CN105779401A - High temperature resistant acidic glucose oxidase GODL8 as well as gene and application thereof - Google Patents
High temperature resistant acidic glucose oxidase GODL8 as well as gene and application thereof Download PDFInfo
- Publication number
- CN105779401A CN105779401A CN201610324331.XA CN201610324331A CN105779401A CN 105779401 A CN105779401 A CN 105779401A CN 201610324331 A CN201610324331 A CN 201610324331A CN 105779401 A CN105779401 A CN 105779401A
- Authority
- CN
- China
- Prior art keywords
- godl8
- glucoseoxidase
- high temperature
- temperature resistant
- glucose oxidase
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0006—Oxidoreductases (1.) acting on CH-OH groups as donors (1.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y101/00—Oxidoreductases acting on the CH-OH group of donors (1.1)
- C12Y101/03—Oxidoreductases acting on the CH-OH group of donors (1.1) with a oxygen as acceptor (1.1.3)
- C12Y101/03004—Glucose oxidase (1.1.3.4)
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Genetics & Genomics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Enzymes And Modification Thereof (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention relates to the field of genetic engineering and in particular relates to high temperature resistant acidic glucose oxidase GODL8 as well as a gene and an application thereof. The invention provides glucose oxidase GODL8 derived from Aspergillus niger L75. The amino acid sequence of glucose oxidase GODL8 derived from Aspergillus niger L75 is shown in SEQ ID NO.1 or 3. The invention provides a coding gene godL8 of glucose oxidase. The nucleotide sequence of the coding gene is shown in SEQ ID NO.4 or 6. Glucose oxidase has optimum pH of 4.5, optimum temperature of 45 DEG C and better thermal stability. As a novel enzyme preparation, glucose oxidase can be applied in the industries of feed, food, medicine, and the like.
Description
Technical field
The present invention relates to genetic engineering field, in particular it relates to a kind of high temperature resistant acidic glucoseoxidase GODL8 and gene, the recombinant vector comprising this gene and application.
Background technology
Glucoseoxidase (glucoseoxidase, E.C.1.1.3.4, GOD) can generate gluconic acid and hydrogen peroxide by catalysis β-D-Glucose in specific manner under aerobic conditions.Find that GOD as far back as people in 1904, but do not cause enough attention.First nineteen twenty-eight Muller finds GOD from the cell-free extract of aspergillus niger.Kusai (1960) etc., Pazur and Swobod-da (1964) purify GOD respectively from penicillin and aspergillus niger.Petruccioli (1995) etc. produces GOD with the mutant of penicillin.Purifying technique is prepared from the GOD's that begins one's study in 1986 by China, within 1998, formally puts into production.
The research of glucoseoxidase and produce the course that have passed through decades, but at present the research report of GOD is concentrated mainly on its mensuration being applied to blood glucose, in food, the deoxidation for medicated beer, fruit juice etc. is fresh-keeping and improve flour quality etc..One of feed enzyme preparation additive that glucoseoxidase was just used as permission by the Ministry of Agriculture in 1999, it has certain result of use in animal productiong and feedstuff preservation.
After in food processing technology, part glycoprotein decomposes, aldehyde radical and the amino acid whose carboxyl of reducing sugar can produce Maillard reaction, make product brown stain.Process food by GOD-catalase combined system, the aldehyde radical on glucose molecule can be changed into carboxyl, generate gluconic acid, eliminate Maillard reaction.It is commonly applied to egg product, potato products, fruit spreads and in seafood, extend the shelf life of product.Containing the food of the reducing substanceses such as flavone, linoleic acid, linolenic acid, such as fruit juice, tea beverage, wine, medicated beer, mayonnaise, fruit jam etc., there is oxygen can make reducing substances aoxidize, and causes product muddiness, precipitation, variable color.Add appropriate GOD or GOD-hydrogen peroxide multienzyme complex, can effectively protect the reducing substances in food.GOD can stop aerobic bacteria growth and breeding, produces hydrogen peroxide, plays bactericidal action.
The GOD single-minded oxidizing glucose of energy, therefore can be used for measuring the content of glucose in various food and mixture.The GOD analyser that current immobilization technology is made has been used for measuring the residual sugar amount of fermentation liquid.The Glucose estimation kit that principle is made accordingly, can the content of glucose in the numerous food such as quantitative assay fruit juice, beverage and milk.GOD and glucose response produce strong oxidizer hydrogen peroxide while generating gluconic acid, sulfydryl (-SH) in gluten molecule can be oxidized to disulfide bond (-S-S-), may replace the Potassium bromate. that human body is had carcinogenesis, strengthen gluten strength and dough ductility, increase loaf volume.Tes-Tape, blood sugar test paper measure the reagent commercialization of sugar content, because of simple to operate, nontoxic, harmless, easy to control, are widely used to clinic.
Although current glucoseoxidase has had commodity selling, but owing to yield is relatively low, production cost is high so that its application is restricted.Therefore the glucoseoxidase that exploitation enzyme activity height, good properties and production cost are low has just become the task of top priority.
Summary of the invention
It is an object of the invention to provide a kind of high temperature resistant acidic glucoseoxidase that can apply.
Another object of the present invention is to provide the gene encoding above-mentioned high temperature resistant acidic glucoseoxidase.
It is a further object of the present invention to provide the recombinant vector comprising said gene.
It is a further object of the present invention to provide the recombinant bacterial strain comprising said gene.
It is a further object of the present invention to provide a kind of gene engineering method preparing above-mentioned high temperature resistant acidic glucoseoxidase.
Another object of the present invention provides the application of above-mentioned high temperature resistant acidic glucoseoxidase.
The invention provides a kind of high temperature resistant acidic glucoseoxidase GODL8, its aminoacid sequence is such as shown in SEQIDNO.1.
Wherein, 616 aminoacid of this enzyme gene code and a termination codon, 22 aminoacid of N end are the signal peptide sequence MRAQLFLRAVLAACLITMPACG (SEQIDNO.2) of its prediction.Therefore, the theoretical molecular of ripe high temperature resistant acidic glucoseoxidase GODL8 is 69.9kDa, and its aminoacid sequence is such as shown in SEQIDNO.3.
The glucoseoxidase GODL8 of the present invention has good heat stability, is respectively provided with greater activity, optimal reaction pH4.5, optimal reactive temperature 45 DEG C in slant acidity and neutral scope.
The invention provides the gene godL8 encoding above-mentioned high temperature resistant acidic glucoseoxidase.Specifically, the nucleotide sequence of this gene is such as shown in SEQIDNO.4.
The present invention by the method separating clone of PCR glucose oxidase gene godL8, cDNA complete sequence analysis it is shown that glucoseoxidase GODL8 structural gene godL8 total length 1851bp.Wherein, the base sequence of signal peptide: atgcgcgcgcagctgtttctgcgcgcggtgctggcggcgtgcctgattaccatgcc ggcgtgcggc (SEQIDNO.5).
The gene order of ripe glucoseoxidase GODL8 is such as shown in SEQIDNO.6.
Glucose oxidase gene godL8 sequence and the aminoacid sequence derived are carried out BLAST comparison in GenBank, and this gene is 84% with the glucoseoxidase Amino acid sequence identity deriving from AspergillusnigerCBS513.88.Illustrate that GODL8 is a kind of new glucoseoxidase.
Present invention also offers the recombinant vector comprising above-mentioned high temperature resistant acidic glucose oxidase gene godL8, it is preferred to pPIC-godL8.It is inserted between the restriction enzyme site that expression vector is suitable after the glucose oxidase gene of the present invention is removed signal peptide so that it is nucleotide sequence is exercisable to be connected with expression regulation sequence.The most preferred embodiment as the present invention, it is preferably and the glucose oxidase gene of the present invention is inserted between EcoRI and the NotI restriction enzyme site on plasmid pPIC9, make this nucleotide sequence be positioned at the downstream of AOX1 promoter and be regulated and controled by it, obtain expression of recombinant yeast plasmid pPIC-godL8.
Present invention also offers the recombinant bacterial strain comprising above-mentioned high temperature resistant acidic glucose oxidase gene godL8, it is preferable that described bacterial strain is escherichia coli, yeast, bacillus cereus or lactobacillus, more preferably recombinant pichia yeast strain GS115/godL8.
Present invention also offers a kind of method preparing high temperature resistant acidic glucoseoxidase GODL8, comprise the following steps:
1) with above-mentioned recombinant vector transformed host cell, recombinant bacterial strain is obtained；
2) cultivating recombinant bacterial strain, induction recombination high temperature-resistant acidity glucoseoxidase is expressed；
3) the high temperature resistant acidic glucoseoxidase GODL8 also expressed by purification is reclaimed.
Wherein, it is preferable that described host cell is Pichia pastoris, it is preferable that by expression of recombinant yeast Plastid transformation Pichia pastoris GS115 (Pichiapastoris), obtain recombinant bacterial strain GS115/godL8.
Present invention also offers the application of above-mentioned high temperature resistant acidic glucoseoxidase GODL8, particularly in the application of oxidizing glucose in food, feedstuff and pharmaceuticals industry.
The present invention clones from aspergillus niger AspergillusnigerL75 and obtains a new glucose oxidase gene, the glucoseoxidase of its coding has higher enzyme activity under acidity and neutrallty condition, and its optimum temperature is 45 DEG C, and has good heat stability.
Accompanying drawing explanation
Fig. 1 is the optimum pH of the restructuring glucoseoxidase of the present invention.
Fig. 2 is the pH stability of the restructuring glucoseoxidase of the present invention.
Fig. 3 is the optimum temperature of the restructuring glucoseoxidase of the present invention.
Fig. 4 is the heat stability of the restructuring glucoseoxidase of the present invention..
Detailed description of the invention
Test material and reagent
1, bacterial strain and carrier
The present invention separates from aspergillus niger AspergillusnigerL75 and obtains a kind of new high temperature resistant acidic glucoseoxidase GODL8.Yeast expression vector pPIC9 and bacterial strain GS115 is purchased from Invitrogen company.
2, enzyme and other biochemical reagents
Restricted enzyme and ligase are all purchased from Fermentas company；Other is domestic biochemical reagents.
3, culture medium
(1) Escherichia coli culture medium LB:1% peptone, 0.5% yeast extract, 1%NaCl, pH7.0；
(2) BMGY culture medium: 1% yeast extract, 2% peptone, 1.34%YNB, 0.00004%Biotin, 1% glycerol (V/V)；
(3) BMMY culture medium: replacing glycerol divided by 0.5% methanol, all the other compositions are all identical with BMGY, pH4.0.
Illustrate: following example are not made the experimental methods of molecular biology illustrated, all carry out with reference to concrete grammar listed in " Molecular Cloning: A Laboratory guide " (third edition) J. Pehanorm Brooker one book, or carry out according to test kit and product description.
The clone of glucoseoxidase encoding gene godL8 in embodiment 1 aspergillus niger AspergillusnigerL75
Extract aspergillus niger AspergillusnigerL75 genomic DNA:
Being filtered by the liquid culture mycelium aseptic filter paper of 3 days puts in mortar, adds 2mL extracting solution, grinds 5min, is then placed in by lapping liquid in 50mL centrifuge tube, 65 DEG C of water-bath cracking 20min, mixes once every 10min, the centrifugal 5min of 10000rpm at 4 DEG C.Take supernatant extrct foreigh protein removing in phenol/chloroform, then take supernatant addition equal-volume isopropanol, after room temperature stands 5min, the centrifugal 10min of 10000rpm at 4 DEG C.Abandon supernatant, precipitation with 70% washing with alcohol twice, vacuum drying, add appropriate TE dissolving, be placed in-20 DEG C standby.
According to glucose oxidase gene sequential design synthetic primer P1, P2
P1:5'-GCGAATTCATTTGGTTTCCGATTCTGGCGAGCGCGC-3'；
P2:5'-GCTGCGGCCGCTTACAGGCAATACCAGCAGCCATAATAG-3'。
Pcr amplification is carried out for template with aspergillus niger AspergillusnigerL75 STb gene.PCR response parameter is: 94 DEG C of degeneration 5min；Then 94 DEG C of degeneration 30sec, 45 DEG C of annealing 30sec, 72 DEG C extend 2min, 30 rear 72 DEG C of insulation 10min of circulation.Beijing Bioisystech Co., Ltd of farsighted Boxing section is sent to check order after being connected conversion with pEASY-T3 carrier after this fragment being reclaimed.
Embodiment 2 is recombinated the preparation of glucoseoxidase
Expression vector pPIC9 is carried out double digestion (EcoRI+NotI), simultaneously by the godL8 double digestion (EcoRI+NotI) of coding glucoseoxidase, the genetic fragment cutting out encoding mature glucoseoxidase is connected with expression vector pPIC9, obtain the recombiant plasmid pPIC-godL8 containing aspergillus niger AspergillusnigerL75 glucose oxidase gene godL8 and convert Pichia pastoris GS115, it is thus achieved that recombinant pichia yeast strain GS115/godL8.
Take the GS115 bacterial strain containing recombiant plasmid, be inoculated in 300mLBMGY culture fluid, after 30 DEG C of 250rpm shaken cultivation 48h, centrifugal collection thalline.Then resuspended in 150mLBMMY culture medium, 30 DEG C of 250rpm shaken cultivation.After induction 72h, centrifugal collection supernatant.Measure the vigor of glucoseoxidase.The expression of restructuring glucoseoxidase is 52U/mL.
Embodiment 3 is recombinated the activity analysis of glucoseoxidase
Glucose oxidase activity assay method: GOD determination of activity is generally adopted o-dianisidine spectrophotography.Under aerobic conditions, GOD catalysis glucose dehydrogenation produces H2O2, under peroxidase (GOD) acts on, the o-dianisidine of oxygen donor (DH2) is oxidized to brown product.Measure the change of 540nm place absorbance, according to standard curve result, calculate glucoseoxidase unit of activity.
Embodiment 4 is recombinated the property testing of glucoseoxidase GODL8
1, the optimum pH of glucoseoxidase GODL8 of recombinating and the mensuration of pH stability
The restructuring glucoseoxidase of purification is carried out enzymatic reaction to measure its optimum pH under different pH.The 0.1mol/L citrate-phosphate disodium hydrogen buffer of the different pH of substrate carries out enzyme activity determination at 37 DEG C.Result (Fig. 1) shows, the optimum pH of restructuring glucoseoxidase GODL8 is 4.5, has the relative activity of more than 80% in pH2.0～6.5.Glucoseoxidase GODL8 37 DEG C of process 60min in the buffer of above-mentioned various different pH, then in pH4.5 buffer solution system, at 37 DEG C, measure enzymatic activity, with the pH patience of studying enzyme.Result (Fig. 2) shows that glucoseoxidase GODL8 is all very stable between pH2.0～9.0, and after processing 60min within the scope of this pH, residual enzyme activity is more than 50%, and this illustrates that this enzyme has good pH stability in acidity and neutral range.
2, the optimum temperature of glucoseoxidase GODL8 and thermal stability determination
Being determined as of the optimum temperature of glucoseoxidase GODL8 carries out enzymatic reaction under citrate-phosphate disodium hydrogen buffer (pH4.5) buffer solution system and different temperatures.Temperature tolerance is determined as glucoseoxidase GODL8 and processes different time at different temperatures, then carries out enzyme assay at 37 DEG C.Enzyme reaction optimum temperature measurement result (Fig. 3) shows that its optimum temperature is 45 DEG C, all keeps high enzyme to live at 30～60 DEG C.The heat stabilization test of enzyme shows (Fig. 4), and glucoseoxidase GODL8 has good heat stability, incubation 1h at 70 DEG C, and the enzyme of more than 90% can be kept to live.
3, the impact that glucoseoxidase GODL8 enzyme is lived by different metal ion chemistry reagent measures
Enzymatic reaction system adds different metal ion and the chemical reagent of variable concentrations, studies its impact on enzymatic activity, various materials final concentration of 1 and 5mmol/L.45 DEG C, pH4.5 when measure enzymatic activity.It is shown that most of ions and chemical reagent are recombinated when concentration is 1mmol, the vigor of glucoseoxidase GODL8 does not have significant change, only its vigor of the faint suppression of SDS.Work as Cu2+, Ag+Can partly suppressing glucoseoxidase GODL8 enzyme activity when being 5mmol with beta-mercaptoethanol concentration, 5mmolSDS makes its vigor total loss.
4, glucoseoxidase GODL8 antipepsin and trypsin ability are determined as follows:
With pH2.0KCl-HCl buffer 0.1mg/mL pepsin, pH7.0Tris-HCl buffer 0.1mg/mL trypsin.The glucoseoxidase liquid taking the 0.5mL purification after the dilution of pH2.0KCl-HCl buffer adds 0.5mL pepsin, the glucoseoxidase liquid taking the 0.5mL purification after the dilution of pH7.0Tris-HCl buffer adds the mixing of 0.5mL trypsin, protease/glucoseoxidase (w/w) ≈ 0.1,37 DEG C of insulations 60 and 120min sampling, measure enzymatic activity under pH4.5 and 45 DEG C of conditions.After test result indicate that glucoseoxidase GODL8 pepsin and trypsin treatment 120min, the enzyme of the glucoseoxidase GODL8 after trypsin treatment is lived and than is improve 15% before processing, and the glucoseoxidase GODL8 specific activity after pepsin improves 20% before processing.
Claims (9)
1. a high temperature resistant acidic glucoseoxidase GODL8, it is characterised in that its aminoacid sequence is such as shown in SEQIDNO.1 or SEQIDNO.3.
2. a high temperature resistant acidic glucose oxidase gene godL8, it is characterised in that coding high temperature resistant acidic glucoseoxidase GODL8 described in claim 1.
3. high temperature resistant acidic glucose oxidase gene godL8 as claimed in claim 2, it is characterised in that its base sequence is such as shown in SEQIDNO.4 or SEQIDNO.6.
4. comprise the recombinant vector of high temperature resistant acidic glucose oxidase gene godL8 described in Claims 2 or 3.
5. recombinant vector as claimed in claim 4, it is characterised in that described recombinant vector is pPIC-godL8.
6. comprise the recombinant bacterial strain of high temperature resistant acidic glucose oxidase gene godL8 described in claim 3.
7. recombinant bacterial strain as claimed in claim 6, it is characterised in that described recombinant bacterial strain is Pichi strain GS115/godL8.
8. the method preparing high temperature resistant acidic glucoseoxidase GODL8, it is characterised in that comprise the following steps:
1) with the recombinant vector transformed host cell of claim 4 or 5, it is thus achieved that recombinant bacterial strain；
2) cultivating recombinant bacterial strain, induction recombination high temperature-resistant acidity glucoseoxidase is expressed；
3) the high temperature resistant acidic glucoseoxidase GODL8 also expressed by purification is reclaimed.
9. the application of high temperature resistant acidic glucoseoxidase GODL8 described in claim 1.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610324331.XA CN105779401B (en) | 2016-05-16 | 2016-05-16 | High-temperature-resistant acidic glucose oxidase GODL8, and gene and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610324331.XA CN105779401B (en) | 2016-05-16 | 2016-05-16 | High-temperature-resistant acidic glucose oxidase GODL8, and gene and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105779401A true CN105779401A (en) | 2016-07-20 |
| CN105779401B CN105779401B (en) | 2020-03-17 |
Family
ID=56378894
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610324331.XA Active CN105779401B (en) | 2016-05-16 | 2016-05-16 | High-temperature-resistant acidic glucose oxidase GODL8, and gene and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105779401B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108034642A (en) * | 2017-11-13 | 2018-05-15 | 中国农业科学院饲料研究所 | Glucose oxidase CnGOD19 and its modified enzyme, gene and application |
| WO2018196881A1 (en) * | 2017-04-26 | 2018-11-01 | 中国农业科学院饲料研究所 | Glucose oxidase cngoda and gene and application thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102925375A (en) * | 2012-09-19 | 2013-02-13 | 江南大学 | Engineered yeasts producing glucose oxidase and construction method and use thereof |
| CN102994406A (en) * | 2012-09-19 | 2013-03-27 | 江南大学 | Genetically engineered bacterium for producing glucose oxidase as well as construction and application thereof |
| CN103275942A (en) * | 2013-04-03 | 2013-09-04 | 北京挑战生物技术有限公司 | Glucose oxidase GODJ4A, and gene and application thereof |
-
2016
- 2016-05-16 CN CN201610324331.XA patent/CN105779401B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102925375A (en) * | 2012-09-19 | 2013-02-13 | 江南大学 | Engineered yeasts producing glucose oxidase and construction method and use thereof |
| CN102994406A (en) * | 2012-09-19 | 2013-03-27 | 江南大学 | Genetically engineered bacterium for producing glucose oxidase as well as construction and application thereof |
| CN103275942A (en) * | 2013-04-03 | 2013-09-04 | 北京挑战生物技术有限公司 | Glucose oxidase GODJ4A, and gene and application thereof |
Non-Patent Citations (2)
| Title |
|---|
| NCBI: "GenBank Accession NO:XP_001395420.1", 《NCBI GENBANK》 * |
| 周亚凤等: "黑曲霉葡萄糖氧化酶基因的克隆及其在酵母中的高效表达", 《生物工程学报》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2018196881A1 (en) * | 2017-04-26 | 2018-11-01 | 中国农业科学院饲料研究所 | Glucose oxidase cngoda and gene and application thereof |
| CN108034642A (en) * | 2017-11-13 | 2018-05-15 | 中国农业科学院饲料研究所 | Glucose oxidase CnGOD19 and its modified enzyme, gene and application |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105779401B (en) | 2020-03-17 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103003297B (en) | The asparaginase of basidiomycetes | |
| JP4495758B2 (en) | Detoxification enzyme having activity to convert aflatoxin, and gene encoding this enzyme | |
| CN101348794B (en) | Encoding gene of high activity glucose oxidase, preparation and use thereof | |
| CN107384900B (en) | The acid protease 6749 and its gene of a kind of originated from fungus and application | |
| EP1902129B1 (en) | Novel enzymes for use in enzymatic bleaching of food products | |
| JP4267696B2 (en) | Enzyme having galactanase activity | |
| CN101348795B (en) | Encoding gene of glucose oxidase, preparation and use thereof | |
| CN114395540B (en) | Application of aspergillus coronary glucose oxidase in improving flour processing quality | |
| CN105779401A (en) | High temperature resistant acidic glucose oxidase GODL8 as well as gene and application thereof | |
| de Almeida Parizotto et al. | Increased glycosylated L-asparaginase production through selection of Pichia pastoris platform and oxygen-methanol control in fed-batches | |
| CN113874498A (en) | Thermostable glucose oxidase | |
| CN107475222B (en) | Genetically engineered heat-resistant human lysozyme | |
| CN109371004B (en) | Acid protease Bs2688 mutant K203E with improved thermal stability and gene and application thereof | |
| Cohen et al. | Mn 2+ alters peroxidase profiles and lignin degradation by the white-rot fungus Pleurotus ostreatus under different nutritional and growth conditions | |
| CN107988190B (en) | Acid protease and coding gene and application thereof | |
| CN112920280B (en) | Method for efficiently expressing acid protease and application thereof | |
| CN107338234B (en) | Production method and application of novel rhizomucor miehei aspartic acid protease | |
| US5529926A (en) | Cloning and expression of DNA encoding a ripening form of a polypeptide having sulfhydryl oxidase activity | |
| KR101632262B1 (en) | Agar-derived neoagarooligosaccharide complex for the prevention and treatment of obesity and/or diabetes comprising enzyme reaction products of beta agarase DagA and agar | |
| EP1944373A2 (en) | Method for purifying interleukin 1 receptor antagonist (IL-1ra) proteins | |
| WO2016097270A1 (en) | Process for bleaching a food product | |
| CN110885801B (en) | Glucose oxidase M5GOD and coding gene and application thereof | |
| CN108795891B (en) | Glucose oxidase CnGODA as well as gene and application thereof | |
| CN107988177B (en) | Glucose oxidase mutant | |
| CN112877306B (en) | Super-heat-resistant glucose oxidase AtGOD and gene and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |