CN105779601A - Drug metabolic enzyme related gene SNP fluorescence labeling composite amplification kit - Google Patents
Drug metabolic enzyme related gene SNP fluorescence labeling composite amplification kit Download PDFInfo
- Publication number
- CN105779601A CN105779601A CN201610214241.5A CN201610214241A CN105779601A CN 105779601 A CN105779601 A CN 105779601A CN 201610214241 A CN201610214241 A CN 201610214241A CN 105779601 A CN105779601 A CN 105779601A
- Authority
- CN
- China
- Prior art keywords
- primer
- site
- gene
- seqidno
- related gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/136—Screening for pharmacological compounds
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Pathology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a drug metabolic enzyme related gene SNP fluorescence labeling composite amplification kit. The kit comprises a mixture of specificity non-labeled primers and share labeled primers of five SNP loci, performs detection by combining PCR composite amplification with a capillary electrophoresis technology and can simultaneously detect genotypes of the five SNP loci of a drug metabolic enzyme related gene in a single tube within 3 hours. By applying the kit, the drug metabolic enzyme related gene is detected, the relation of the adverse drug reaction and genetic variation is researched, and a theoretical support is provided for rational drug use.
Description
Technical field
The invention belongs in vitro diagnostic techniques field, be specifically related to a kind of drug metabolism enzyme related gene SNP fluorescence labeling composite amplification test kit and using method thereof.
Background technology
Cytochrome P 450 enzymes (cytochromeP450, CYP), also known as drug metabolism enzyme, it is primarily present in hepatomicrosome, exogenous compounds (including medicine and poisonous substance) and the bioconversion of endogenous material play a very important role, its activity determines the metabolic rate of medicine, has direct relation with the clearance rate of medicine, is the phasel enzyme of drug metabolism.The gene of P450 enzyme system mainly has tri-families of CYP1, CYP2, CYP3, wherein CYP1A2, CYP2C9, CYP2C19, CYP2D6, CYP3A4 and CYP2E1 are topmost hypotypes, content accounts in liver more than the 80% of CYP450 total amount, and 90% is above by these 6 kinds of hypotype metabolism in the medicine of liver metabolism.
Affect a lot of because have of drug metabolism enzymatic activity, such as the environmental factors such as food and environmental poisonous substance；The Physiological factors such as age and sex；Pathologic factor and the inherited genetic factorss such as liver, kidney or heart disease.Most important of which is that inherited genetic factors, owing to gene mutation makes the expression of pheron change, thus have impact on enzymatic activity, it is possible to make enzyme deactivation, enzymatic activity reduces or enzymatic activity strengthens.According to individuality, crowd is divided into by the difference of medicament metabolism ability: four kinds of types such as ultra-rapid metabolism (UM), fast metabolism (EM), medium metabolic (IM), slow metabolism (PM).CYP450 enzyme gene pleiomorphism is to produce poisonous side effect of medicine, reduction or lose the one of the main reasons of curative effect of medication, wherein CYP2C9, CYP2C19, CYP2D6 and CYP3A4 have obvious genetic polymorphism, drug metabolism plays a significant role, relates to the multiple medications such as gastrointestinal disease, cardiovascular drugs, anti-inflammation analgesia medicine, antidepressants, psychosis, anticonvulsant.Add up according to World Health Organization: in the Died Patients of the whole world, 1/3 is die from non-rational use of drug, but not dies from nature disease itself；The data at China's health ministry adverse drug reaction supervision center are: in inpatient, there are about 200,000 people every year and die from adverse effect.Therefore, guidance and the adjustment of clinical application scheme can be carried out by CYP450 genotype detection, provide foundation, prophylactic agent untoward reaction etc. for clinical individual medication.
The detection technique being presently used for CYP450 enzyme related gene polymorphism site focuses primarily upon fluorescence quantitative PCR method, sequencing and SnaPshot detection method (Single base extension) etc..The disadvantage that wherein fluorescence quantitative PCR method and sequencing exist is false negative and false-positive appearance, and is both needed to loci and detects one by one, the complicated operation when site is more, costly.SnaPshot detection method there is also following deficiency: the digestive enzyme such as partial purification is expensive, and complex operation step, workload are big, and it is low etc. that PBR exists the site detection success rate of unknown mutation.Such as: Chinese Patent Application No. 200810208219.5, " detection of a kind of drug metabolism associated SNP positions ", it relates to fluorescence quantitative PCR method, and 5 SNP for 4 P450 enzyme related genes detect.5 reactions need to be carried out simultaneously and just can draw the genotype of 5 SNP site, and the method exist synthesising probing needle cost high, can not the shortcoming such as Multiple detection.Chinese Patent Application No. 201310433222.8, " a kind of test kit detecting CYP3A4 gene pleiomorphism and method ", be specifically related to gene sequencing technology, though the method only needs a pcr amplification, but sequencing steps length loaded down with trivial details, consuming time.Chinese Patent Application No. 20130137910.X, " for detecting primer system in gene polymorphic site relevant for human-cytochrome P450 and application thereof ", it relates to multiple PCR technique and Single base extension technology, in a reaction system, heterogeneic 7 gene polymorphic sites, place can be detected simultaneously, but the method exists the required shortcomings such as reagent is expensive, operating process is complicated.Therefore, it is presently required the detection technique that a kind of difference is conventional, multiple SNP site for same individuality can be used for quickly detecting in same system, provide reference frame by the detection information of this technology for rational use of drug.
The principle of ARMS technology is sudden change place two primers of design DNA sequence one section, mutational site is positioned at 3 ' ends of primer, one corresponding to normal allele aligning primer, one corresponding to mutant gene sequence primer, a general primer is designed again, thus mutant gene being detected with PCR at the DNA other end.The combination of ARMS-PCR and fluorescence gel electrophoretic techniques has many detection advantages, for instance: detection site quantity is many, highly sensitive, good stability, economical and efficient, consuming time short and flux is high.Through the retrieval of prior art document is found, the report that CYP450 related gene polymorphism is detected by not yet useful the method.
nullAccording to China (or asian ancestry) crowd, there is the principle that of a relatively high incidence rate is known with the changes of function that sudden change causes herein，Have selected wherein CYP2C9 (rs1057910)、CYP2C19(rs4244285、rs4986893)、CYP2D6(rs1065852)、5 pleomorphism sites of CYP3A4 (rs28371759) four genes are as object of study，Want to set up a PCR fluorescent composite amplification system，And develop the fluorescent composite amplification reagent kit of drug metabolism enzyme related gene on this basis，And in existing detection technique，Detection for rs4244285 site concentrates on two allele of A/G entirely，The present invention designs three primers altogether according to tri-allele of A/G/C in the rs4244285 site that NCBI net is announced，Five kinds of mutation types except wild type can be detected.
Summary of the invention
For above-mentioned technical problem, it is an object of the invention to provide a kind of high specificity, the fluorescence labeling composite amplification test kit of the drug metabolism enzyme related gene SNP site that highly sensitive, flux is high, highly reliable, cost is low and easy and simple to handle.By setting up the detection technique platform of drug metabolism enzyme related gene, carry out the detection of medicine related gene, fundamentally solve the unreasonable administering mode of " thousand people one medicines, thousand people one amounts ", provide theories integration for rational use of drug.
The present invention have selected China (or asian ancestry) crowd and has 5 SNP site of of a relatively high incidence rate as object of study, adopt dichromatism fluorescent labelling techniques, specificity fluorescent primer amplification combined with fluorescent detected through gel electrophoresis, with FAM, SIZ fluorescence signal for detection signal.By heredity sequenator the collection of fluorescence signal detected the sudden change of specific SNP site, it is intended to set up the detection method of a kind of quick, efficient, reliable single nucleotide mutation.
Technical scheme is as follows:
A kind of drug metabolism enzyme related gene SNP fluorescence labeling composite amplification test kit, includes composite amplification primer and the allele genotype standard substance thereof of 5 gene polymorphism sites for expanding；
Described 5 gene polymorphism sites include: CYP2C9 gene rs1057910 site (CYP2C9*3), CYP2C19 gene rs4244285 site (CYP2C19*2), CYP2C19 gene rs4986893 site (CYP2C19*3), CYP2D6 gene rs1065852 site (CYP2D6*10), CYP3A4 gene rs28371759 site (CYP3A4*18).
Preferably, the primer sequence of the composite amplification primer of described 5 gene polymorphism sites is respectively as follows: rs1057910, reverse general primer, SEQIDNO.1, forward primer, SEQIDNO.2-3；Rs4244285, reverse general primer, SEQIDNO.4, forward primer, SEQIDNO5-7；Rs4986893, reverse general primer, SEQIDNO.8, forward primer, SEQIDNO.9-10；Rs1065852, reverse general primer, SEQIDNO.11, forward primer, SEQIDNO.12-13；Rs28371759, reverse general primer, SEQIDNO.14, forward primer, SEQIDNO.15-16.
Preferably, the composite amplification primer of described 5 gene polymorphism sites final concentration in amplification system is as follows:
| SEQ ID NO. | Concentration (μM) | SEQ ID NO. | Concentration (μM) |
| 1 | 0.1 | 9 | 0.04 2 --> |
| 2 | 0.06 | 10 | 0.1 |
| 3 | 0.16 | 11 | 0.06 |
| 4 | 0.04 | 12 | 0.04 |
| 5 | 0.04 | 13 | 0.08 |
| 6 | 0.06 | 14 | 0.04 |
| 7 | 0.12 | 15 | 0.02 |
| 8 | 0.08 | 16 | 0.06 |
Preferably, described drug metabolism enzyme related gene SNP fluorescence labeling composite amplification test kit also includes ReactionMix, thermal starting Taq DNA polymerase, composite primer, sdH2O；Described ReactionMix is MgCl22.5mM, Tris-HClbuffer125mM, KCl80mM, dNTPs7.5mM, BSA1.5mg/ml.
Preferably, described reverse general primer has fluorescent labeling.
Preferably, described reverse general primer can be FAM, HEX, TAMRA or ROX labelling.
The using method of a kind of drug metabolism enzyme related gene SNP fluorescence labeling composite amplification test kit, comprises the steps:
Step A, extracts genomic DNA, as DNA profiling from biological material；Or directly block for template with blood filter paper or saliva, it is not necessary to extract；
Step B, prepares PCR reactant liquor, adds ReactionMix, thermal starting Taq DNA polymerase, composite primer, sdH2O and DNA profiling, adopts three step TRAP, polymorphic SNP site to be detected is carried out pcr amplification；
Step C, carries out fluorescence gel electrophoretic analysis and gene type to amplified production.
Preferably, the execution program of described pcr amplification includes: a, denaturation, 95 DEG C of 5min；B, thermal cycle, 94 DEG C of 30s, 60 DEG C of 1min；Totally 30 circulations；C, eventually extension, 60 DEG C of 15min；D, insulation, 4 DEG C.
Preferably, described biological material includes one or more in blood, hair, saliva, seminal stain, exfoliative cyte or skeleton.
The invention has the beneficial effects as follows:
1, the detection method step of the present invention is simple, the approach application combined with capillary electrophoresis technique by fluorescence labeling composite amplification first is in the abrupt climatic change of drug metabolism enzyme gene, greatly improve detection speed and efficiency, the needs of special compound practical application；
2, the testing result accuracy of the present invention is strong, highly sensitive, non-specific amplification product, primer dimer can be separated with specific amplification products, at utmost reduce false positive；
3, the present invention is through great many of experiments, repeatedly verify, obtains the primer concentration proportioning of optimum combination；
4, the strong adaptability of sample required for the present invention, can be expanded preferably such as blood, hair, saliva, seminal stain, exfoliative cyte and skeleton etc.；
5, instant invention overcomes the defect that conventional art one-time detection SNP site is very few, with low cost, and two kinds of mutation types can be detected for rs4244285 site；
6, medicine associated metabolic enzyme gene is detected and studies by the test kit applying the present invention, sets up related gene data base, drugs untoward reaction and the relation of genovariation, provides theories integration for rational use of drug.
Accompanying drawing explanation
Fig. 1 is the electrophoretogram of the genotype standard substance of the present invention；
Fig. 2 is the pleomorphism site correspondence design of primers schematic diagram of the present invention；
Fig. 3 a is the electrophoretogram before the wild primers change of rs4986893 site of the present invention；
Fig. 3 b is the electrophoretogram after the wild primers change of rs4986893 site of the present invention；
Fig. 4 a is the electrophoretogram before rs28371759 site mutation type primer of the present invention change；
Fig. 4 b is the electrophoretogram 1 after rs28371759 site mutation type primer of the present invention change；
Fig. 4 c is the electrophoretogram 2 after rs28371759 site mutation type primer of the present invention change；
Fig. 5 is the electrophoretogram of the testing result of patient 1 in embodiments of the invention, patient 2, patient 3；
Fig. 6 is the electrophoretogram of the testing result of patient 4 in embodiments of the invention, patient 5, patient 6.
Detailed description of the invention
Below in conjunction with accompanying drawing, the present invention is described in further detail, to make those skilled in the art can implement according to this with reference to description word.
As it can be seen, disclosure one drug metabolism enzyme related gene SNP fluorescence labeling composite amplification test kit, include the composite amplification primer of 5 gene polymorphism sites for expanding and allelic genotype standard substance thereof；
Described 5 gene polymorphism sites include: CYP2C9 gene rs1057910 site (CYP2C9*3), CYP2C19 gene rs4244285 site (CYP2C19*2), CYP2C19 gene rs4986893 site (CYP2C19*3), CYP2D6 gene rs1065852 site (CYP2D6*10), CYP3A4 gene rs28371759 site (CYP3A4*18).
Preferably, the primer sequence of the composite amplification primer of described 5 gene polymorphism sites is respectively as follows: rs1057910, reverse general primer, SEQIDNO.1, forward primer, SEQIDNO.2-3；Rs4244285, reverse general primer, SEQIDNO.4, forward primer, SEQIDNO5-7；Rs4986893, reverse general primer, SEQIDNO.8, forward primer, SEQIDNO.9-10；Rs1065852, reverse general primer, SEQIDNO.11, forward primer, SEQIDNO.12-13；Rs28371759, reverse general primer, SEQIDNO.14, forward primer, SEQIDNO.15-16.
The composite amplification primer of described 5 gene polymorphism sites final concentration in amplification system is as follows:
Described drug metabolism enzyme related gene SNP fluorescence labeling composite amplification test kit also includes ReactionMix, thermal starting Taq DNA polymerase, composite primer, sdH2O；Described ReactionMix is MgCl22.5mM, Tris-HClbuffer125mM, KCl80mM, dNTPs7.5mM, BSA1.5mg/ml.
Described reverse general primer has fluorescent labeling.
Described reverse general primer can be FAM, HEX, TAMRA or ROX labelling.
The using method of a kind of drug metabolism enzyme related gene SNP fluorescence labeling composite amplification test kit, comprises the steps: step A, extracts genomic DNA, as DNA profiling from biological material；Or directly block for template with blood filter paper or saliva, it is not necessary to extract；Step B, prepares PCR reactant liquor, adds ReactionMix, thermal starting Taq DNA polymerase, composite primer, sdH2O and DNA profiling, adopts three step TRAP, polymorphic SNP site to be detected is carried out pcr amplification；Step C, carries out fluorescence gel electrophoretic analysis and gene type to amplified production.
The execution program of described pcr amplification includes: a, denaturation, 95 DEG C of 5min；B, thermal cycle, 94 DEG C of 30s, totally 30 circulations；60℃1min；C, eventually extension, 60 DEG C of 15min；D, insulation, 4 DEG C.
Described biological material includes one or more in blood, hair, saliva, seminal stain, exfoliative cyte or skeleton.
Embodiment 1:
The foundation of the design of primer of the present invention, the optimization of concentration and reaction system is as follows:
1. the design of primer and screening
1.1 sequences are downloaded
Template sequence is downloaded, and has downloaded the gene order of SNP site from NCBIgenebank, and determines allele position and the type in each site, and wherein the allele A in rs1057910 site is wild type, and C is saltant type；The allele G in rs4244285 site is wild type, and A and C is saltant type；The allele G in rs4986893 site is wild type, and A is saltant type；The allele C in rs1065852 site is wild type, and T is saltant type；The allele T in rs28371759 site is wild type, and C is saltant type.Concrete outcome is as shown in the table:
The each SNP site sequence information of table 2
| SNP site | Sequence Genebank | Allele position | Allelic gene type |
| rs1057910 | NT_030059.13 | 47545517 | A/C |
| rs4244285 | NT_030059.14 | 53088338 | G/A/C |
| rs4986893 | NT_030059.14 | 53087132 | G/A |
| rs1065852 | NT_011520.13 | 23421128 | C/T |
| rs28371759 | NT_007933.16 | 37257224 | T/C |
1.2 design of primers
After determining gene order and the allelic gene type of each SNP site, utilizing OLIGO6.0 to carry out the design of primer, all primers of the present invention synthesize by Sangon Biotech (Shanghai) Co., Ltd..Wherein 5 ' ends of a general primer are with fluorescein-labelled, the 3 ' of two other non-marked primer (rs4244285 site is three) hold last base pair allele template to carry out specific recognition, article two, (present invention uses ATT or ATTATT with the unpaired nucleotide of template in any of which bar 5 ' the end introducing 3～6 of non-marked primer, the impact of primer TM value is minimum) it is used for indicating allele, owing to two non-marked primer length differences cause that amplified production length is different, electrophoretic mobility is different, is finally reached the purpose of detection.
The principle of design of primers of the present invention is as shown in Figure 2, except the rule of the design following general primer, for increasing the specificity of two non-marked primers, 2～5 base places are held to be artificially induced base mismatch at distance primer 3 ', the principle introducing mispairing is: if 3 ' ends are weak mispairing (A-C, G-T), then strong mispairing (A-G, C-T) is introduced；If 3 ' ends are middle mispairing (A-A, G-G, C-C, T-T), then mispairing in introducing；If 3 ' ends are strong mispairing, then introduce weak mispairing.The primer of the present invention is all designed by this rule, for the optimization of follow-up primer concentration, at the primer Tm of this design all between 58～62 DEG C.
The screening of 1.3 primers
It is plasmid DNA corresponding to each SNP site that the present invention screens the template of primer, totally 11, respectively rs1057910A/C, rs4244285G/A/C, rs4986893A/G, rs1065852C/T and rs28371759T/C, positive plasmid is synthesized by Sangon Biotech (Shanghai) Co., Ltd..The sequence of concrete each positive plasmid is as follows:
rs1057910A
ACCTTCATGATTCATATACCCCTGAATTGCTACAACAAATGTGCCATTTTTCTCCTTTTCCATCAGTTTTTACTTGTGTCTTATCAGCTAAAGTCCAGGAAGAGATTGAACGTGTGATTGGCAGAAACCGGAGCCCCTGCATGCAAGACAGGAGCCACATGCCCTACACAGATGCTGTGGTGCACGAGGTCCAGAGATACATTGACCTTCTCCCCACCAGCCTGCCCCATGCAGTGACCTGTGACATTAAATTCAGAAACTATCTCATTCCCAAGGTAAGTTTGTTTCTCCTACACTGCAACTCCATGTTTTCGAAGTCCCCAAATTCATAGTATCATTTTTAAACCTCTACCATCACCGGGTGAGAGAAGTGCATAACTCATATGTATGGCAGTTTAACT
rs1057910C
ACCTTCATGATTCATATACCCCTGAATTGCTACAACAAATGTGCCATTTTTCTCCTTTTCCATCAGTTTTTACTTGTGTCTTATCAGCTAAAGTCCAGGAAGAGATTGAACGTGTGATTGGCAGAAACCGGAGCCCCTGCATGCAAGACAGGAGCCACATGCCCTACACAGATGCTGTGGTGCACGAGGTCCAGAGATACCTTGACCTTCTCCCCACCAGCCTGCCCCATGCAGTGACCTGTGACATTAAATTCAGAAACTATCTCATTCCCAAGGTAAGTTTGTTTCTCCTACACTGCAACTCCATGTTTTCGAAGTCCCCAAATTCATAGTATCATTTTTAAACCTCTACCATCACCGGGTGAGAGAAGTGCATAACTCATATGTATGGCAGTTTAACT
rs4244285G
TAATCAGAGAATTACTACACATGTACAATAAAAATTTCCCCATCAAGATATACAATATATTTTATTTATATTTATAGTTTTAAATTACAACCAGAGCTTGGCATATTGTATCTATACCTTTATTAAATGCTTTTAATTTAATAAATTATTGTTTTCTCTTAGATATGCAATAATTTTCCCACTATCATTGATTATTTCCCGGGAACCCATAACAAATTACTTAAAAACCTTGCTTTTATGGAAAGTGATATTTTGGAGAAAGTAAAAGAACACCAAGAATCGATGGACATCAACAACCCTCGGGACTTTATTGATTGCTTCCTGATCAAAATGGAGAAGGTAAAATGTTAACAAAAGCTTAGTTATGTGACTGCTTGCGTATTTGTGATTCATTGACTAGT
rs4244285A
TAATCAGAGAATTACTACACATGTACAATAAAAATTTCCCCATCAAGATATACAATATATTTTATTTATATTTATAGTTTTAAATTACAACCAGAGCTTGGCATATTGTATCTATACCTTTATTAAATGCTTTTAATTTAATAAATTATTGTTTTCTCTTAGATATGCAATAATTTTCCCACTATCATTGATTATTTCCCAGGAACCCATAACAAATTACTTAAAAACCTTGCTTTTATGGAAAGTGATATTTTGGAGAAAGTAAAAGAACACCAAGAATCGATGGACATCAACAACCCTCGGGACTTTATTGATTGCTTCCTGATCAAAATGGAGAAGGTAAAATGTTAACAAAAGCTTAGTTATGTGACTGCTTGCGTATTTGTGATTCATTGACTAGT
rs4244285C
TAATCAGAGAATTACTACACATGTACAATAAAAATTTCCCCATCAAGATATACAATATATTTTATTTATATTTATAGTTTTAAATTACAACCAGAGCTTGGCATATTGTATCTATACCTTTATTAAATGCTTTTAATTTAATAAATTATTGTTTTCTCTTAGATATGCAATAATTTTCCCACTATCATTGATTATTTCCCCGGAACCCATAACAAATTACTTAAAAACCTTGCTTTTATGGAAAGTGATATTTTGGAGAAAGTAAAAGAACACCAAGAATCGATGGACATCAACAACCCTCGGGACTTTATTGATTGCTTCCTGATCAAAATGGAGAAGGTAAAATGTTAACAAAAGCTTAGTTATGTGACTGCTTGCGTATTTGTGATTCATTGACTAGT
rs4986893A
ATATCTAATGTTTACTCATATTTTAAAATTGTTTCCAATCATTTAGCTTCACCCTGTGATCCCACTTTCATCCTGGGCTGTGCTCCCTGCAATGTGATCTGCTCCATTATTTTCCAGAAACGTTTCGATTATAAAGATCAGCAATTTCTTAACTTGATGGAAAAATTGAATGAAAACATCAGGATTGTAAGCACCCCCTGAATCCAGGTAAGGCCAAGTTTTTTGCTTCCTGAGAAACCACTTACAGTCTTTTTTTCTGGGAAATCCAAAATTCTATATTGACCAAGCCCTGAAGTACATTTTTGAATACTACAGTCTTGCCTAGACAGCCATGGGGTGAATATCTGGAAAAGATGGCAAAGTTCTTTATTTTATGCACAGGAAATGAATATCCCAATATA
rs4986893G
ATATCTAATGTTTACTCATATTTTAAAATTGTTTCCAATCATTTAGCTTCACCCTGTGATCCCACTTTCATCCTGGGCTGTGCTCCCTGCAATGTGATCTGCTCCATTATTTTCCAGAAACGTTTCGATTATAAAGATCAGCAATTTCTTAACTTGATGGAAAAATTGAATGAAAACATCAGGATTGTAAGCACCCCCTGGATCCAGGTAAGGCCAAGTTTTTTGCTTCCTGAGAAACCACTTACAGTCTTTTTTTCTGGGAAATCCAAAATTCTATATTGACCAAGCCCTGAAGTACATTTTTGAATACTACAGTCTTGCCTAGACAGCCATGGGGTGAATATCTGGAAAAGATGGCAAAGTTCTTTATTTTATGCACAGGAAATGAATATCCCAATATA
rs1065852C
ACGCGCTCGGTGTGCTGAGAGTGTCCTGCCTGGTCCTCTGTGCCTGGTGGGGTGGGGGTGCCAGGTGTGTCCAGAGGAGCCCATTTGGTAGTGAGGCAGGTATGGGGCTAGAAGCACTGGTGCCCCTGGCCGTGATAGTGGCCATCTTCCTGCTCCTGGTGGACCTGATGCACCGGCGCCAACGCTGGGCTGCACGCTACCCACCAGGCCCCCTGCCACTGCCCGGGCTGGGCAACCTGCTGCATGTGGACTTCCAGAACACACCATACTGCTTCGACCAGGTGAGGGAGGAGGTCCTGGAGGGCGGCAGAGGTCCTGAGGATGCCCCACCACCAGCAAACATGGGTGGTGGGTGAAACCACAGGCTGGACCAGAAGCCAGGCTGAGAAGGGGAAGCAGGT
rs1065852T
ACGCGCTCGGTGTGCTGAGAGTGTCCTGCCTGGTCCTCTGTGCCTGGTGGGGTGGGGGTGCCAGGTGTGTCCAGAGGAGCCCATTTGGTAGTGAGGCAGGTATGGGGCTAGAAGCACTGGTGCCCCTGGCCGTGATAGTGGCCATCTTCCTGCTCCTGGTGGACCTGATGCACCGGCGCCAACGCTGGGCTGCACGCTACTCACCAGGCCCCCTGCCACTGCCCGGGCTGGGCAACCTGCTGCATGTGGACTTCCAGAACACACCATACTGCTTCGACCAGGTGAGGGAGGAGGTCCTGGAGGGCGGCAGAGGTCCTGAGGATGCCCCACCACCAGCAAACATGGGTGGTGGGTGAAACCACAGGCTGGACCAGAAGCCAGGCTGAGAAGGGGAAGCAGGT
rs28371759T
AAATGATTTGCCTTATTCTGGTTCTGTAAGATACACATCAGAATGAAACCACCCCCAGTGTACCTCTGAATTGCTTTTCTATTCTTTTCCCTTAGGGATTTGAGGGCTTCACTTAGATTTCTCTTCATCTAAACTGTGATGCCCTACATTGATCTGATTTACCTAAAATGTCTTTCCTCTCCTTTCAGCTCTGTCCGATCTGGAGCTCGTGGCCCAATCAATTATCTTTATTTTTGCTGGCTATGAAACCACGAGCAGTGTTCTCTCCTTCATTATGTATGAACTGGCCACTCACCCTGATGTCCAGCAGAAACTGCAGGAGGAAATTGATGCAGTTTTACCCAATAAGGTGAGTGGATGGTACATGGAGAAGGAGGGAGGAGGTGAAACCTTAGCAAAAA
rs28371759C
AAATGATTTGCCTTATTCTGGTTCTGTAAGATACACATCAGAATGAAACCACCCCCAGTGTACCTCTGAATTGCTTTTCTATTCTTTTCCCTTAGGGATTTGAGGGCTTCACTTAGATTTCTCTTCATCTAAACTGTGATGCCCTACATTGATCTGATTTACCTAAAATGTCTTTCCTCTCCTTTCAGCTCTGTCCGATCCGGAGCTCGTGGCCCAATCAATTATCTTTATTTTTGCTGGCTATGAAACCACGAGCAGTGTTCTCTCCTTCATTATGTATGAACTGGCCACTCACCCTGATGTCCAGCAGAAACTGCAGGAGGAAATTGATGCAGTTTTACCCAATAAGGTGAGTGGATGGTACATGGAGAAGGAGGGAGGAGGTGAAACCTTAGCAAAAA
The concrete grammar of primer screening is as follows: first the allelic gene type that each SNP site is corresponding is carried out the list of primer and expand test by (1), namely by the plasmid DNA of the primer amplification wild type of wild type, the plasmid DNA of the primer amplification saltant type of saltant type；(2) then all of primer is formed composite primer, respectively the plasmid DNA of amplification wild type and saltant type, to verify specificity and the amplification efficiency of primer；(3) finally according to the result, it is determined that final primer sequence.The present invention repeatedly changes primer sequence when screening primer and tests primer amplification effect, and concrete situation has several as follows.
The present invention finds in the process screening primer: composite primer all there will be a non-specific amplification peak when expanding arbitrary plasmid DNA template, and size is at about 79bp.Go out peak principle according to fluorescence gel electrophoresis, appoint from the nonstandard primer of each SNP site and take one and form composite primer together with the shared labeled primer of each SNP site again, have three kinds of combinations, expand the plasmid DNA of its correspondence respectively.Result from fluorescence gel electrophoresis, only the labeled primer in the mutant primers in rs1065852 site and rs1057910 site just there will be this non-specific amplification peak when combining, therefore the present invention is according to the general primer rule designed and the principle introducing mispairing, design the mutant primers in three rs1065852 sites altogether, it is respectively labeled as rs1065852M-F1, rs1065852M-F2, rs1065852M-F3, concrete primer sequence respectively TGGGCTGCACGCTtCT, TGGGCTGCACGCgACT, TGGGCTGCACGgTACT.Then with other primers of each SNP site, these three primers being formed composite primer respectively to test, found that the specificity of primer rs1065852M-F3 and expanding effect are best, the non-specific amplification peak being sized to about 79bp disappears.
The present invention finds in the process of screening primer: according to the principle introducing mispairing, the wild primers in rs4986893 site should introduce strong mispairing at the 3 ' seconds held, and the present invention has introduced strong mispairing at its 3 ' end second when designing primer, but there will be specificity to cross strong and can not expand the situation of template, therefore the present invention has redesigned two primers according to the rule of general primer design and the principle of introducing mispairing, it is respectively labeled as rs4986893W-F1, rs4986893W-F2, concrete primer sequence is GGATTGTAAGCACCCCCaGG, GGATTGTAAGCACCCCCTcG.After two wild primers in the rs4986893 site after change are formed composite primer with the primer of other SNP site respectively, respectively the wild plasmid in rs4986893 site and mutant plasmids being carried out pcr amplification again, result shows: the composite primer of rs4986893W-F2 composition also there will be specificity and crosses strong and can not expand the situation of template；The composite primer of rs4986893W-F1 composition all has corresponding amplified peak when expanding wild type and mutant plasmids DNA.Concrete outcome is shown in accompanying drawing, Fig. 3 a is the former wild primers in the rs4986893 site electrophoretogram when the 3 ' seconds held introduce strong mispairing, in figure, the template in rs1065852 site is mutant plasmids (T), the template in rs4244285 site is mutant plasmids (A), the template in rs1057910 site is wild plasmid (A), the template in rs28371759 site is wild plasmid (T), the template in rs4986893 site is wild plasmid (G), rs1065852 as seen from the figure, rs4244285, rs1057910 and rs28371759 all has corresponding amplified peak, rs4986893 site does not have amplified peak；Fig. 3 b is the electrophoretogram after rs4986893W-F1 forms composite primer amplification, in figure the template in rs1065852 site be mutant plasmids (T), rs4244285 site template be mutant plasmids (A), rs1057910 site template be wild plasmid (A), rs28371759 site template be wild plasmid (T), rs4986893 site template be wild plasmid (G), rs1065852, rs4244285, rs1057910, rs28371759 and rs4986893 all have corresponding amplified peak as seen from the figure.
The present invention finds in the process screening primer: composite primer has corresponding amplified peak when expanding the mutant plasmids in rs28371759 site, and the amplified peak having wild plasmid corresponding when expanding the wild plasmid in rs28371759 site also has the amplified peak that mutant plasmids is corresponding, it can thus be appreciated that the specificity of the mutant primers in rs28371759 site is poor, the mutant primers in rs28371759 site need to be changed.According to the principle introducing mispairing, the second held at the mutant primers 3 ' in rs28371759 site should introduce strong mispairing, and the present invention has introduced strong base mismatch at its 3 ' end second when designing primer, but the mutant primers in rs28371759 site does not still have good specificity, for increasing the specificity of primer, the present invention according to general primer design rule and introduce mispairing principle when its 3 ' end second have been introduced into strong mispairing be re-introduced at the 5th in mispairing (selecting the 5th to be not only to ensure that the amplification efficiency of primer but also be the specificity in order to increase primer), concrete primer sequence is ATTCCTTTCAGCTCTGTCCcATaC.The mutant primers that rs28371759 site is changed and the primer composition composite primer of other SNP site, respectively the wild plasmid in rs28371759 site and mutant plasmids are carried out pcr amplification, result shows: (1) composite primer only has, when expanding the mutant plasmids in rs28371759 site, the amplified peak that mutant plasmids is corresponding, and namely the mutant primers in rs28371759 site still has good amplification efficiency when introducing two base mismatch.(2) the amplified peak amplified peak corresponding without mutant plasmids occurs that composite primer only has wild plasmid corresponding when expanding the wild plasmid in rs28371759 site, namely the specificity of the mutant primers in rs28371759 site is better, it does not have non-specific amplification occur.nullConcrete outcome is shown in accompanying drawing，Wherein Fig. 4 a is the mutant primers in the rs28371759 site electrophoretogram when the 3 ' seconds held introduce strong mispairing，In figure, the template in rs1065852 site is wild plasmid (C)、The template in rs4244285 site is mutant plasmids (C)、The template in rs1057910 site is wild plasmid (A)、The template in rs4986893 site is mutant plasmids (A)、The template in rs28371759 site is wild plasmid，Rs1065852 as seen from the figure、rs4244285、All there is corresponding amplified peak in rs1057910 and rs4986893 site，And there are two amplified peak in rs28371759 site，Correspond respectively to wild plasmid and the mutant plasmids of rs28371759，In visible composite primer, the mutant primers in rs28371759 site can amplify the plasmid of wild type；Fig. 4 b is the mutant primers in the rs28371759 site electrophoretogram 1 when the 3 ' seconds held and the 5th introduce strong mispairing and middle mispairing respectively, in figure, the template in rs1065852 site is wild plasmid (C), the template in rs4244285 site is mutant plasmids (C), the template in rs1057910 site is wild plasmid (A), the template in rs4986893 site is mutant plasmids (A), the template in rs28371759 site is mutant plasmids (C), rs1065852 as seen from the figure, rs4244285, rs1057910, all there is corresponding amplified peak in rs4986893 and rs28371759 site；Fig. 4 c is the mutant primers in the rs28371759 site electrophoretogram 2 when the 3 ' seconds held and the 5th introduce strong mispairing and middle mispairing respectively, in figure, the template in rs1065852 site is wild plasmid (C), the template in rs4244285 site is mutant plasmids (C), the template in rs1057910 site is wild plasmid (A), the template in rs4986893 site is mutant plasmids (A), the template in rs28371759 site is wild plasmid (T), rs1065852 as seen from the figure, rs4244285, rs1057910, all there is corresponding amplified peak in rs4986893 and rs28371759 site.The present invention finds that when screening primer the mutant primers in mutant primers M2-Primer and the rs28371759 site in rs4244285 site exists the same problem, and namely specificity is poor, therefore this primer is also modified by the present invention.
By in the primer screening process of the present invention it can be seen that the experiment effect of primer designed in strict accordance with the principle introducing mispairing not necessarily can be as expected, it is possible to do suitable change according to practical situation.Primer, through many experiments, is carried out repeated screening by the present invention, finally determines the primer sequence of each SNP site, and concrete sequence is in Table 1.
2. the optimization of primer concentration
Owing to there are differences between every primer efficiency, when causing every primer to reach same amplification peak value, the dosage in system is different.The concentration of primer, after determining primer sequence, will be optimized by the present invention.It is plasmid DNA corresponding to each SNP site that the present invention optimizes the template that primer concentration selects, and the plasmid DNA of each SNP site is formed plasmid DNA cocktail makes its final concentration be 0.05ng/ μ l.Concrete method is as follows: first all of primer is formed composite primer by (1) makes its final concentration in amplification system be 0.02 μM, then plasmid DNA cocktail is carried out pcr amplification；(2) amplified production in step (1) is carried out capillary electrophoresis detection, adjust the addition of each primer according to each SNP site primer amplification efficiency of detection.Through the many experiments of primer concentration, finally determine each SNP site primer optimum concentration in amplification system.Concrete concentration is shown in following table:
Table 3 each SNP site primer final concentration in amplification system
| SEQ ID NO. | Concentration (μM) | SEQ ID NO. | Concentration (μM) |
| 1 | 0.1 | 9 | 0.04 |
| 2 | 0.06 | 10 | 0.1 |
| 3 | 0.16 | 11 | 0.06 |
| 4 | 0.04 | 12 | 0.04 |
| 5 | 0.04 | 13 | 0.08 |
| 6 | 0.06 | 14 | 0.04 |
| 7 | 0.12 | 15 | 0.02 |
| 8 | 0.08 | 16 | 0.06 |
3. the experimentation of amplification and product detection
3.1 amplification systems
First complete the preparation of PCR reaction system outside removing template, be eventually adding amplification template；When extracting genomic DNA, first by ultraviolet scene photometer measurement concentration, then dilution makes its final concentration at 0.05-1ng/ μ about l, and in practical operation, the DNA profiling generally taking 1～2 μ l expands.In system, the application of sample amount of each component is as shown in table 4.
Table 4 test kit amplification system
Wherein, ReactionMix is MgCl22.5mM, Tris-HClbuffer125mM, KCl80mM, dNTPs7.5mM, BSA1.5mg/ml, hot start Taq polymerase is the TaKaRaTaqHotStartVersion of precious biological engineering (Dalian) company limited.
3.2 amplification programs
Use hand held centrifuge immediately after above-mentioned system configurations is good, after PCR pipe is placed on thermal cycler, the program of option table 5 expands, and the product after amplification should carry out fluorescence gel electrophoresis detection immediately or keep in Dark Place.
Table 5 test kit amplification program
3.3 amplified productions
On genetic analyzer, fluoroscopic examination is formed loading mixture (mix at 9.5: 0.5 by volume) by deionized formamide with mark LIZ-500 (Applied biosystems) in test kit middle-molecular-weihydroxyethyl.10 μ l loading mixture and 1 μ l amplified production are mixed, centrifugal, it is to avoid to produce bubble.95 DEG C of degeneration 3 minutes, ice bath 3 minutes, analyze with genetic analyzer 3100 (Applied biosystems) detection.
4. the preparation of allelic genotype standard substance
The positive plasmid 11 of rs1057910A/C, rs4244285A/G/C, rs4986893A/G, rs1065852T/C and rs28371759T/C it is respectively synthesized by Sangon Biotech (Shanghai) Co., Ltd., respectively with rs1057910A/C, rs4244285A/G/C, rs4986893A/G, rs1065852T/C and rs28371759T/C 11 pairs of primers carry out individually amplification (primer concentration is 0.02 μM), primer sequence is in Table 1.
4.1 amplification systems
First complete the preparation of PCR reaction system outside removing template, be eventually adding plasmid DNA template to be amplified.In system, the application of sample amount of each component is as shown in table 4.
Table 4 test kit amplification system
Wherein said ReactionMix is MgCl22.5mM, Tris-HClbuffer125mM, KCl80mM, dNTPs7.5mM, BSA1.5mg/ml, hot start Taq polymerase is the TaKaRaTaqHotStartVersion of precious biological engineering (Dalian) company limited.
4.2 amplification programs
Use hand held centrifuge immediately after above-mentioned system configurations is good, after PCR pipe is placed on thermal cycler, the program of option table 5 expands, and the product after amplification should carry out fluorescence gel electrophoresis detection immediately or keep in Dark Place.
Table 5 test kit amplification program
4.3 amplified productions fluoroscopic examination on genetic analyzer
Loading mixture (mix at 9.5: 0.5 by volume) is formed with mark LIZ-500 (Applied biosystems) in test kit middle-molecular-weihydroxyethyl by deionized formamide.10 μ l loading mixture and 1 μ l amplified production are mixed, centrifugal, it is to avoid to produce bubble.95 DEG C of degeneration 3 minutes, ice bath 3 minutes, analyze with genetic analyzer 3100 (Applied biosystems) detection.
4.4 phenotypic analysis
The data collected with genetic analyzer detection in fragment analysis software GeneMapper3.2 analytical procedure (3).Electrophoresis adopts multiple tracks or single track capillary electrophoresis.Wherein genome DNA sample can be bacterium solution, it is also possible to be the plasmid DNA extracted.
The group of 4.5 allele genotype standard substance is joined
Detection peak height ratio according to each amplified allele, lacking of peak height adds, low the adding in peak, and each amplified allele product is mixed, and forms allele genotype standard substance.Electrophoresis detection again, detection figure is such as accompanying drawing 1.Table 6 is the allelic composition of each SNP site.
The allelic composition of each SNP site of table 6
5. 5 genotypic detections of SNP site of six patients
In the present embodiment, choose 6 and through the medical test portion order-checking success of son deep pool judicial expertise institute and determine genotypic patient.The numbering of 6 patients respectively C1, C2, C3, C4, C5 and C6.Concrete sequencing result is shown in following table.
Table 7 deep pool judicial expertise institute medical test portion sequencing result
Utilizing this test kit that 5 SNP site of 6 patients are carried out joint-detection, concrete detection process is as follows:
5.1 amplification systems
First complete the preparation of PCR reaction system outside removing template, be finally separately added into the genomic DNA template of to be amplified 6 patient.In system, the application of sample amount of each component is as shown in table 4.
Table 4 test kit amplification system
Wherein said ReactionMix is MgCl22.5mM, Tris-HClbuffer125mM, KCl80mM, dNTPs7.5mM, BSA1.5mg/ml, hot start Taq polymerase is the TaKaRaTaqHotStartVersion of precious biological engineering (Dalian) company limited.
5.2 amplification programs
Use hand held centrifuge immediately after above-mentioned system configurations is good, after PCR pipe is placed on thermal cycler, the program of option table 5 expands, and the product after amplification should carry out fluorescence gel electrophoresis detection immediately or keep in Dark Place.
Table 5 test kit amplification program
5.3 amplified productions fluoroscopic examination on genetic analyzer
Loading mixture (mix at 9.5: 0.5 by volume) is formed with mark LIZ-500 (Applied biosystems) in test kit middle-molecular-weihydroxyethyl by deionized formamide.10 μ μ l loading mixture and 1 μ l amplified production are mixed, centrifugal, it is to avoid to produce bubble.95 DEG C of degeneration 3 minutes, ice bath 3 minutes, analyze with genetic analyzer 3100 (Applied biosystems) detection.
The testing result of 6 patients is such as figure, and wherein in Fig. 5, numbering C1 to be patient 1, numbering C2 be patient 2, numbering C3 are patient 3；In Fig. 6, numbering C4 to be patient 4, numbering C5 be patient 5, numbering C6 are patient 6.Concrete detection genotype is in Table 8.By the genotype of deck watch 7 and table 8 it can be seen that the genotype of 5 SNP site of 6 patients is completely the same with the sequencing result in medical test portion of judicial expertise institute, sub-deep pool.
The genotype that in table 8 the present embodiment, 5 SNP site of 6 patients detect
Interpretation of result: there are three kinds of genotype in rs1057910 site in crowd: A/A, A/C and C/C, wherein carry A/A genotype and be normal population and fast metabolic pattern EM represents, carrying A/C genotype is that medium metabolic type IM represents, carries that C/C genotypic crowd liver metabolism ability is the most weak to be represented for slow inactivation PM.There are six kinds of genotype: G/G, A/G, A/A, C/C, C/G and A/C in rs4244285 site in crowd, wherein carrying G/G genotype is that fast metabolic pattern EM represents, carrying A/G, C/G genotype is that medium metabolic type IM represents, carrying A/A, A/C, C/C genotype is that slow inactivation PM represents.There are three kinds of genotype in rs4986893 site in crowd: G/G, A/G and A/A, and wherein carrying G/G genotype is that fast metabolic pattern EM represents, carrying A/G genotype is that medium metabolic type IM represents, carrying A/A genotype is that slow inactivation PM represents.There are three kinds of genotype in rs1065852 site in crowd: C/C, C/T and T/T, and wherein carrying C/C genotype is that fast metabolic pattern EM represents, carrying C/T genotype is that medium metabolic type IM represents, carrying T/T genotype is that slow inactivation PM represents.Rs28371759 site is three kinds of genotype in crowd: T/T, C/T and C/C, and wherein carrying T/T genotype is that fast metabolic pattern EM represents, carrying C/T genotype is that medium metabolic type IM represents, carrying C/C genotype is that slow inactivation PM represents.
It follows that the rs4244285 site of patient 1, rs4986893 site, rs1065852 site and rs28371759 site are normal genotype and fast metabolic pattern (EM), rs1057910 site is abnormal is medium metabolic type (IM).The rs1057910 site associated metabolic medicine of CYP2C9 gene includes: warfarin, dicoumarol, ibuprofen, diclofenac, piroxicam, naproxen, indomethacin, phenytoin, carbamazepine, glimepiride, glipizide, tolbutamide etc..In order to avoid the generation of ADR, patient 1 is best consulting profession doctor before medication, it is determined that best drug dose.The rs1057910 site of patient 2, rs1065852 site and rs28371759 site are normal genotype and fast metabolic pattern (EM), rs4244285 site and rs4986893 site and are extremely medium metabolic type (IM).Rs4244285 site and two different mutational sites that rs4986893 site is CYP2C19 gene, the associated metabolic medicine of CYP2C19 gene includes: amitriptyline, clomipramine, citalopram, proguanil, mephenytoin, phenobarbital, diazepam etc..In order to avoid the generation of ADR, patient 2 is best consulting profession doctor before medication, it is determined that best drug dose.The rs1057910 site of patient 3, rs4986893 site, rs1065852 site and rs28371759 site are normal genotype and fast metabolic pattern (EM), and rs4244285 site is abnormal is medium metabolic type (IM).The associated metabolic medicine in the rs4244285 site of CYP2C19 gene includes: amitriptyline, clomipramine, proguanil, mephenytoin, phenytoin, ethotoin, enphenemal, diazepam etc..In order to avoid the generation of ADR, patient 3 is best consulting profession doctor before medication, it is determined that best drug dose.The rs1057910 site of patient 4, rs4986893 site, rs1065852 site and rs28371759 site are normal genotype and fast metabolic pattern (EM), and rs4244285 site is abnormal is slow inactivation (PM).The associated metabolic medicine in the rs4244285 site of CYP2C19 gene includes: amitriptyline, citalopram, proguanil, mephenytoin, phenytoin, ethotoin, enphenemal, diazepam etc..In order to avoid the generation of ADR, patient 4 is best consulting profession doctor before medication, it is determined that best drug dose.The rs1057910 site of patient 5, rs4244285 site, rs4986893 site, rs1065852 site are normal genotype and fast metabolic pattern (EM), and rs28371759 site is abnormal is slow inactivation (PM).The associated metabolic medicine in the rs28371759 site of CYP3A4 gene has: ketoconazole, erythromycin, rifampicin, clarithromycin, codeine, tramadol, oxycodone, dihydrocodeine, acetaminophen, simvastatin, fluvastatin, gemfibrozil, bezafibrate, fenofibrate, testosterone, cortisone, gestodene, dexamethasone, prednisolone etc..In order to avoid the generation of ADR, patient 5 is best consulting profession doctor before medication, it is determined that best drug dose.The rs1057910 site of patient 6, rs4244285 site, rs4986893 site and rs28371759 site are normal genotype and fast metabolic pattern (EM), and rs1065852 site is abnormal is medium metabolic type (IM).The associated metabolic medicine in the rs1065852 site of CYP2D6 gene includes: codeine, tramadol, oxycodone, dihydrocodeine, amitriptyline, imipramine, trimeprimine, desmethylimipramine, paroxetine, fluvoxamine, Propafenone, flecainide, encainide, sparteine etc..In order to avoid the generation of ADR, patient 6 is best consulting profession doctor before medication, it is determined that best drug dose.
In sum, the detection method step of the present invention is simple, and testing result is accurately and reliably.Only need to once test, so that it may high flux obtains the genotype in all sites to be detected, and can detect five kinds of mutated-genotype (A/G, A/A, C/C, C/G and A/C) for rs4244285 site.Medicine associated metabolic enzyme gene is detected by the test kit of the application present invention, and the relation of drugs untoward reaction and genovariation provides theories integration for rational use of drug.
Although embodiment of the present invention are disclosed as above, but listed utilization that it is not restricted in description and embodiment, it can be applied to various applicable the field of the invention completely, for those skilled in the art, it is easily achieved other amendment, therefore, under the general concept limited without departing substantially from claim and equivalency range, the present invention is not limited to specific details and shown here as the legend with description.
Claims (9)
1. a drug metabolism enzyme related gene SNP fluorescence labeling composite amplification test kit, it is characterised in that: include composite amplification primer and the allele genotype standard substance thereof of 5 gene polymorphism sites for expanding；
Described 5 gene polymorphism sites include: CYP2C9 gene rs1057910 site, CYP2C19 gene rs4244285 site, CYP2C19 gene rs4986893 site, CYP2D6 gene rs1065852 site, CYP3A4 gene rs28371759 site.
2. drug metabolism enzyme related gene SNP fluorescence labeling composite amplification test kit according to claim 1, it is characterised in that: the primer sequence of the composite amplification primer of described 5 gene polymorphism sites is respectively as follows:
Rs1057910, reverse general primer, SEQIDNO.1, forward primer, SEQIDNO.2-3；
Rs4244285, reverse general primer, SEQIDNO.4, forward primer, SEQIDNO5-7；
Rs4986893, reverse general primer, SEQIDNO.8, forward primer, SEQIDNO.9-10；
Rs1065852, reverse general primer, SEQIDNO.11, forward primer, SEQIDNO.12-13；
Rs28371759, reverse general primer, SEQIDNO.14, forward primer, SEQIDNO.15-16.
3. drug metabolism enzyme related gene SNP fluorescence labeling composite amplification test kit according to claim 1, it is characterised in that: the composite amplification primer of described 5 gene polymorphism sites final concentration in amplification system is as follows:
4. the drug metabolism enzyme related gene SNP fluorescence labeling composite amplification test kit according to claim 1,2 or 3, it is characterised in that: also include ReactionMix, thermal starting Taq DNA polymerase, composite primer, sdH2O；Described ReactionMix is MgCl22.5mM, Tris-HClbuffer125mM, KCl80mM, dNTPs7.5mM, BSA1.5mg/ml.
5. drug metabolism enzyme related gene SNP fluorescence labeling composite amplification test kit according to claim 2, it is characterised in that: described reverse general primer has fluorescent labeling.
6. the drug metabolism enzyme related gene SNP fluorescence labeling composite amplification test kit according to claim 2 or 5, it is characterised in that: described reverse general primer can be FAM, HEX, TAMRA or ROX labelling.
7. the using method of the drug metabolism enzyme related gene SNP fluorescence labeling composite amplification test kit according to any one of claim 1～6, comprises the steps:
Step A, extracts genomic DNA, as DNA profiling from biological material；Or directly block for template with blood filter paper or saliva, it is not necessary to extract；
Step B, prepares PCR reactant liquor, adds ReactionMix, thermal starting Taq DNA polymerase, composite primer, sdH2O and DNA profiling, adopts three step TRAP, polymorphic SNP site to be detected is carried out pcr amplification；
Step C, carries out fluorescence gel electrophoretic analysis and gene type to amplified production.
8. the using method of drug metabolism enzyme related gene SNP fluorescence labeling composite amplification test kit according to claim 7, it is characterised in that: the execution program of described pcr amplification includes: a, denaturation, 95 DEG C of 5min；B, thermal cycle, 94 DEG C of 30s, 60 DEG C of 1min；Totally 30 circulations；C, eventually extension, 60 DEG C of 15min；D, insulation, 4 DEG C.
9. the using method of drug metabolism enzyme related gene SNP fluorescence labeling composite amplification test kit according to claim 7, it is characterised in that: described biological material includes one or more in blood, hair, saliva, seminal stain, exfoliative cyte or skeleton.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610214241.5A CN105779601A (en) | 2016-04-07 | 2016-04-07 | Drug metabolic enzyme related gene SNP fluorescence labeling composite amplification kit |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610214241.5A CN105779601A (en) | 2016-04-07 | 2016-04-07 | Drug metabolic enzyme related gene SNP fluorescence labeling composite amplification kit |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN105779601A true CN105779601A (en) | 2016-07-20 |
Family
ID=56394970
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610214241.5A Pending CN105779601A (en) | 2016-04-07 | 2016-04-07 | Drug metabolic enzyme related gene SNP fluorescence labeling composite amplification kit |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105779601A (en) |
Cited By (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107904302A (en) * | 2017-11-29 | 2018-04-13 | 昆明理工大学 | One group of primer for detecting anticoagulant related gene polymorphism at the same time and application |
| CN107937506A (en) * | 2017-11-16 | 2018-04-20 | 南京迪安医学检验所有限公司 | A kind of kit of molecular beacon probe method detection mankind's CYP2C19 gene pleiomorphisms, method and its application |
| CN108841948A (en) * | 2018-06-07 | 2018-11-20 | 厦门为正生物科技股份有限公司 | For detecting primer sets, kit and the detection method of human-cytochrome P450 related gene polymorphism |
| CN108998515A (en) * | 2018-08-24 | 2018-12-14 | 北京青航基因科技有限公司 | SNP combination and the application in the product of preparation detection drug response related gene |
| CN110438224A (en) * | 2019-07-12 | 2019-11-12 | 广州迈景基因医学科技有限公司 | A kind of primer, kit and detection method for UGT1A1 genetic polymorphism detection |
| CN112795632A (en) * | 2020-12-31 | 2021-05-14 | 深圳瑞奥康晨生物科技有限公司 | Drug metabolizing enzyme and drug action target gene detection method, device and storage medium |
| CN113249467A (en) * | 2021-06-08 | 2021-08-13 | 北京大学第一医院 | Metabolic typing method of CYP2D6 gene related to psychotropic drugs in Chinese population |
| CN114438221A (en) * | 2022-01-11 | 2022-05-06 | 江苏省海洋水产研究所 | SNP molecular marker related to black porgy growth traits and application thereof |
| CN116515993A (en) * | 2023-06-25 | 2023-08-01 | 广州凯普医药科技有限公司 | Primer group and kit for detecting drug genes for depression |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101760528A (en) * | 2008-12-26 | 2010-06-30 | 上海基康生物技术有限公司 | Medicine metabolic relevant loci detection method |
| CN103352080A (en) * | 2013-07-11 | 2013-10-16 | 无锡中德美联生物技术有限公司 | Gene detection kit for hereditary hearing loss |
-
2016
- 2016-04-07 CN CN201610214241.5A patent/CN105779601A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101760528A (en) * | 2008-12-26 | 2010-06-30 | 上海基康生物技术有限公司 | Medicine metabolic relevant loci detection method |
| CN103352080A (en) * | 2013-07-11 | 2013-10-16 | 无锡中德美联生物技术有限公司 | Gene detection kit for hereditary hearing loss |
Non-Patent Citations (1)
| Title |
|---|
| 沈俊辉等: "北京地区CYP450药物代谢基因的等位基因分布调查", 《中国医药导报》 * |
Cited By (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107937506A (en) * | 2017-11-16 | 2018-04-20 | 南京迪安医学检验所有限公司 | A kind of kit of molecular beacon probe method detection mankind's CYP2C19 gene pleiomorphisms, method and its application |
| CN107904302A (en) * | 2017-11-29 | 2018-04-13 | 昆明理工大学 | One group of primer for detecting anticoagulant related gene polymorphism at the same time and application |
| CN108841948A (en) * | 2018-06-07 | 2018-11-20 | 厦门为正生物科技股份有限公司 | For detecting primer sets, kit and the detection method of human-cytochrome P450 related gene polymorphism |
| CN108998515A (en) * | 2018-08-24 | 2018-12-14 | 北京青航基因科技有限公司 | SNP combination and the application in the product of preparation detection drug response related gene |
| CN110438224A (en) * | 2019-07-12 | 2019-11-12 | 广州迈景基因医学科技有限公司 | A kind of primer, kit and detection method for UGT1A1 genetic polymorphism detection |
| CN110438224B (en) * | 2019-07-12 | 2020-12-01 | 广州迈景基因医学科技有限公司 | Primer, kit and detection method for UGT1A1 gene polymorphism detection |
| CN112795632A (en) * | 2020-12-31 | 2021-05-14 | 深圳瑞奥康晨生物科技有限公司 | Drug metabolizing enzyme and drug action target gene detection method, device and storage medium |
| CN113249467A (en) * | 2021-06-08 | 2021-08-13 | 北京大学第一医院 | Metabolic typing method of CYP2D6 gene related to psychotropic drugs in Chinese population |
| CN114438221A (en) * | 2022-01-11 | 2022-05-06 | 江苏省海洋水产研究所 | SNP molecular marker related to black porgy growth traits and application thereof |
| CN116515993A (en) * | 2023-06-25 | 2023-08-01 | 广州凯普医药科技有限公司 | Primer group and kit for detecting drug genes for depression |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105779601A (en) | Drug metabolic enzyme related gene SNP fluorescence labeling composite amplification kit | |
| CN101760528B (en) | Medicine metabolic relevant loci detection method | |
| CN107641645A (en) | Angiocardiopathy personalized medicine related gene polymorphism detection architecture and kit | |
| CN109136365B (en) | Detection method for children personalized medication analysis based on SNP (Single nucleotide polymorphism) locus and application thereof | |
| CN106636337A (en) | Clopidogrel drug-resistant gene detection method based on multiple HRM analysis | |
| CN109868314A (en) | A kind of kit and detection method detecting Drugs for Cardiovascular Diseases gene | |
| CN106086192A (en) | The parting detecting reagent of tacrolimus personalized medicine related gene | |
| CN106498035A (en) | A kind of construction method and its application for detecting chemotherapeutics gene SNP variation library for high-flux sequence | |
| CN110004222A (en) | A kind of multiple gene detection kit and its application method for antipsychotics medication guide | |
| CN107287340A (en) | A kind of composition and its application for being used to detect CYP2C9 and VKORC1 gene pleiomorphisms | |
| CN110699440A (en) | Primer and method for detecting SNP (single nucleotide polymorphism) locus of gene related to metformin personalized medicine | |
| CN112280849B (en) | Composite amplification system and kit for anti-depression individualized medication genotyping detection | |
| CN110846399A (en) | Cardiovascular disease individualized medication gene detection system kit and application thereof | |
| CN110387412A (en) | Primer combination and kit and method for instructing Rosuvastatin drug personalized medicine related gene to detect | |
| CN108913766A (en) | A kind of specific primer and probe and kit detecting depressed individuals chemical drug object therapeutic gene multisite mutation | |
| CN110241197A (en) | Primer combination of probe and kit and application for instructing Atorvastatin drug personalized medicine related gene to detect | |
| EP3969012A1 (en) | Methods concerning ongoing treatment for cancer | |
| CN103952481A (en) | Primer combination for detecting allele CYP2C19*3 and detection kit thereof | |
| CN109837339A (en) | Primer sets, probe groups, kit and method for the detection of children's safety medication related gene | |
| CN107435076A (en) | A kind of hypertension medication genetic test Solid phase PCR kit | |
| CN112501283A (en) | Guiding method and kit for carbamazepine personalized medicine gene | |
| CN110079596A (en) | A kind of multiple gene detection kit and its application method for antimanic agents medication guide | |
| CN111690736A (en) | Warfarin medication gene detection kit and use method thereof | |
| CN112646869B (en) | Guidance method and kit for atorvastatin personalized medicine genes | |
| CN104046696B (en) | The allelic primer of rapid detection HLA-B*1502, test kit and method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB02 | Change of applicant information |
Address after: 1 No. 223800 Suqian city of Jiangsu Province, the software and service outsourcing industry park of Metasequoia Avenue Applicant after: Jiangsu biomedical Limited by Share Ltd Address before: 1 No. 223800 Suqian city of Jiangsu Province, the software and service outsourcing industry park of Metasequoia Avenue Applicant before: JIANGSU SUPERBIO LIFE SCIENCE CO., LTD. |
|
| COR | Change of bibliographic data | ||
| DD01 | Delivery of document by public notice |
Addressee: Song Xiaoyun Document name: Notification of Passing Examination on Formalities |
|
| DD01 | Delivery of document by public notice | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20160720 |
|
| WD01 | Invention patent application deemed withdrawn after publication |