CN105755104A - Method for detecting gene engineering enzyme activity - Google Patents
Method for detecting gene engineering enzyme activity Download PDFInfo
- Publication number
- CN105755104A CN105755104A CN201610176972.5A CN201610176972A CN105755104A CN 105755104 A CN105755104 A CN 105755104A CN 201610176972 A CN201610176972 A CN 201610176972A CN 105755104 A CN105755104 A CN 105755104A
- Authority
- CN
- China
- Prior art keywords
- carrier
- repeated
- fragment
- seqidno
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/34—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving hydrolase
- C12Q1/44—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving hydrolase involving esterase
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/02—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving viable microorganisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/02—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving viable microorganisms
- C12Q1/04—Determining presence or kind of microorganism; Use of selective media for testing antibiotics or bacteriocides; Compositions containing a chemical indicator therefor
- C12Q1/06—Quantitative determination
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Toxicology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a method for detecting gene engineering nuclease activity. A vector containing double repeating segments and a to-be-detected nuclease target sequence located between the double repeating segments are subjected to co-transformation with gene engineering nuclease, differences of escherichia coli colonies formed through the co-transformation and through single transformation without gene engineering enzyme are compared, and the shearing activity of the to-be-detected gene engineering enzyme to to-be-detected target sequences is determined. The method has application value in qualitative and quantitative analysis of genes.
Description
Technical field
The present invention relates to field of biology, be specifically related to gene engineering technology field.
Background technology
The reporter gene assays technology of prior art, as blue white macula screens and antibiotic-screening, is widely used in biology field.
Blue white macula screening (beta galactosidase system) is selection markers more common in molecular biology experiment, has efficient and simple advantage, is mainly used in basic research, including improving cloning efficiency.In recent years, blue white macula screening is for the external basic research of somatic mutation, the latter such as big-blue mice and rat (ref)；And the gene analysis for the sudden change of human inheritance's property.But blue white macula triage techniques is for mankind's KRAS gene mutation, or a kind of there is new technique yet-to-be developed.
In vitro study, examples of such carriers carries lacZ gene, the N-end (α-peptide) of its coding beta-galactosidase, and it is under inducer IPTG (isopropyl-β-D-thiogalactoside, similar with lactose structure but can not be degraded by the beta galactosidase) promoter regulation induced.The Host Strains of Plastid transformation is LacZ △ M15 genotype (gene of the beta-galactosidase polypeptides containing coding N-end deficiency).After the Plastid transformation Host Strains do not recombinated, under the induction of IPTG, plasmid and Host Strains express defect but two peptides (i.e. α-complementary) can mutually compensating for respectively, define the beta galactosidase of function, this enzyme can become galactose and the bromo-4-of navy blue 5-chloro-indigo X-gal (the bromo-4-of 5-chloro-3-indole-β-D-galactoside) Substrate hydrolysis colourless in culture medium, and bacterium colony presents blueness.But when foreign DNA inserts the multiple clone site that plasmid is arranged in α-peptide-coding sequence, owing to destroying the reading frame of α-peptide, its α-peptide encoded is made to lose activity, then the antibacterial at recon place can not complete α complementation, activated beta galactosidase can not be formed, cause recombinant bacterium to form white colony.Therefore, it can filter out recon by blue white macula.The present invention comes therefrom.
Summary of the invention
The technical problem to be solved in the present invention is to provide and a kind of can detect the method that genetic engineering nuclease has inactive and active height on escherichia coli.The present invention, by building the target sequence carrier to be measured containing double; two repeated fragments, carries out cotransformation with genetic engineering enzyme, and after utilizing double; two conversion, produced bacterium colony change, is estimated nuclease.
The technological core of the present invention is the carrier that the identical repetitive sequence of double; two copy is contained at target sequence two ends to be measured.
For solving above-mentioned technical problem, the invention provides a kind of method detecting genetic engineering nuclease vigor, it is characterised in that comprise the steps:
(1) choose containing the carrier carrying lacZ gene,
(2) carrier containing double; two repeated fragments is built: be inserted in described carrier by two repeated fragments, and the target sequence of determined nucleic acid enzyme is inserted between two repeated fragments, the reading frame that two repeated fragments are Movement Report gene that the sequence of two described repeated fragments is completely the same and described；
(3) carrier containing genetic engineering nuclease with double; two repeated fragments step (2) built carries out converting in the culture medium containing X-Gal-IPTG,
(4) form result according to the bacterium colony of cotransformation enzyme activity is evaluated.
In a currently preferred technical scheme, described carrier comprises but is not limited to PMD19-T, PMD18-T, CRISPR/Cas9.
In a currently preferred technical scheme, the length of described repeated fragment is 10 to 50 bases.
In a currently preferred technical scheme, described repeated fragment includes EGFR repeated fragment, and its nucleotide sequence is such as shown in SeqIDNo.1；HBV repeated fragment, its nucleotide sequence is such as shown in SeqIDNo.2；LoxP repeated fragment, its nucleotide sequence is such as shown in SeqIDNo.3.
In a currently preferred technical scheme, in described step (4), bacterium colony forms result and includes: the difference that the blueness of colony colour and the difference of white, difference with presence or absence of bacterium colony, bacterium colony are how many.
In a currently preferred technical scheme, the target sequence of determined nucleic acid enzyme is selected from: proangiotensin (AGT) gene, it is preferable that have the nucleotide sequence as shown in SeqIDNo.4 or 5.
After nucleic acid target sequence is sheared by nucleic acid in living cell enzyme, the main reparation that two ways occurs: non-homologous end joining and homology reparation.In prokaryotic cell, non-homologous end joining seldom occurs or does not occur completely；Homology reparation is then because sequence difference causes different efficiency.
For the homologous recombination in standardization and efficient escherichia coli body, we build and compare the multiple carrier containing double; two repeated fragments using value in nuclease detects.Three kinds of carriers all can have the ability of detection genetic engineering enzymatic activity, and wherein with higher containing mankind's HBV virus repeated fragment and the carrier efficiency containing phage LoxP repeated fragment.
When this dual multiple fragment vector combines with blue white macula screening, target sequence to be measured and repeated fragment are respectively positioned within alpha-polypeptide gene coded sequence, and making coding framework generation frameshit effect, such carrier self converts the escherichia coli obtained and shows as white.Meanwhile, devising during vector construction makes gene reading frame frame reply after there is recombining reaction between repeated fragment.So, after genetic engineering enzyme makes target sequence shear when cotransformation, the bacterium colony speckle of blueness can be formed.The formation of blue colonies speckle, it was shown that the shearing of nuclease has occurred and that.Blue colonies speckle number, to nuclease shear vigor size relevant.
This dual multiple fragment vector combines when can also be applied to other selectivity target genes.No matter being applied to which kind of selected gene, the dual multiple genes fragment in this method can derive from several genes, it is necessary to satisfied condition is: 1) sequence of repeated fragment is completely the same；2) target sequence of determined nucleic acid enzyme must be positioned between two repeated fragments；3) it is containing only the reading frame recovering reporter gene when having a repeated fragment when ensureing during design vector containing double; two repeated fragment after the reading frame of Movement Report gene and restructuring.
The shearing of nuclease is had straightforward by the present invention, and sensitivity is high, quickly, and the advantage such as cheap.
By using the carrier containing double; two repeated fragments, when with genetic engineering enzyme cotransformation, genetic engineering enzyme can shear the target sequence in the middle of repeated fragment, cause occurring reconfiguring of repeated fragment in escherichia coli, show the change of bacterial clump quantity or color, thereby determine that determined nucleic acid enzyme whether target sequence be there occurs shear and shear number.The present invention can be used for screening the suitable of nuclease and non-suitable target sequence, and for screening the efficient genetic engineering enzyme determining target sequence.
Accompanying drawing explanation
Below in conjunction with drawings and Examples, the invention will be further described:
Fig. 1 is the EGFR repetitive sequence carrier sequencing result in embodiment 1 containing 25bp target spot.
Fig. 2 is the EGFR repetitive sequence carrier colony growth on Amp-X-Gal-IPTG culture dish in embodiment 1 containing 25bp target spot.
Fig. 3 is the HBV repetitive sequence carrier sequencing result in embodiment 2 containing 24bp target spot.
Fig. 4 is that the HBV repetitive sequence carrier containing 24bp target spot in embodiment 2 cultivates bacterium colony on Amp-X-Gal-IPTG culture dish.
Fig. 5 is the LoxP repetitive sequence carrier sequencing result in embodiment 3 containing 24bp target spot.
Fig. 6 is the LoxP repetitive sequence carrier bacterium colony on Amp-X-Gal-IPTG culture dish is cultivated in embodiment 3 containing 24bp target spot.
Fig. 7 is that in embodiment 4, CRISPR/Cas9 carrier cultivates bacterium colony on Cl-X-Gal-IPTG culture dish.
Fig. 8 is the CRISPR/Cas9 plasmid sequencing result in embodiment 4 containing corresponding gRNA.
Fig. 9 is that the carrier built in embodiment 1 grows at Amp-Cl-X-Gal-IPTG culture dish with CRISPR/Cas9 carrier cotransformation bacterium colony.
Figure 10 is blue colonies sequencing result in Fig. 9.
Figure 11 is by the carrier in embodiment 2 and the CRISPR/Cas9 carrier cotransformation Amp-Cl-X-Gal-IPTG culture dish colony growth figure in embodiment 4 in embodiment 5.
Figure 12 is blue colonies sequencing result in Figure 11.
Figure 13 is by the carrier in embodiment 3 and the CRISPR/Cas9 carrier cotransformation Amp-Cl-X-Gal-IPTG culture dish growing state in embodiment 4.
Figure 14 is blue colonies sequencing result in Figure 13.
Detailed description of the invention
Below in conjunction with specific embodiment, such scheme is described further.Should be understood that these embodiments to be an illustration for the present invention and be not limited to restriction the scope of the present invention.The implementation condition adopted in embodiment can do further adjustment according to the condition that concrete application requires, not marked implementation condition is generally the condition in normal experiment.
One, material and equipment
1. laboratory animal or material source and process
PMD-19T (A1360) purchased from American promega company；PCas9 traces to the source precise and tiny Science and Technology Ltd. purchased from Beijing；General primer or oligonucleotide are synthesized by Jin Weizhi bio tech ltd, Suzhou.
null2. key instrument: regular-PCR instrument (Hangzhou Bo company)、Water isolation type constant incubator (the permanent Scientific Instruments Corporation in Shanghai one)、Milli-Q ultra-pure water instrument (Shanghai Rephile Biotechnology Co., Ltd.)、DK-600B electric heating constant temperature tank (the upper grand company of Nereid)、MICROCL17 centrifuge (Thermo company)、Air-tech superclean bench (Su Jing group)、-80 DEG C of cryogenic refrigerators (SANYO company)、Electronic analytical balance (Sartorius company of the U.S.)、Labworks image acquisition and analysis software (multiple day is scientific and technological)、High-pressure sterilizing pot (the rich news in Shanghai)、4 DEG C of refrigerators (Qingdao Haier)、5810R low-temperature and high-speed centrifuge (Eppendorf company)、Micropipettor (Eppendorf company)、Room temperature high speed centrifuge (Eppendorf company)、DDY-5 type voltage stabilization and current stabilization electrophresis apparatus (Liuyi Instruments Plant, Beijing).
3. main agents: EColi.DH5a bacterial strain, the centrifugal common DNA product of column type reclaim test kit, centrifugal column type plasmid is little carries middle amount test kit mainly purchased from Beijing Tian Gen company；1000bpDNALadder, HindIII, KpnI, Eco31I main purchased from American Fermentas company；T4PNK, T4ligase main purchased from American NEB company；Ampicillin, chloromycetin, electrophoresis level agar powder, tryptone, yeast extract, agar, EB, dehydrated alcohol, sodium chloride, Tris-bas, EDTA, DMSO, IPTG, X-Gal etc. are main purchased from Alpha biological reagent company.Order-checking service is provided by Jin Weizhi bio tech ltd, Suzhou.
Embodiment one, the structure dual multiple fragment vector containing human EGFR gene fragment
First with KpnI and HindIII, PMD19-T carrier is carried out double digestion, be inserted into EGFR repetitive sequence, and original KpnI and HindIII restriction enzyme site is suddenlyd change, build the carrier containing EGFR repetitive sequence.Again with KpnI and HindIII, the carrier containing EGFR repetitive sequence is carried out double digestion, insert the target sequence of 25bp, making carrier be in frameshit state, build the EGFR repetitive sequence carrier containing target spot, this carrier is grown to white colony under X-Gal and IPTG induces.
Primer used by carrier construction is as follows:
Re-EGFR-F:AGCTCCAAGGAACTGGTAGCAAGCTTGACGATATCTGGTACCCAAG GAACTGGTAGCAGTAC, as shown in SeqIDNo.6.
Re-EGFR-R:TGCTACCAGTTCCTTGGGTACCAGATATCGTCAAGCTTGCTACCAG TTCCTTGG, as shown in SeqIDNo.7.
Target-25-F:AGCTTGCCCAGCTGCTGCTGTCCACGGTGGGGTAC, as shown in SeqIDNo.8.
Target-25-R:CCCACCGTGGACAGCAGCAGCTGGGCA, as shown in SeqIDNo.9.
EGFR repetitive sequence carrier sequencing result containing 25bp target spot is as it is shown in figure 1, (two ends are labeled as EGFR repetitive sequence, and central marker is target spot).
EGFR repetitive sequence is CAAGGAACTGGTAGC, as shown in SeqIDNo.1.
Target sequence is GCCCAGCTGCTGCTGTCCACGGTGG, as shown in SeqIDNo.4.
Colony growth is as shown in Figure 2 on Amp-X-Gal-IPTG culture dish for EGFR repetitive sequence carrier containing 25bp target spot.
Embodiment two, the structure dual multiple fragment vector containing mankind's HBV viral fragment
First with KpnI and HindIII, PMD19-T carrier is carried out double digestion, be inserted into HBV repetitive sequence, and original KpnI and HindIII restriction enzyme site is suddenlyd change, build the carrier containing HBV repetitive sequence.Again with KpnI and HindIII, the carrier containing HBV repetitive sequence is carried out double digestion, insert the target sequence of 24bp, making carrier be in frameshit state, build the HBV repetitive sequence carrier containing target spot, this carrier is grown to white colony under X-Gal and IPTG induces.
Primer used by carrier construction is as follows:
Re-HBV-F:AGCTCACTCTGGCTAACTAGGGAACCCTTCACCTCTGCAAGCTTCAC GATATCTGGTACCTCACTCTGGCTAACTAGGGAACCCTTCACCTCTGCAGTAC, as shown in SeqIDNo.10.
Re-HBV-R:TGCAGAGGTGAAGGGTTCCCTAGTTAGCCAGAGTGAGGTACCAGATA TCGTGAAGCTTGCAGAGGTGAAGGGTTCCCTAGTTAGCCAGAGTG, as shown in SeqIDNo.11.
Target-24-F:AGCTTCCCAGCTGCTGCTGTCCACGGTGGGGTAC, as shown in SeqIDNo.12.
Target-24-R:CCCACCGTGGACAGCAGCAGCTGGGA, as shown in SeqIDNo.13.HBV repetitive sequence carrier sequencing result containing 24bp target spot is (two ends are labeled as HBV repetitive sequence, and central marker is target spot) as shown in Figure 3.
HBV repetitive sequence is ACTCTGGCTAACTAGGGAACCCTTCACCTCTGC, as shown in SeqIDNo.2.
Target sequence is CCCAGCTGCTGCTGTCCACGGTGG, as shown in SeqIDNo.5.It is white that HBV repetitive sequence carrier containing 24bp target spot cultivates bacterium colony on Amp-X-Gal-IPTG culture dish, as shown in Figure 4.
Embodiment three, the structure dual multiple fragment vector containing phage LoxP fragment
First with KpnI and HindIII, PMD19-T carrier is carried out double digestion, be inserted into LoxP repetitive sequence, and original KpnI and HindIII restriction enzyme site is suddenlyd change, build the carrier containing LoxP repetitive sequence.Again with KpnI and HindIII, the carrier containing LoxP repetitive sequence is carried out double digestion, insert the target sequence of 24bp, making carrier be in frameshit state, build the LoxP repetitive sequence carrier containing target spot, this carrier is grown to white colony under X-Gal and IPTG induces.
Primer used by carrier construction is as follows:
Re-LOXP-F:AGCTCGATAACTTCGTATAATGTATGCTATACGAAGTTATCAAGCT TCACGATATCTGGTACCTCGATAACTTCGTATAATGTATGCTATACGAAGTTATCA GTAC, as shown in SeqIDNo.14.
Re-LOXP-R:TGATAACTTCGTATAGCATACATTATACGAAGTTATCGAGGTACCA GATATCGTGAAGCTTGATAACTTCGTATAGCATACATTATACGAAGTTATCG, as shown in SeqIDNo.15.
Target-24-F:AGCTTCCCAGCTGCTGCTGTCCACGGTGGGGTAC, as shown in SeqIDNo.16.
Target-24-R:CCCACCGTGGACAGCAGCAGCTGGGA, as shown in SeqIDNo.17.Build the LoxP repetitive sequence carrier sequencing result (both sides are labeled as LoxP repetitive sequence, and central marker is target spot) as shown in Figure 5 containing 24bp target spot.
LoxP repetitive sequence is shown in GATAACTTCGTATAATGTATGCTATACGAAGTTATC, SeqIDNo.3.
Target sequence is CCCAGCTGCTGCTGTCCACGGTGG, as shown in SeqIDNo.5.
Building the bacterium colony on Amp-X-Gal-IPTG culture dish is cultivated of the LoxP repetitive sequence carrier containing 24bp target spot is white, as shown in Figure 6.
Embodiment four, the utilization dual multiple fragment vector containing EGFR gene fragment carry out escherichia coli leucismus Fructus polygoni tinctorii and test
First with BsaI, CRISPR/Cas9 plasmid is carried out enzyme action, insert gRNA sequence, build the CRISPR/Cas9 carrier containing corresponding gRNA.
Build containing the primer used by gRNACRISPR/Cas9 carrier as follows:
GRNA-F:AAACCAGCTGCTGCTGTCCACGGG, as shown in SeqIDNo.18.
GRNA-R:AAAACCCGTGGACAGCAGCAGCTG, as shown in SeqIDNo.19.
It is white that CRISPR/Cas9 carrier cultivates bacterium colony on Cl-X-Gal-IPTG culture dish, as shown in Figure 7.CRISPR/Cas9 plasmid sequencing result containing corresponding gRNA is as shown in Figure 8.
By the carrier that built in embodiment one and CRISPR/Cas9 carrier cotransformation, incubated overnight on Amp-Cl-X-Gal-IPTG culture dish, blue colonies occurs, and select blue colonies and check order.Sequencing result shows, shear action occurs CRISPR/Cas9 so that the EGFR repetitive sequence on carrier both sides is recombinated in embodiment one, makes carrier recovery reading frame, so being grown to blue colonies under X-Gal and IPTG induces.
The carrier built in embodiment one grows as shown in Figure 9 at Amp-Cl-X-Gal-IPTG culture dish with CRISPR/Cas9 carrier cotransformation bacterium colony.Blue colonies sequencing result is as shown in Figure 10.Embodiment five, the utilization dual multiple fragment vector containing mankind's HBV viral fragment carry out escherichia coli leucismus Fructus polygoni tinctorii and test
The CRISPR/Cas9 carrier cotransformation that will build in the carrier that build in embodiment two and embodiment four, incubated overnight on Amp-Cl-X-Gal-IPTG culture dish, blue colonies occurs, and selects blue colonies and check order.Sequencing result shows, shear action occurs CRISPR/Cas9 so that the HBV repetitive sequence on carrier both sides is recombinated in embodiment two, makes carrier recovery reading frame, so being grown to blue colonies under X-Gal and IPTG induces.
Bacterium colony grows as shown in figure 11 at Amp-Cl-X-Gal-IPTG culture dish.Blue colonies sequencing result is as shown in figure 12.
Embodiment six, the utilization dual multiple fragment vector containing phage LoxP fragment carry out escherichia coli leucismus Fructus polygoni tinctorii and test
The CRISPR/Cas9 carrier cotransformation that will build in the carrier that build in embodiment three and embodiment four, incubated overnight on Amp-Cl-X-Gal-IPTG culture dish, blue colonies occurs, and selects blue colonies and check order.Sequencing result shows, shear action occurs CRISPR/Cas9 so that the LoxP repetitive sequence on carrier both sides is recombinated in embodiment three, makes carrier recovery reading frame, so being grown to blue colonies under X-Gal and IPTG induces.
Bacterium colony grows as shown in figure 13 at Amp-Cl-X-Gal-IPTG culture dish.Blue colonies sequencing result is as shown in figure 14.
Claims (7)
1. the method detecting genetic engineering enzyme activity, it is characterised in that it comprises the steps:
(1) choose containing the carrier carrying lacZ gene,
(2) carrier containing double; two repeated fragments is built: be inserted in described carrier by two repeated fragments, and the target sequence of determined nucleic acid enzyme is inserted between two repeated fragments, the reading frame that two repeated fragments are Movement Report gene that the sequence of two described repeated fragments is completely the same and described；
(3) carrier containing genetic engineering nuclease with double; two repeated fragments step (2) built carries out converting in the culture medium containing X-Gal-IPTG,
(4) form result according to the bacterium colony of cotransformation enzyme activity is evaluated.
2. detection method according to claim 1, it is characterised in that described carrier is selected from PMD19-T, PMD18-T, CRISPR/Cas9.
3. detection method according to claim 1, it is characterised in that the length of described repeated fragment is 10 to 50 bases.
4. detection method according to claim 1, it is characterised in that described repeated fragment includes EGFR repeated fragment, its nucleotide sequence is such as shown in SeqIDNo.1；HBV repeated fragment, its nucleotide sequence is such as shown in SeqIDNo.2；LoxP repeated fragment, its nucleotide sequence is such as shown in SeqIDNo.3.
5. the detection method according to any one of claim 1-4, it is characterised in that described determined nucleic acid enzyme is proangiotensin AGT gene.
6. the detection method according to any one of claim 1-4, it is characterised in that shown in the target sequence fragment such as SeqIDNo.4 or 5 of described determined nucleic acid enzyme.
7. detection method according to claim 1, it is characterised in that in described step (4), bacterium colony forms result and includes: the difference that the blueness of colony colour and the difference of white, difference with presence or absence of bacterium colony, bacterium colony are how many.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610176972.5A CN105755104A (en) | 2016-03-25 | 2016-03-25 | Method for detecting gene engineering enzyme activity |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610176972.5A CN105755104A (en) | 2016-03-25 | 2016-03-25 | Method for detecting gene engineering enzyme activity |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN105755104A true CN105755104A (en) | 2016-07-13 |
Family
ID=56345682
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610176972.5A Pending CN105755104A (en) | 2016-03-25 | 2016-03-25 | Method for detecting gene engineering enzyme activity |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105755104A (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102174649A (en) * | 2011-01-18 | 2011-09-07 | 陕西师范大学 | Method for rapidly detecting zinc-finger nuclease mediated gene fixed point integration |
| EP2188384B1 (en) * | 2007-09-27 | 2015-07-15 | Sangamo BioSciences, Inc. | Rapid in vivo identification of biologically active nucleases |
-
2016
- 2016-03-25 CN CN201610176972.5A patent/CN105755104A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2188384B1 (en) * | 2007-09-27 | 2015-07-15 | Sangamo BioSciences, Inc. | Rapid in vivo identification of biologically active nucleases |
| CN102174649A (en) * | 2011-01-18 | 2011-09-07 | 陕西师范大学 | Method for rapidly detecting zinc-finger nuclease mediated gene fixed point integration |
Non-Patent Citations (3)
| Title |
|---|
| RAN FA ET AL.: "Double Nicking by RNA-Guided CRISPR Cas9 for Enhanced Genome Editing Specificity", 《CELL》 * |
| 潘韵芝: "蓝白斑筛选技术的改进及其生物医学应用", 《中国优秀硕士学位论文全文数据库医药卫生科技辑》 * |
| 王令等: "快速构建CRISPR/Cas9基因组靶向编辑系统", 《中国生物化学与分子生物学报》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108504657B (en) | The method for knocking out HEK293T cell KDM2A gene using CRISPR-CAS9 technology | |
| Yan et al. | Cre/lox system and PCR-based genome engineering in Bacillus subtilis | |
| CN107075452A (en) | The promoter and its application method of adenine A Shi yeast are conciliate from Yarrowia lipolytica | |
| WO2002014495B1 (en) | Enhanced homologous recombination mediated by lambda recombination proteins | |
| CN112080521B (en) | Recombinant pseudorabies virus vector construction for expressing foreign protein and preparation method of recombinant pseudorabies virus | |
| CN108118059A (en) | Carrier and the application of a kind of improved promoter and its composition | |
| CN107723287B (en) | Expression system for enhancing production and preparation of silk protein | |
| CN108588102A (en) | Carrier T and the application of a kind of pre-T carrier and its composition | |
| CN107602707A (en) | The dcas9 ω fusion proteins of one species specificity regulation bacillus subtilis exogenous gene expression and its application | |
| CN112899296A (en) | Transposase screening report vector and preparation method and application thereof | |
| CN109486845B (en) | Method for accurately regulating and controlling gene expression of corynebacterium glutamicum | |
| CN103131718A (en) | Cloning of hypertonicity-resistant functional gene CgHog1 from Candida glycerinogenes and application thereof | |
| CN105755104A (en) | Method for detecting gene engineering enzyme activity | |
| Huo et al. | Identifying amino acid overproducers using rare-codon-rich markers | |
| Contursi et al. | Identification and autonomous replication capability of a chromosomal replication origin from the archaeon Sulfolobus solfataricus | |
| CN113549621B (en) | Minimal promoter for enhancing activity and expression of foreign protein in bacteria | |
| Xiong et al. | Directed evolution of a beta-galactosidase from Pyrococcus woesei resulting in increased thermostable beta-glucuronidase activity | |
| CN115772533A (en) | Bacteria continuous evolution system, orthogonal error-prone DNA polymerase and continuous evolution method | |
| CN108060168A (en) | Carrier T and the application of a kind of improved promoter and its composition | |
| Borne et al. | Engineering of a new Escherichia coli strain efficiently metabolizing cellobiose with promising perspectives for plant biomass-based application design | |
| CN107083375B (en) | Medium-temperature alpha-amylase and gene and application thereof | |
| Jiang et al. | Screening and application of inducible promoters in Ruminiclostridium papyrosolvens | |
| CN106480031B (en) | Bacillus expresses promoter and its application | |
| CN103849640B (en) | A kind of oligonucleotide and the method for plasmid cotransformation for the point mutation of intestinal bacteria indispensable gene can be eliminated | |
| CN114774421B (en) | Mutant of endogenous promoter of zymomonas mobilis |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB03 | Change of inventor or designer information |
Inventor after: Wang Qian Inventor after: Lu Guangming Inventor after: Xiao Li Inventor after: Zhou Lin Inventor after: Zhou Cuilan Inventor after: Xu Huifen Inventor after: Zhang Andi Inventor after: Zhang Jia Inventor after: Li Kai Inventor before: Wang Qian Inventor before: Zhou Lin Inventor before: Zhou Cuilan Inventor before: Xu Huifen Inventor before: Zhang Andi Inventor before: Zhang Jia Inventor before: Li Kai |
|
| COR | Change of bibliographic data | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20160713 |
|
| RJ01 | Rejection of invention patent application after publication |