degradation methods is difficult to industrial applications.The traditional method of current industrialized production oligochitosan is chemical degradation method, and namely Acid hydrolysis prepares oligochitosan, and chitosan is unstable under acidic condition, it may occur that the partial hydrolysis of long-chain, i.e. glycosidic bond fracture, forms the fragment that many relative molecular masses do not wait.Acid hydrolysis prepares a kind of method that oligochitosan is comparative maturity, is the method the earliest for industrialized production oligochitosan, and the technology of the method requires relatively low, and degradation speed is fast, and equipment, cost of material are relatively low, are especially suitable for industrialized production；But, the shortcomings such as it is loaded down with trivial details that the method exists aftertreatment technology, and environmental pollution is serious, in the oligochitosan product the most seriously prepared, contents of monosaccharides is high, and trimerization above oligosaccharide yield is low, molecular weight distribution width, and by-product is many, makes Product Safety endure query to the fullest extent.

Along with the development of biotechnology, chitosanase Hydrolyze method is applied to the preparation of oligochitosan gradually.Chitosanase is generally prepared by fermentable, is common in the metabolite of antibacterial and fungus.Chitosanase belongs to hydrolase, and with the β-Isosorbide-5-Nitrae glycosidic bond in inscribe model of action specificity hydrolyzing chitosan molecule, generating the degree of polymerization is the oligochitosan of 3-8.Oligochitosan is prepared with chitosanase Hydrolyze method, reaction condition is gentle, easily controllable, molecular weight of product is evenly distributed, and the oligosaccharide yield that the degree of polymerization is 3-8 reaches more than 90%, contents of monosaccharides is non-normally low, production process is without adding a large amount of chemical reagent, and environmental pollution is little, and without other by-product, ensure that Product Safety, be the oligochitosan production method of a kind of " green ".

Traditional chitosanase production method is to be obtained by nature wild mushroom natural fermentation, different strain fermentation condition, fermentation form differ, and wild mushroom fermentation condition is immature, existence product enzyme activity is low, produce enzyme cycle length, be difficult to purification process, difficulty realizes the shortcomings such as commercialization, directly limit enzyme hydrolysis method and prepare the industrial applications of oligochitosan technique, such as: Cheng Shiwei etc. screen on fresh shrimp surface and identify produces chitosanase bacterium clostridium perfringen, it produces the highest enzyme of chitosanase alive is 15.8U/mL；Wang Yanjun produces chitosanase bacterial strain penicillium equal to separating in mud sample and identifying, and its condition of enzyme production is optimized, fermentation culture 72h, and enzyme is lived and is up to 18U/mL.Progress along with science and technology, also scholar is had to attempt utilizing technique for gene engineering means to improve chitosanase vigor, as Yabuki.M etc. utilizes the chitosanase gene of bacillus acidocldarius to build recombination engineering, after high density fermentation, chitosanase enzyme is lived and is up to 1051U/mL, enzyme running water is flat improves several times, but the various bacterial strains of above-mentioned acquisition still can not meet industrial requirement.Therefore, high vigor chitosanase bacterial strain is produced in screening, and utilizes the animal nutrition of advanced person to update raising chitosanase vigor, is realize chitosanase Hydrolyze method to prepare the key of oligochitosan process industry.

Summary of the invention

The present invention is directed to the deficiency that above-mentioned technology exists, it is provided that a kind of High-activity chitosanase controls gene csn and the method utilizing this gene to produce High-activity chitosanase.High-activity chitosanase involved in the present invention controls gene csn and derives from the Bacillus cercus that preserving number is CGMCCNo.6129, inventor utilizes this High-activity chitosanase to control gene csn and builds heterologous expression vector, and proceed in host e. coli BL21 body, experiments show that and utilize this e. coli bl21 to carry out high density fermentation, active chitosan essence enzyme can be obtained, enzyme more than 500000U/g alive, and production technology is simple, controllability strong, is suitable to industrialized production.

Present invention firstly provides a kind of High-activity chitosanase and control gene csn, described High-activity chitosanase controls gene csn, and its nucleotide sequence is such as shown in SeqIDNo:1, and the aminoacid sequence of its coding is such as shown in SeqIDNo:2；Described High-activity chitosanase controls gene csn and derives from bacillus cereus JBSH-003, and this bacterial strain is CGMCCNo.6129 at the preserving number of China General Microbiological DSMZ.

The acquisition methods of this gene is as follows:

(1) the acquisition of genes of interest:

Design forward primer F:GCGCCATATGAAAATCAGTATGCAAAAAGC, its nucleotide sequence is such as shown in SeqIDNo:3, and downstream primer R:GCGCGAATTCTTATTTGATTACAAAATTACCGT, its nucleotide sequence is such as shown in SeqIDNo:4；With Bacillus cercus genomic DNA for template, under the effect of Taq DNA polymerase, carry out pcr amplification, carry out glue recovery after checking is correct and obtain genetic fragment, then this fragment and carrier are carried out blunt end cloning, build cloning vehicle；Being proceeded in bacillus coli DH 5 alpha body by physical method by cloning vehicle, and bacterium solution coated on the LB solid medium containing Ampicillin, 32 DEG C～37 DEG C, quiescent culture 10h, it is thus achieved that positive transformant, by positive transformant order-checking, comparison analysis；Result display genes of interest sequence contains 834 bases, and its nucleotide sequence, such as shown in SeqIDNo:1, encodes 277 aminoacid, and the aminoacid sequence of its coding is such as shown in SeqIDNo:2,

The cloning vehicle wherein adopted is selected from pMD-T series or pUC serial carrier；

After obtaining above-mentioned purpose gene, inventor utilizes this gene to proceed to conventional engineering bacteria to verify its function:

Genes of interest csn is extracted from positive transformant and through restricted enzyme NdeI and EcoRI double digestion 30min under 30～37 DEG C of water bath condition, utilize glue to reclaim test kit to be reclaimed by the gene csn after enzyme action, then it is connected with expression vector under T4DNA ligase effect, builds heterologous expression vector；Heterologous expression vector is proceeded in host e. coli BL21 body by Physical, bacterium solution is coated on the LB solid medium containing Kanamycin, 32 DEG C～37 DEG C, quiescent culture 10h, obtain positive transformant, the engineered strain of High-activity chitosanase must be produced；

Wherein building heterologous expression vector is the serial or pGEM serial carrier for pET adopted；

Except the host e. coli BL21 of above-mentioned employing, it is also possible to adopt other hosts, such as bacillus coli DH 5 alpha, bacillus subtilis, Salmonella, helicobacter pylori.

Inventor additionally provides High-activity chitosanase and controls the gene csn method producing High-activity chitosanase, comprises the following steps, for e. coli bl21:

(1) planting activation: on aseptic operating platform, take the engineering bacteria of production High-activity chitosanase of above-mentioned acquisition frozen for 1～5 μ l in the test tube containing LB fluid medium, 32 DEG C～37 DEG C, 130～180rpm cultivates 10h；

(2) Spawn preparation: on aseptic operating platform, the strain of activation is proceeded in the triangular flask containing sterilized liquid culture medium, this culture medium of subpackage 200ml in every triangular flask, test tube strains one triangular flask of inoculation of an activation, then 32 DEG C～37 DEG C, 130～180rpm cultivates 10h；

(3) inoculation fermentation tank: first fermentation tank tank body, pipeline, air filter are carried out sky and disappeared, 121 DEG C, sky disappears 30min, after temperature reduces, injects culture medium, and then culture medium carries out real disappearing, 121 DEG C, and disappear 30min in fact；Inoculate when temperature is down to 32 DEG C～37 DEG C；

(4) fermentation condition: inoculum concentration v/v5%～10%；Cultivation temperature 35 DEG C～37 DEG C；PH:7.0；Initial speed: 200rpm；Fermentation tank pressure: 0.05Mpa；Ventilation compares: 1:1；Feed supplement: concentration is the glycerol liquor mixture of 50vt%；Fermentation period: 45～50h；

(5) induction: as fermentation liquid OD₆₀₀When=40～60, add the derivant IPTG of final concentration of 0.1～0.4mmol/L, induce target gene csn great expression；

(6) beginning from addition derivant, every 2h samples once, and utilizes DNS method detection enzyme to live, and stops fermentation when enzyme continuous 4h alive no longer raises, and puts tank, it is thus achieved that zymocyte liquid；

(7) broken wall treatment: utilize high pressure homogenizer that zymocyte liquid is carried out thalline broken wall treatment, arranges between pressure 90～120Mpa, flow velocity 60L/h, by broken wall treatment, is discharged into outside born of the same parents by chitosanase substantial amounts of in somatic cells, it is thus achieved that chitosanase crude enzyme liquid.

Wherein the formula of culture medium described in step (2) and (3) is calculated as: 1.0～1.5 parts of peptones, 2.0～2.5 parts of yeast extracts, 0.4～0.6 part of glycerol, 0.2～0.3 part of dipotassium hydrogen phosphate, 1.0～1.3 parts of potassium dihydrogen phosphates, 93.8～95.4 parts of softening water；

The glycerol liquor mixture of 50vt% described in step (4) is the magnesium sulfate of 2% possibly together with g/v.

The thick enzyme of chitosanase of above-mentioned acquisition, the thick breaking cellular wall with enzyme rate of final chitosanase reaches 90%, and through DNS method enzyme activity determination, the work of its enzyme is 7000～9000U/ml.

In order to improve the quality of chitosanase further, inventor also discloses the refinement treatment to above-mentioned chitosanase crude enzyme liquid, to obtain active chitosan essence enzyme, specifically comprises the following steps that

(1) utilize centrifuge that acquisition crude enzyme liquid carries out solid-liquid separation, centrifugal rotational speed 4000rpm, centrifugal 10min, collect clear liquid；

(2) the clear liquid after being centrifuged is carried out microfiltration process by 0.22um micro-filtration membrane, remove thalline and molecule impurity further；Micro-filtrate is concentrated by ultrafiltration then through the ultrafilter membrane of 6000Dalton, concentration rate 1/5～1/10, collects liquid in ultrafiltration；

(3) in liquid in ultrafiltration, add the ethanol of the 95% of liquid long-pending 30%～50% in ultrafiltration, under room temperature, carry out precipitate with ethanol, centrifugal after precipitate with ethanol, collect precipitation, obtain wet solid enzyme；

(4) dry: the wet solid enzyme vacuum drying under 50 DEG C of conditions that will obtain, obtain active chitosan essence enzyme.Through DNS method enzyme activity determination, its enzyme is lived as more than 500000U/g.

Through calculating, the comprehensive recovery that whole technical process enzyme is lived is more than 75%, and gained purification High-activity chitosanase enzyme is lived and reached more than 500000U/g；It addition, gained High-activity chitosanase temperature and acid-base value wide accommodation, it is respectively provided with higher biological activity at 40 DEG C～65 DEG C, there is very strong the enzyme activity between pH value 4.5～6.5.

The chitosanase essence enzyme enzyme that the present invention obtains as from the foregoing is lived and is reached 500000U/g, and Bacillus cercus JBSH-003 fermentation is produced chitosanase essence enzyme enzyme running water and is put down as 25000U/g, therefore, the flat more former starting strain of the present invention final gained chitosanase essence enzyme enzyme running water improves more than 20 times；The engineering bacteria host that the present invention adopts preferably employs e. coli bl21, it is type strain, high density fermentation condition maturity, ferment maximum cell density relatively Bacillus cercus JBSH-003 high several times, additionally, the Escherichia coli fermentation cycle is 45～50h, and Bacillus cercus JBSH-003 fermentation period is 72～96h, therefore much lower than former starting strain on fermentation costs.

Compared with prior art, the present invention utilizes High-activity chitosanase to control gene csn and builds the engineering bacteria producing High-activity chitosanase, provide the production method utilizing this bacterial strain to carry out high density fermentation production High-activity chitosanase simultaneously, achieve following usefulness: (1) by the structure of expression vector, undertaken genes of interest csn transforming, recombinating, proceeding in host bacterial, carry out great expression at derivant inductive condition, expression is its decades of times in former starting strain body；(2) selecting e. coli bl21 to carry out as Host Strains building the engineered strain producing High-activity chitosanase, e. coli bl21 is type strain, high density fermentation condition maturity, and the product enzyme cycle is short, is widely used in industrial field of microorganism fermentation；(3) obtained High-activity chitosanase crude enzyme liquid enzyme activity is high, reaches 8000U/ml through DNS method enzyme activity determination, and before relatively, average level improves several times；(4) the method produces after the purified process of chitosan thick enzyme later stage and can obtain High-activity chitosanase essence enzyme, reach 500000U/g through DNS method enzyme activity determination, the technique simple realization the adopted requirement of merchandized handling；(5) the method obtains High-activity chitosanase, and enzyme activity is greatly improved, and can be applicable to enzyme hydrolysis method and produces the industrial applications of oligochitosan technique.

Accompanying drawing explanation

Fig. 1 is the electrophoresis result schematic diagram that active chitosan of the present invention controls gene csn.

Detailed description of the invention

The detailed description of the invention of form by the following examples, is described in further detail the foregoing of the present invention, but this should not being interpreted as, the scope of the above-mentioned theme of the present invention is only limitted to Examples below.All technology realized based on foregoing of the present invention belong to the scope of the present invention, except specified otherwise, all adopt conventional prior to complete in following embodiment.

The acquisition of embodiment 1 genes of interest

Design forward primer F:GCGCCATATGAAAATCAGTATGCAAAAAGC, its nucleotide sequence is such as shown in SeqIDNo:3, and downstream primer R:GCGCGAATTCTTATTTGATTACAAAATTACCGT, its nucleotide sequence is such as shown in SeqIDNo:4；With bacillus cereus genomic DNA for template, pcr amplification is carried out under the effect of Taq DNA polymerase, described bacillus cereus genomic DNA source is in bacillus cereus JBSH-003, and this bacterial strain is CGMCCNo.6129 at the preserving number of China General Microbiological DSMZ；

Adopt single factor experiment and orthogonal experiment, by changing in PCR amplification system the amount of primer that adds, the amount of genomic DNA and pcr amplification condition annealing temperature (TM), determine PCR amplification system and the condition of the best, to obtain single, enough amplified productions；Optimized, final amplification system and amplification condition are respectively in Table 1 and table 2:

Table 1.PCR amplification system (50 μ l)

Table 2.PCR amplification condition

Build cloning vehicle

Pcr amplification product is verified by Agarose horizontal electrophoresis, " agarose gel recovery test kit " is utilized to carry out genes of interest fragment recovery after checking is correct, the genetic fragment of acquisition is carried out blunt end cloning (linked system is in Table 3) with pMD19-Tvector at 16 DEG C, it is thus achieved that cloning vehicle.

Table 3. cloning vehicle linked system (10 μ l)

Cloning vehicle is proceeded in bacillus coli DH 5 alpha body, and bacterium solution is coated on the LB solid medium containing Ampicillin, 37 DEG C of quiescent culture 10h, it is thus achieved that positive transformant.And by positive transformant check order, comparison analysis, sequencing result shows, it is thus achieved that genes of interest sequence contain 834 bases, its nucleotide sequence, such as shown in SeqIDNo:1, encodes 277 aminoacid, and the aminoacid sequence of its coding is such as shown in SeqIDNo:2；This unnamed gene is csn the most at last.Electrophoresis detection result is as shown in Figure 1.

Embodiment 2 produces the engineered strain of High-activity chitosanase and builds

Selection e. coli bl21 is Host Strains, pET-30bvector and genes of interest csn is selected to be connected construction of expression vector, at 37 DEG C, double digestion is carried out first with restricted enzyme NdeI and EcoRI, pET-30bvector and csn is made to form identical sticky end, then utilize T4DNA ligase that the two is connected (linked system is in Table 4), connect overnight at 16 DEG C.

Table 4. expression vector linked system (10 μ l)

Connection product is proceeded in e. coli bl21 body, and bacterium solution is coated on the LB solid medium containing Kanamycin, 37 DEG C of quiescent culture 10h, it is thus achieved that positive transformant, namely produce the engineered strain of High-activity chitosanase.

Embodiment 3 high density fermentation obtains High-activity chitosanase

Carrying out high density fermentation using the engineered strain of the production High-activity chitosanase of embodiment 2 acquisition as strain, zymocyte liquid, after broken wall treatment, measures, through DNS enzyme activity determination method, the chitosan crude enzyme liquid enzyme obtained and lives.

Specific as follows:

(1) actication of culture: on aseptic operating platform, takes the engineered strain kind of 5 frozen for μ l production High-activity chitosanase in the test tube containing LB fluid medium, and 37 DEG C, 150rpm cultivates 10h.

(2) Spawn preparation: on aseptic operating platform, being proceeded to by the strain of activation in the triangular flask containing sterilized liquid culture medium, culture medium prescription is: 1.2 parts of peptones, 2.4 parts of yeast extracts, 0.4 part of glycerol, 0.23 part of dipotassium hydrogen phosphate, 1.25 parts of potassium dihydrogen phosphates, 94.52 parts of softening water, this culture medium of subpackage 200ml in every triangular flask, test tube strains one triangular flask of inoculation of one activation, then 37 DEG C, 150rpm cultivates 10h.

(3) inoculation fermentation tank: first fermentation tank tank body, pipeline, air filter are carried out sky and disappear, 121 DEG C, sky disappears 30min, after temperature reduces, injects culture medium, culture medium prescription is: 1.2 parts of peptones, 2.4 parts of yeast extracts, 0.4 part of glycerol, 0.23 part of dipotassium hydrogen phosphate, 1.25 parts of potassium dihydrogen phosphates, 94.52 parts of softening water.Then culture medium carries out real disappearing, and 121 DEG C, disappear 30min in fact.Inoculate when temperature is down to 37 DEG C.

(4) fermentation condition: inoculum concentration 5vt%；Cultivation temperature 37 DEG C；PH:7.0；Initial speed: 200rpm；Fermentation tank pressure: 0.05Mpa；Ventilation compares: 1:1；The glycerol liquor mixture (containing 2vt% magnesium sulfate) of feed supplement: 50vt%；

(5) induction: as fermentation liquid OD₆₀₀When about=60, add the derivant IPTG of final concentration of 0.2mmol/L, and cultivation temperature is controlled at 30 DEG C.

(6) putting tank: begin from adding derivant, within every 2 hours, sampling detection enzyme is lived, when enzyme live continue 4 little time no longer raise, now fermentation time is 45h, terminates fermentation and also puts tank.

(7) utilizing high pressure homogenizer that zymocyte liquid is carried out broken wall treatment, it is thus achieved that chitosan crude enzyme liquid, through DNS method enzyme activity determination, enzyme is lived as 8100U/ml.

Embodiment 4 high density fermentation obtains High-activity chitosanase

Carrying out high density fermentation using the engineered strain of the production High-activity chitosanase of embodiment 2 acquisition as strain, zymocyte liquid, after broken wall treatment, measures, through DNS enzyme activity determination method, the chitosan crude enzyme liquid enzyme obtained and lives.

Specific as follows:

(1) actication of culture: on aseptic operating platform, takes the engineered strain kind of 5 frozen for μ l production High-activity chitosanase in the test tube containing LB fluid medium, and 35 DEG C, 150rpm cultivates 10h.

(2) Spawn preparation: on aseptic operating platform, the strain of activation is proceeded in the triangular flask containing sterilized liquid culture medium, 1.4 parts of peptones, 2.0 parts of yeast extracts, 0.5 part of glycerol, 0.25 part of dipotassium hydrogen phosphate, 1.3 parts of potassium dihydrogen phosphates, 94.55 part softening water, this culture medium of subpackage 200ml in every triangular flask.Test tube strains one triangular flask of inoculation of one activation, then 35 DEG C, 150rpm cultivates 10h.

(3) inoculation fermentation tank: first fermentation tank tank body, pipeline, air filter are carried out sky and disappear, 121 DEG C, sky disappears 30min, after temperature reduces, injecting culture medium, culture medium prescription is: 1.4 parts of peptones, 2.0 parts of yeast extracts, 0.5 part of glycerol, 0.25 part of dipotassium hydrogen phosphate, 1.3 parts of potassium dihydrogen phosphates, 94.55 part softening water, then culture medium is carried out real disappearing, 121 DEG C, disappear 30min in fact, inoculates when temperature is down to 37 DEG C.

(4) fermentation condition: inoculum concentration 5.5vt%；Cultivation temperature 35 DEG C；PH:7.0；Initial speed: 200rpm；Fermentation tank pressure: 0.05Mpa；Ventilation compares: 1:1；The glycerol liquor mixture (containing 2vt% magnesium sulfate) of feed supplement: 50vt%；

(5) induction: as fermentation liquid OD₆₀₀When about=50, add the derivant IPTG of final concentration of 0.35mmol/L, and cultivation temperature is controlled at 28 DEG C.

(6) putting tank: begin from adding derivant, within every 2 hours, sampling detection enzyme is lived, when enzyme live continue 4 little time no longer raise, now fermentation time is 48h, terminates fermentation and also puts tank.

(7) utilizing high pressure homogenizer that zymocyte liquid is carried out broken wall treatment, it is thus achieved that chitosan crude enzyme liquid, through DNS method enzyme activity determination, enzyme is lived as 8350U/ml；

In order to improve the quality of chitosanase further, above-mentioned chitosanase crude enzyme liquid has been carried out refinement treatment by inventor, specifically comprises the following steps that

(1) utilize centrifuge that acquisition crude enzyme liquid carries out solid-liquid separation, centrifugal rotational speed 4000rpm, centrifugal 10min, collect clear liquid；

(2) the clear liquid after being centrifuged is carried out microfiltration process by 0.22um micro-filtration membrane, remove thalline and molecule impurity further；Micro-filtrate is concentrated by ultrafiltration then through the ultrafilter membrane of 6000Dalton, concentration rate 1/5-1/10, collects liquid in ultrafiltration；

(3) in liquid in ultrafiltration, add the ethanol of the 95% of liquid long-pending 30%～50% in ultrafiltration, under room temperature, carry out precipitate with ethanol, centrifugal after precipitate with ethanol, collect precipitation, obtain wet solid enzyme；

(4) dry: the wet solid enzyme vacuum drying under 50 DEG C of conditions that will obtain, obtain active chitosan essence enzyme.Through DNS method enzyme activity determination, its enzyme is lived as more than 500000U/g.

Embodiment 5. high density fermentation obtains High-activity chitosanase

Carrying out high density fermentation using the engineered strain of the production High-activity chitosanase of embodiment 2 acquisition as strain, zymocyte liquid, after broken wall treatment, measures, through DNS enzyme activity determination method, the chitosan crude enzyme liquid enzyme obtained and lives.

Specific as follows:

(1) actication of culture: on aseptic operating platform, takes the engineered strain kind of 5 frozen for μ l production High-activity chitosanase in the test tube containing LB fluid medium, and 32 DEG C, 150rpm cultivates 10h.

(2) Spawn preparation: on aseptic operating platform, the strain of activation is proceeded in the triangular flask containing sterilized liquid culture medium, 1.5 parts of peptones, 2.5 parts of yeast extracts, 0.6 part of glycerol, 0.3 part of dipotassium hydrogen phosphate, 1.3 parts of potassium dihydrogen phosphates, 93.8 parts of softening water, this culture medium of subpackage 200ml in every triangular flask, test tube strains one triangular flask of inoculation of one activation, then 32 DEG C, 150rpm cultivates 10h.

(3) inoculation fermentation tank: first fermentation tank tank body, pipeline, air filter are carried out sky and disappear, 121 DEG C, sky disappears 30min, after temperature reduces, injecting culture medium, culture medium prescription is: 1.5 parts of peptones, 2.5 parts of yeast extracts, 0.6 part of glycerol, 0.3 part of dipotassium hydrogen phosphate, 1.3 parts of potassium dihydrogen phosphates, 93.8 part softening water, then culture medium is carried out real disappearing, 121 DEG C, disappear 30min in fact, inoculates when temperature is down to 32 DEG C.

(4) fermentation condition: inoculum concentration 6vt%；Cultivation temperature 32 DEG C；PH:7.0；Initial speed: 200rpm；Fermentation tank pressure: 0.05Mpa；Ventilation compares: 1:1；The glycerol liquor mixture (containing 2vt% magnesium sulfate) of feed supplement: 50vt%；

(5) induction: as fermentation liquid OD₆₀₀When about=45, add the derivant IPTG of final concentration of 0.4mmol/L, and cultivation temperature is controlled at 28 DEG C.

(6) putting tank: make from adding derivant, within every 2 hours, sampling detection enzyme is lived, when enzyme live continue 4 little time no longer raise, now fermentation time is 50h, terminates fermentation and also puts tank.

(7) utilizing high pressure homogenizer that zymocyte liquid is carried out broken wall treatment, it is thus achieved that chitosan crude enzyme liquid, through DNS method enzyme activity determination, enzyme is lived as 7950U/ml.

Comparative example 1. produces the engineered strain of High-activity chitosanase and compares with the product chitosanase enzyme work of former starting strain and fermentation time

With the culture medium prescription in embodiment 3 and fermentation condition, engineered strain and the former starting strain-Bacillus cercus JBSH-003 of production High-activity chitosanase provided by the invention are carried out fermenting experiment, compare the two produced chitosanase enzyme and live and best fermentation period.

Specific as follows:

(1) actication of culture: on aseptic operating platform, takes the engineered strain kind of 5 frozen for μ l production High-activity chitosanase and Bacillus cercus JBSH-003 respectively in two test tubes containing LB fluid medium, and 37 DEG C, 150rpm cultivates 10h.

(2) Spawn preparation: on aseptic operating platform, being proceeded to by the strain of activation in the triangular flask containing sterilized liquid culture medium, culture medium prescription is: 1.2 parts of peptones, 2.4 parts of yeast extracts, 0.4 part of glycerol, 0.23 part of dipotassium hydrogen phosphate, 1.25 parts of potassium dihydrogen phosphates, 94.52 parts of softening water, this culture medium of subpackage 200ml in every triangular flask, test tube strains one triangular flask of inoculation of one activation, then 37 DEG C, 150rpm cultivates 10h.

(3) inoculation fermentation tank: first fermentation tank tank body, pipeline, air filter are carried out sky and disappear, 121 DEG C, sky disappears 30min, after temperature reduces, injecting culture medium, culture medium prescription is: 1.2 parts of peptones, 2.4 parts of yeast extracts, 0.4 part of glycerol, 0.23 part of dipotassium hydrogen phosphate, 1.25 parts of potassium dihydrogen phosphates, 94.52 part softening water, then culture medium is carried out real disappearing, 121 DEG C, disappear 30min in fact, inoculates when temperature is down to 37 DEG C.

(4) fermentation condition: inoculum concentration 5%；Cultivation temperature 37 DEG C；PH:7.0；Initial speed: 200rpm；Fermentation tank pressure: 0.05Mpa；Ventilation compares: 1:1；The glycerol liquor mixture (containing 2vt% magnesium sulfate) of 50vt%；

(5) induction: as the engineered strain fermentation liquid OD producing High-activity chitosanase₆₀₀When about=60, add the derivant IPTG of final concentration of 0.2mmol/L, and cultivation temperature is controlled at 30 DEG C.

(6) putting tank: from fermentation 42h, within every 2 hours, sampling detection enzyme is lived, when enzyme live continue 4 little time no longer raise, terminate fermentation and also put tank.Every sub-sampling is through high pressure homogenizer broken wall treatment, and it is alive to measure the thick enzyme enzyme of sample through DNS method.

Testing result is following table such as:

From upper table it appeared that, the engineered strain of production High-activity chitosanase provided by the invention is when fermenting 46h, gained chitosanase thick enzyme enzyme is lived and is reached maximum 8125U/mL, and Bacillus cercus JBSH-003 is when fermenting 72h, gained chitosanase thick enzyme enzyme is lived and is reached maximum 405U/mL, so it can be concluded that the engineered strain of production High-activity chitosanase that builds of a kind of High-activity chitosanase gene csn provided by the invention, the flat height of the chitosanase enzyme running water produced, fermentation period is short, and production technology is simple, controllability strong, is suitable to industrialized production.

Claims (5)

1. a High-activity chitosanase controls gene csn, it is characterised in that: described High-activity chitosanase controls gene csn, and its nucleotide sequence is such as shown in SeqIDNo:1, and the aminoacid sequence of its coding is such as shown in SeqIDNo:2.

2. High-activity chitosanase according to claim 1 controls gene csn, it is characterized in that: described High-activity chitosanase controls gene csn and derives from bacillus cereus JBSH-003, and this bacterial strain is CGMCCNo.6129 at the preserving number of China General Microbiological DSMZ.

3. utilize High-activity chitosanase described in claim 1 to control the gene csn method obtaining the engineering bacteria producing High-activity chitosanase, it is characterised in that: specifically comprise the following steps that

(1) the acquisition of genes of interest:

Design forward primer F:GCGCCATATGAAAATCAGTATGCAAAAAGC, its nucleotide sequence is such as shown in SeqIDNo:3, and downstream primer R:GCGCGAATTCTTATTTGATTACAAAATTACCGT, its nucleotide sequence is such as shown in SeqIDNo:4；With Bacillus cercus genomic DNA for template, under the effect of Taq DNA polymerase, carry out pcr amplification, carry out glue recovery after checking is correct and obtain genetic fragment, then this fragment and carrier are carried out blunt end cloning, build cloning vehicle；Being proceeded in bacillus coli DH 5 alpha body by physical method by cloning vehicle, and bacterium solution coated on the LB solid medium containing Ampicillin, 32 DEG C～37 DEG C, quiescent culture 10h, it is thus achieved that positive transformant, by positive transformant order-checking, comparison analysis；Result display genes of interest sequence contains 834 bases, and its nucleotide sequence, such as shown in SeqIDNo:1, encodes 277 aminoacid, and the aminoacid sequence of its coding is such as shown in SeqIDNo:2,

The cloning vehicle wherein adopted is selected from pMD-T series or pUC serial carrier；

(2) the engineered strain producing High-activity chitosanase builds: target gene csn is connected into carrier, builds heterologous expression vector, it is thus achieved that produce the engineered strain of High-activity chitosanase:

Genes of interest csn is extracted from positive transformant and through restricted enzyme NdeI and EcoRI double digestion 30min under 30～37 DEG C of water bath condition, utilize glue to reclaim test kit to be reclaimed by the gene csn after enzyme action, then it is connected with expression vector under T4DNA ligase effect, builds heterologous expression vector；Heterologous expression vector is proceeded in host by Physical, bacterium solution is coated on the LB solid medium containing Kanamycin, 32 DEG C～37 DEG C, quiescent culture 10h, it is thus achieved that positive transformant, the engineered strain of High-activity chitosanase must be produced；

Wherein building heterologous expression vector is the serial or pGEM serial carrier for pET adopted；

Described host is selected from e. coli bl21 or bacillus coli DH 5 alpha or bacillus subtilis or Salmonella or helicobacter pylori.

4. utilize High-activity chitosanase described in claim 1 to control the gene csn method producing High-activity chitosanase, it is characterised in that: comprise the following steps:

(1) actication of culture: on aseptic operating platform, takes the engineering bacteria of 1～5 frozen for μ l production High-activity chitosanase in the test tube containing LB fluid medium, and 32 DEG C～37 DEG C, 130～180rpm cultivates 10h；

(2) Spawn preparation: on aseptic operating platform, the strain of activation is proceeded in the triangular flask containing sterilized liquid culture medium, this culture medium of subpackage 200ml in every triangular flask, test tube strains one triangular flask of inoculation of an activation, then 32 DEG C～37 DEG C, 130～180rpm cultivates 10h；

(3) inoculation fermentation tank: first fermentation tank tank body, pipeline, air filter are carried out sky and disappeared, 121 DEG C, sky disappears 30min, after temperature reduces, injects culture medium, and then culture medium carries out real disappearing, 121 DEG C, and disappear 30min in fact；Inoculate when temperature is down to 32 DEG C～37 DEG C；

(4) fermentation condition: inoculum concentration v/v5%～10%；Cultivation temperature 35 DEG C～37 DEG C；PH:7.0；Initial speed: 200rpm；Fermentation tank pressure: 0.05Mpa；Ventilation compares: 1:1；Feed supplement: concentration is the glycerol liquor mixture of 50vt%；Fermentation period: 45～50h；

(5) induction: as fermentation liquid OD₆₀₀When=40～60, add the derivant IPTG of final concentration of 0.1～0.4mmol/L, induce target gene csn great expression；

(6) beginning from addition derivant, every 2h samples once, and utilizes DNS method detection enzyme to live, and stops fermentation when enzyme continuous 4h alive no longer raises, and puts tank, it is thus achieved that zymocyte liquid；

(7) broken wall treatment: utilize high pressure homogenizer that zymocyte liquid is carried out thalline broken wall treatment, arranges between pressure 90～120Mpa, flow velocity 60L/h, by broken wall treatment, is discharged into outside born of the same parents by chitosanase substantial amounts of in somatic cells, it is thus achieved that chitosanase crude enzyme liquid；

Wherein the formula of culture medium described in step (2) and (3) is calculated as: 1.0～1.5 parts of peptones, 2.0～2.5 parts of yeast extracts, 0.4～0.6 part of glycerol, 0.2～0.3 part of dipotassium hydrogen phosphate, 1.0～1.3 parts of potassium dihydrogen phosphates, 93.8～95.4 parts of softening water；

The glycerol liquor mixture of 50vt% described in step (4) is the magnesium sulfate of 2% possibly together with g/v.

5. method according to claim 4, it is characterised in that: the fine purification treatment process of described chitosanase crude enzyme liquid, specifically comprise the following steps that

(1) utilize centrifuge that acquisition crude enzyme liquid carries out solid-liquid separation, centrifugal rotational speed 4000rpm, centrifugal 10min, collect clear liquid；

(2) the clear liquid after being centrifuged is carried out microfiltration process by 0.22um micro-filtration membrane, remove thalline and molecule impurity further；Micro-filtrate is concentrated by ultrafiltration then through the ultrafilter membrane of 6000Dalton, concentration rate 1/5～1/10, collects liquid in ultrafiltration；

(3) in liquid in ultrafiltration, add the ethanol of the 95% of liquid long-pending 30%～50% in ultrafiltration, under room temperature, carry out precipitate with ethanol, centrifugal after precipitate with ethanol, collect precipitation, obtain wet solid enzyme；

(4) dry: the wet solid enzyme vacuum drying under 50 DEG C of conditions that will obtain, obtain active chitosan essence enzyme.