CN105784658B - A kind of method of quick detection tumour correlation small peptide MUC1 - Google Patents
A kind of method of quick detection tumour correlation small peptide MUC1 Download PDFInfo
- Publication number
- CN105784658B CN105784658B CN201610184950.3A CN201610184950A CN105784658B CN 105784658 B CN105784658 B CN 105784658B CN 201610184950 A CN201610184950 A CN 201610184950A CN 105784658 B CN105784658 B CN 105784658B
- Authority
- CN
- China
- Prior art keywords
- small peptide
- probe
- hair fastener
- concentration
- detection
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N21/00—Investigating or analysing materials by the use of optical means, i.e. using sub-millimetre waves, infrared, visible or ultraviolet light
- G01N21/62—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light
- G01N21/63—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light optically excited
- G01N21/64—Fluorescence; Phosphorescence
- G01N21/6428—Measuring fluorescence of fluorescent products of reactions or of fluorochrome labelled reactive substances, e.g. measuring quenching effects, using measuring "optrodes"
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N21/00—Investigating or analysing materials by the use of optical means, i.e. using sub-millimetre waves, infrared, visible or ultraviolet light
- G01N21/62—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light
- G01N21/63—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light optically excited
- G01N21/64—Fluorescence; Phosphorescence
- G01N21/6428—Measuring fluorescence of fluorescent products of reactions or of fluorochrome labelled reactive substances, e.g. measuring quenching effects, using measuring "optrodes"
- G01N2021/6432—Quenching
Landscapes
- Health & Medical Sciences (AREA)
- Immunology (AREA)
- Chemical & Material Sciences (AREA)
- Physics & Mathematics (AREA)
- Analytical Chemistry (AREA)
- Optics & Photonics (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- General Physics & Mathematics (AREA)
- Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Investigating Or Analysing Materials By The Use Of Chemical Reactions (AREA)
- Investigating Or Analysing Biological Materials (AREA)
Abstract
This patent discloses the methods of quickly detection tumour correlation small peptide MUC1 a kind of, are related to fluorescence probe detection technique field.The characteristics of using aptamers and target small peptide specific recognition, specific adaptation body sequence is designed, to achieve the purpose that object specific recognition；By combining the hybridization reaction of two kinds of hairpin structure probes to complete the strategy of signal amplification, to realize the Sensitive Detection of target small peptide.This method includes four steps such as probe initial denaturation-hybrid reaction-background quenching-fluorescence detection, easy to operate quick, time saving and energy saving, provides a kind of new method for the detection of tumour correlation small peptide MUC1.
Description
Technical field
The present invention relates to fluorescence probe detection technique fields, and more specifically one kind is with aptamers specific recognition and two
The fluorescence detection small peptide method that the mode of kind hair fastener probe hybridization reaction amplification constructs.
Background technique
Gradually high trend was presented in national cancer morbidity and the death rate in recent years, therefore found quick, quantitative, clever
The method of quick detection tumor marker is extremely important in early detection and treatment monitoring.Cancer-associated tumor marker at present
Mainly there are enzyme, hormone, antigen, small peptide and microRNA etc..Small peptide is as the product after the hydrolysis of human body internal protein in amino acid
Digestion, absorb etc. play an important role.After human body cell generates canceration, cancer cell metabolism and normal cell
Very big difference is had, cancer cell can also generate small peptide substance, thus by the contents level of detection small peptide, people being capable of energy
Discovery cancerous tumor cell in time, to achieve the purpose that disease early warning.
Small peptide MUC1, is called CA15-3, participate in signal transmission and regulation immune cell growth in terms of have
Important function.MUC1 has expression in most people adenocarcinoid, and the serum cancer mark quality testing being still commercialized
Antigen in survey method.The MUC1 of tumor tissues can generate abnormality in cancer cell surfaces, that is, glycosylate relative to normal cell not
Completely.Since MUC1 specificity is higher than general antigen, sensibility is higher than carcinomebryonic antigen, thus by as cancer in terms of cancer detection
Disease marker is applied.
In order to solve the problems, such as that small peptide also can be carried out detection at low concentrations, small peptide identification and signal amplification strategy become outstanding
It is important.However, the method for detecting small peptide at present, such as enzyme linked immunosorbent assay (ELISA), the surface plasma resonance without label, liquid
Phase chromatography-mass spectroscopy and the method for electrochemical analysis although sensitivity and specificity with higher, but require a series of
Fixation, separation and cleaning step, it is time-consuming, laborious.Therefore developing one kind can specific recognition and low concentration
The method of small peptide is of great significance.It is anti-that the characteristics of adaptation physical efficiency is specifically bound with target molecule and hair fastener probe hybridize chain type
The advantage of amplified signal is answered just to can solve the above problem, and easy to operate, time saving and energy saving.
Summary of the invention
The technical problem to be solved by the present invention is to construct a kind of specific recognition small peptide MUC1 and be able to achieve follow-up signal
The small peptide detection method of amplification.
A kind of method of quick detection tumour correlation small peptide MUC1, it is characterized in that the following steps are included:
(1) probe initial denaturation
Firstly, the hair fastener probe 1 and hair fastener probe 2 and aptamers, English name of Fluoresceincarboxylic acid FAM label are
Aptamer is incubated for 0.5 h respectively at 95 oC；These three solution are placed into 1 h at room temperature；
(2) hybrid reaction
The overall reaction mixeding liquid volume that following steps carry out is 200 μ L, and Mucin1 and the concentration of various concentration are
The aptamers that the hair fastener probe 2 and concentration that the hair fastener probe 1 of 10-50 nM, concentration are 10-50 nM are 5-10 nM are mixed in slow
It rushes in solution, mixed solution reacts 1 h at 25 oC；
The ingredient of buffer solution is the sodium chloride that concentration is 0.75 M and the disodium hydrogen phosphate of 50 mM, pH value 7.4；
(3) background quenches
Concentration is added for 0.5 mg/mL graphene oxide solution, under 25oC to mixed solution obtained in (2) described step
It is incubated for 0.5 h；
(4) fluorescence detection
The experiment parameter of fluorescence detection is as follows: excitation wavelength is 480 nm, and launch wavelength range is 500-650 nm.
Beneficial effects of the present invention
(1) using adaptation body technique, it can be realized the specific recognition of object small peptide MUC1；
(2) using the cross chain reaction between hair fastener probe 1 and hair fastener probe 2, realize that fluorescence signal quickly amplifies；
(3) the method for the invention is easy to operate, rapid reaction.
Detailed description of the invention
Fig. 1 is the experimental principle figure of methods described herein.
Specific embodiment
For a better understanding of the present invention, below with reference to the embodiment and attached drawing content that the present invention is furture elucidated, but this
The content of invention is not limited solely to following implementation.
Embodiment 1
A kind of method of quick detection tumour correlation small peptide MUC1, it is characterized in that the following steps are included:
(1) probe initial denaturation
Firstly, the hair fastener probe 1 and hair fastener probe 2 and aptamers, English name of Fluoresceincarboxylic acid FAM label are
Aptamer is incubated for 0.5 h respectively at 95 oC；These three solution are placed into 1 h at 25oC；
(2) hybrid reaction
The overall reaction mixeding liquid volume that following steps carry out is 200 μ L, and the Mucin1 and concentration of various concentration are 10
The aptamers that the hair fastener probe 2 and concentration that the hair fastener probe 1 of nM, concentration are 10 nM are 10 nM are mixed in buffer solution, are mixed
It closes solution and reacts 0.5 h at 25 oC；
The ingredient of buffer solution is the sodium chloride that concentration is 0.75 M and the disodium hydrogen phosphate of 50 mM, pH value 7.4；
(3) background quenches
It is 0.5 mg/mL graphene oxide solution that concentration, which is added, to mixed solution obtained in (2) described step, at room temperature
It is incubated for 0.5 h；
(4) fluorescence detection
The experiment parameter of fluorescence detection is as follows: excitation wavelength is 480 nm, and launch wavelength range is 500-650 nm.
Embodiment 2
Detecting step is a difference in that with example 1: 1 concentration of hair fastener probe is 50 nM in step 2, and 2 concentration of hair fastener probe is
50 nM, sequence be 1 h in the reaction time.
SEQUENCE LISTING
<110>University Of Ji'nan
<120>a kind of method of quickly detection tumour correlation small peptide MUC1
<130> 2016
<160> 3
<170> PatentIn version 3.3
<210> 1
<211> 69
<212> DNA
<213>artificial sequence
<400> 1
tgaggtagta ggttgtatag ttgcagttga tcctttggat accctggaac tatacaacct 60
actacctca 69
<210> 2
<211> 44
<212> DNA
<213>artificial sequence
<400> 2
agtaggttgt atagttcaaa gtaactatac aacctactac ctca 44
<210> 3
<211> 44
<212> DNA
<213>artificial sequence
<400> 3
actttgaact atacaaccta cttgaggtag taggttgtat agtt 44
Claims (1)
1. a kind of application of aptamers sequence in preparation small peptide MUC1 quick detection reagent, it is characterized in that the following steps are included:
(1) probe initial denaturation
Firstly, hair fastener probe 1, the hair fastener probe 2 of Fluoresceincarboxylic acid FAM label, aptamers are incubated for 0.5 h respectively at 95 oC；
These three solution are placed into 1 h at room temperature；The wherein hair fastener probe 1 of Fluoresceincarboxylic acid FAM label, sequence AGTAG
GTTGTATAGTTCAAAGTAACTATACAACCTACTACCTCA；The hair fastener probe 2 of Fluoresceincarboxylic acid FAM label, sequence A
CTTTGAACTATACAACCTACTTGAGGTAGTAGGTTGTATAGTT；Aptamers, English name aptamer, sequence T
GAGGTAGTAGGTTGTATAGTTGCAGTTGATCCTTTGGATACCCTGGAACTATACAACCTACTACCTCA；
(2) hybrid reaction
The overall reaction mixeding liquid volume that following steps carry out is 200 μ L, the Mucin1 of various concentration and certain density hair
The aptamers that card probe 1 and hair fastener probe 2 and concentration are 5 nM are mixed in buffer solution, and mixed solution is anti-at 25 oC
Answer 1 h；
The ingredient of buffer solution is the sodium chloride that concentration is 0.75 M and the disodium hydrogen phosphate of 50 mM, pH value 7.4；
(3) background quenches
It is 0.5 mg/mL graphene oxide solution that concentration, which is added, to mixed solution obtained in the step (2), at room temperature
It is incubated for 0.5 h；
(4) fluorescence detection
The experiment parameter of fluorescence detection is as follows: excitation wavelength is 480 nm, and launch wavelength range is 500-650 nm.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610184950.3A CN105784658B (en) | 2016-03-29 | 2016-03-29 | A kind of method of quick detection tumour correlation small peptide MUC1 |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610184950.3A CN105784658B (en) | 2016-03-29 | 2016-03-29 | A kind of method of quick detection tumour correlation small peptide MUC1 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105784658A CN105784658A (en) | 2016-07-20 |
| CN105784658B true CN105784658B (en) | 2019-02-15 |
Family
ID=56392261
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610184950.3A Expired - Fee Related CN105784658B (en) | 2016-03-29 | 2016-03-29 | A kind of method of quick detection tumour correlation small peptide MUC1 |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105784658B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107245488B (en) * | 2017-06-07 | 2021-01-08 | 中山火炬职业技术学院 | Test strip and method for detecting aflatoxin B1 |
| WO2019144389A1 (en) * | 2018-01-26 | 2019-08-01 | National Institute Of Biological Sciences, Beijing | Hybridization chain reaction-based method for amplifying immunosignals |
| CN110734960B (en) * | 2019-09-19 | 2023-03-14 | 中国科学院苏州生物医学工程技术研究所 | Trace MUC1 fluorescence detection method based on chain type hybridization reaction and fluorescent carbon quantum dots |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102703594A (en) * | 2012-06-12 | 2012-10-03 | 华南师范大学 | Method for detecting miRNA (micro ribonucleic acid) based on graphene/nucleic acid dye platform |
| CN104007152A (en) * | 2014-06-18 | 2014-08-27 | 青岛科技大学 | DNA determining electrochemical sensor and method based on platinum nano particle catalysis electrochemistry circulation signal amplification technology |
| CN104020198A (en) * | 2014-06-18 | 2014-09-03 | 青岛科技大学 | Method for detecting DNA by electrochemical transducer with signal amplification technology |
| CN104764790A (en) * | 2015-03-26 | 2015-07-08 | 济南大学 | Biosensor for detecting streptomycin based on aptamer and preparation method of biosensor |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CA2767521A1 (en) * | 2009-07-10 | 2011-01-13 | Perkinelmer Health Sciences, Inc. | Detecting multinucleotide repeats |
-
2016
- 2016-03-29 CN CN201610184950.3A patent/CN105784658B/en not_active Expired - Fee Related
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102703594A (en) * | 2012-06-12 | 2012-10-03 | 华南师范大学 | Method for detecting miRNA (micro ribonucleic acid) based on graphene/nucleic acid dye platform |
| CN104007152A (en) * | 2014-06-18 | 2014-08-27 | 青岛科技大学 | DNA determining electrochemical sensor and method based on platinum nano particle catalysis electrochemistry circulation signal amplification technology |
| CN104020198A (en) * | 2014-06-18 | 2014-09-03 | 青岛科技大学 | Method for detecting DNA by electrochemical transducer with signal amplification technology |
| CN104764790A (en) * | 2015-03-26 | 2015-07-08 | 济南大学 | Biosensor for detecting streptomycin based on aptamer and preparation method of biosensor |
Non-Patent Citations (3)
| Title |
|---|
| A hairpin aptamer-based electrochemical biosensing platform for the sensitive detection of proteins;Zai-Sheng Wu 等;《Biomaterials》;20090228;第30卷;第2950–2955页 |
| Electrochemical immunoassay for the protein biomarker mucin 1 and for MCF-7 cancer cells based on signal enhancement by silver nanoclusters;Qingjun Guo 等;《Microchim Acta》;20150325;第182卷;第1483–1489页 |
| Immobilization of redox-labeled hairpin DNA aptamers on gold: Electrochemicalquantitation of epithelial tumor marker mucin 1;Fen Ma 等;《Electrochimica Acta》;20130226;第110卷;第139–145页 |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105784658A (en) | 2016-07-20 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Rani et al. | Milk miRNAs encapsulated in exosomes are stable to human digestion and permeable to intestinal barrier in vitro | |
| Zhang et al. | Molecular elucidation of disease biomarkers at the interface of chemistry and biology | |
| Chandrasekar et al. | Catalytic DNA with phosphatase activity | |
| Rai et al. | Proteomic profiling of human uterine extracellular vesicles reveal dynamic regulation of key players of embryo implantation and fertility during menstrual cycle | |
| CN105784658B (en) | A kind of method of quick detection tumour correlation small peptide MUC1 | |
| Wang et al. | Exosomes carrying ALDOA and ALDH3A1 from irradiated lung cancer cells enhance migration and invasion of recipients by accelerating glycolysis | |
| CN110964785B (en) | Nucleic acid analysis method based on constant-temperature cross-catalyzed nuclease reaction | |
| Liu et al. | Multiplexed analysis of small extracellular vesicle-derived mRNAs by droplet digital PCR and machine learning improves breast cancer diagnosis | |
| Rajagopalan et al. | The Stress-response protein prostate-associated gene 4, interacts with c-Jun and potentiates its transactivation | |
| Zhou et al. | Target-initiated autonomous synthesis of metal-ion dependent DNAzymes for label-free and amplified fluorescence detection of kanamycin in milk samples | |
| KR101535709B1 (en) | Method for Dectecting of Target Molecules Using PNA Aptamers | |
| Wang et al. | Immunomagnetic antibody plus aptamer pseudo-DNA nanocatenane followed by rolling circle amplication for highly-sensitive CTC detection | |
| CN109055498A (en) | MiRNA and/or biological micromolecule detection probe, detection method and kit based on the dendritic rolling ring responsive transcription of hypertree | |
| CN106248941B (en) | A kind of method of Sensitive Detection small peptide MUC1 | |
| Bing et al. | Aptameric probe specifically binding protein heterodimer rather than monomers | |
| CN111172235B (en) | Biosensor for detecting cathepsin B and detection method and application thereof | |
| Wang et al. | Template-free multiple signal amplification for highly sensitive detection of cancer cell-derived exosomes | |
| Jesus et al. | Ultrasonic-based membrane aided sample preparation of urine proteomes | |
| CN115057924B (en) | Specific IgY antibody for resisting HPV virus and preparation method and application thereof | |
| Modh et al. | Specific detection of tetanus toxoid using an aptamer-based matrix | |
| Chen et al. | Target-triggered stochastic DNAzyme motors on spherical nucleic acids for simultaneous fluorescence assay of double miRNAs | |
| Li et al. | Live imaging of cell membrane-localized MT1-MMP activity on a microfluidic chip | |
| CN107142332A (en) | A kind of enzyme DNA machines are used for the method that miRNA is detected | |
| Mei et al. | Mitochondrial adaptations during myocardial hypertrophy induced by abdominal aortic constriction | |
| Chen et al. | High-fidelity imaging of intracellular microRNA via a bioorthogonal nanoprobe |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20190215 Termination date: 20210329 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |