CN105753949A - Erysipelothrix rhusiopathiae antigen protein and application thereof - Google Patents
Erysipelothrix rhusiopathiae antigen protein and application thereof Download PDFInfo
- Publication number
- CN105753949A CN105753949A CN201610245012.XA CN201610245012A CN105753949A CN 105753949 A CN105753949 A CN 105753949A CN 201610245012 A CN201610245012 A CN 201610245012A CN 105753949 A CN105753949 A CN 105753949A
- Authority
- CN
- China
- Prior art keywords
- vaccine
- antigen protein
- pota
- erysipelothrix
- piglets
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/02—Bacterial antigens
- A61K39/0208—Specific bacteria not otherwise provided for
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/55—Medicinal preparations containing antigens or antibodies characterised by the host/recipient, e.g. newborn with maternal antibodies
- A61K2039/552—Veterinary vaccine
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- General Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Medicinal Chemistry (AREA)
- Microbiology (AREA)
- Gastroenterology & Hepatology (AREA)
- Epidemiology (AREA)
- Animal Behavior & Ethology (AREA)
- Mycology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Pharmacology & Pharmacy (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Genetics & Genomics (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Peptides Or Proteins (AREA)
Abstract
The invention discloses an erysipelothrix rhusiopathiae antigen protein and application thereof.An amino acid sequence of the antigen protein is as shown in SEQ ID NO.2, and a corresponding nucleotide sequence of the antigen protein is as shown in SEQ ID NO.1.After the antigen protein is subjected to sterile treatment, proportionally mixed with an adjuvant and immunized intramuscularly to piglets, the survival rate of infected piglets can be effectively increased, and recovery speed of the piglets is increased.According to safety test, adverse reactions are avoided after immunization of weaned piglets and gestational sows.In addition, the erysipelothrix rhusiopathiae antigen protein is long in immunity period and effective in control of various serotypes of erysipelothrix, thereby being extremely high in market development potential.
Description
Technical field
The present invention relates to domestic animal recombinant vaccine field, be specifically related to a kind of erysipelothrix rhusiopathiae antigen albumen and application.
Technical background
Pig erysipelas is one of the big infectious disease of pig three nineties in last century, along with the use of weak poison and commercial vaccine obtains effective control gradually.But since 2010, pig erysipelas is at China's drug in some provinces happening and prevelence.Within 2012, pig erysipelas case increases gradually, to 2013, all occurs in that the popular on a large scale of pig erysipelas in multiple provinces such as China Hunan, Hubei, Jiangxi, Guangxi, Sichuan, Guangdong, Zhejiang, causes huge economic loss to pig farm.
Conventional penicillin can treat pig erysipelas as specific drug, does not also find a penicillin-fast erysipelothrix ruhsiopathiae of strain in the world.But, what generation one-tenth of Hunan Animal Disease Center et al. has been separated in current pig erysipelas breaks out carries out 3 strain penicillin resistant erysipelothrix ruhsiopathiaes.The drug resistance analysis being clinically separated erysipelothrix ruhsiopathiae of Hubei province is shown by this laboratory, is 100% to conventional kanamycin, streptomycin, amikacin, polymyxin B, vancomycin, 6 kinds of antibiotics resistance rates of gentamycin.
Epidemiologic data existing enough at present confirms, the aquaculture of China and people ' s health are constituted serious threat by erysipelothrix ruhsiopathiae.
Erysipelothrix ruhsiopathiae commercial vaccine mainly has inactivated vaccine C43-5, attenuated vaccine G4T10 and GC42.Use inactivated vaccine that the erysipelothrix ruhsiopathiae of homology has good immunoprotection, but owing to the virulence gene phenotype of different strains exists larger difference, the protection for heterologous strain is not good, and immune duration was up to 6 months.Pig erysipelas Attenuate vaccine is for pigs more than 3 monthly ages, and after immunity, 7d produces immunity, sustainable 6 months.Attenuated vaccine can make pig be protected, but can not remove the erysipelothrix ruhsiopathiae settled down in tonsil or joint, can not remove the antibacterial in inapparent infection pig tonsil.It addition, maternal antibody and medicine are easy to the effect of interference vaccine, if weak poison live strain returns poison, be there is very big risk by it in susceptible swinery.
In consideration of it, the present invention gets down to the research of erysipelothrix ruhsiopathiae protective antigen, find and be provided that the antigenic component that efficient immunity, bio-safety are good, the invasion and attack of protection pig opposing epidemic isolates.
Summary of the invention
Having it is an object of the invention to provide a kind of erysipelothrix rhusiopathiae antigen albumen, its sequence is shown in SEQIDNO.2.The nucleotides sequence of its correspondence is classified as shown in SEQIDNO.1.
Last purpose of the present invention there are provided the application in preparing swine erysipelas vaccine of a kind of erysipelothrix rhusiopathiae antigen albumen, it is mixed in proportion with adjuvant after this albumen aseptic process, intramuscular immunisation piglet, it has been found that it can effectively provide piglet survival rate after counteracting toxic substances, accelerates piglet resume speed.
In order to achieve the above object, the present invention takes techniques below measure:
A kind of erysipelothrix rhusiopathiae antigen albumen, its sequence is shown in SEQIDNO.2.Available conventional scheme, for instance synthesis, the mode such as prokaryotic expression obtains this albumen.
The nucleotide sequence that aminoacid sequence shown in SEQIDNO.2 is corresponding is also protection scope of the present invention, it is preferred that described nucleotides sequence is classified as shown in SEQIDNO.1.
The application in preparing swine erysipelas vaccine of a kind of erysipelothrix rhusiopathiae antigen albumen, is mixed in proportion with adjuvant including after utilizing this albumen aseptic process, prepares for swine erysipelas vaccine；Or this vaccine is multiple vaccines with the combination preparation of other known vaccine.
Compared with existing vaccine, the invention have the advantages that
There is virulence and return strong danger in Attenuate vaccine, susceptible swinery can be caused huge threat, and the mechanism of virulence attenuation of is not very clear.Inactivated vaccine can provide good protected effect for homology erysipelothrix ruhsiopathiae, but the virulence gene of different strains there are differences, and it is very weak to the protected effect of heterologous strain.The protected effect that subunit vaccine provided by the invention has had, biological safety is high.
Accompanying drawing explanation
Fig. 1 is the PotA Protein Detection schematic diagram of preparation in embodiment 1.
Figure 1A recombinant antigen purification SDS-PAGE electrophoresis；Figure 1B Western-blot analyzes schematic diagram.
Antibody horizontal after Fig. 2 recombinant antigen PotA protein immunization mice.
The protein induced mouse antibodies IgG subclass of Fig. 3 recombinant antigen PotA measures.
2LD after Fig. 4 antigen PotA protein immunization mice100Counteracting toxic substances protection effect test.
Temperature changing after Fig. 5 PotA immunity piglet.
The horizontal Changing Pattern of serum specific antibody after Fig. 6 PotA immunity piglet.
3LD100 counteracting toxic substances protection test after Fig. 7 PotA immunity piglet
Detailed description of the invention
Reagent of the present invention if not otherwise specified, equal available from commercial channel or be the normal compound reagent of this area.Described technical scheme, if not otherwise specified, is the conventional scheme of this area.
Embodiment 1:
The preparation of erysipelothrix rhusiopathiae antigen albumen (present invention or title PotA albumen):
The embodiment of the present invention for prokaryotic expression, to this albumen acquisition illustrate:
The structure of escherichia coli (Escherichiacoli) BL21/pET-28a-PotA, expresses and purification destination protein
1) construction of expression vector utilizes BamHI+Hind III purchased from precious biological (Dalian) company limited product) simultaneously the PotA genetic fragment (shown in SEQIDNO.1) of enzyme action pcr amplification and pET-28a (+), reclaim PCR segment and expression vector plasmid, by PotA genetic fragment after enzyme action and pET-28a after enzyme action (+) be connected, construct pET-28a-PotA.It is transformed into DH5a competence, utilizes the plasmid pET-28a-PotA that BamHI+Hind III enzyme action extracts, after enzyme action, should occur that the exogenous sequences of expection size and carrier segment are correct recombiant plasmid.The double digestion qualification result of recombiant plasmid pET-28a-PotA is shown in Fig. 2, and the band of double digestion meets the size of PotA.Recombiant plasmid pET-28a-PotA is converted to competent cell BL-21 (DE3), the method adopting bacterium colony PCR, selects positive colony amplification culture, extracts plasmid double digestion and identifies plasmid is served the order-checking of Hai Sheng work biotech firm simultaneously, comparison is correct, is the expression strain of PotA.
2) express, escherichia coli (Escherichiacoli) BL21/pET-28a-PotA is inoculated in the 3mLLB fluid medium containing 25 μ g/mlKan by purification destination protein, cultivates in 37 DEG C of shaking tables.From cultured bacterium solution, take 100 μ L be inoculated in the 10mL fresh LB fluid medium containing 25 μ g/mlKan, be about 3h in 37 DEG C of shaken cultivation, to OD600When reaching 0.8, add IPTG to final concentration of 0.2mmol/L, after continuing cultivation 3h, collect thalline.
By centrifugal for the recombination bacillus coli 8000r/min after induction 15min.Precipitate resuspended with the 50mMTris-HCl (pH8.0) of 1/10 volume, and add lysozyme to final concentration 1mg/ml, ice bath 30min.Carry out ultrasonic broken broken under condition of ice bath, until bacterium solution no longer thickness, 12000r/min, centrifugal 30min.Precipitation 2M carbamide is washed two times, by the resuspended precipitation of 8M carbamide, put in bag filter, carry out gradient dialysis, until the buffer in bag filter replaces to 50mMTris-HCl (pH8.0) completely, recombinant antigen protein PotA (includes sequence shown in SEQIDNO.2) carries out SDS-PAGE electrophoretic analysis and purification result is shown in that Figure 1A, band meet the size 40KD of PotA albumen.The immunogenicity of recombinant antigen protein PotA is analyzed by Western-blot method (see above-mentioned " molecular cloning handbook "); result PotA albumen as shown in Figure 1B can with PotA immunized mice positive serum generation specific reaction; it is a highly important protective antigen, for following example.
Embodiment 3: subunit vaccine composition and routine inspection
1) vaccine composition: PotA protein solution, adjuvant (before the section of Wuhan biological Co., Ltd) vaccine emulsifying: 1:1 volume mixture emulsifying pressed by PotA albumen and adjuvant.Make the final concentration of 1mg/ml of antigen protein, for following example.
2) routine inspection:
Vaccine character detects: after emulsifying, vaccine instills in clear water, and first is scattered, the second oil dripping pearl, rolling producing fluid level oil droplet not breakdown of emulsion.
Sterility testing: taking a little vaccine coating TSA plate, 37 DEG C of incubators are cultivated and grown without bacterium colony for 18 hours.
According to separation case, centrifugal 15 minutes of stability test: 3000rpm/min, judges that whether emulsifying is stable, after centrifugal, emulsifying vaccine is not layered；
Embodiment 4: recombinant antigen protein mouse immune protection is tested
1) experimental program
Laboratory animal: 4 week old female BAl BIc/c white mice, purchased from Disease Prevention Control Center, Hubei Prov.
Counteracting toxic substances bacterial strain: erysipelothrix ruhsiopathiae SE38 strain (hereinafter referred to as SE38, Li Jingtao, some areas, Hubei erysipelothrix ruhsiopathiae separates strain drug resistance analysis, cultivation and feedstuff [J] .2015.2,11-14).
Immunization method: the vaccine present invention prepared is by l/ dose subcutaneous immunity test mice of 100 μ；The vaccine booster immunization that 2 Zhou Houyong are similarly prepared 1 time (immunizing dose is 100 μ l/).
Experiment packet: take 4 week old, body weight 18 ± 2g female BAl BIc/c white mice 20, be randomly divided into 2 groups: vaccine I group (PotA), adjuvant and Tris-HCl mixing matched group, often group 10.Period docks weekly and takes blood, for the monitoring of serum specific antibody.
2) detection of serum specific antibody
The recombinant antigen PotA100ng/ hole using purification is overnight coated elisa plate in 4 DEG C, detects the antibody horizontal separating serum by the method for indirect ELISA, sees Fig. 2.It is monitored the antibody horizontal of mice after immunity finding: within after first immunisation first week, just can produce higher antibody horizontal by inducing mouse, have 28.When two exempt from 14 days, in Mice Body, antibody horizontal reaches a higher level, and the Mean antibody titer of positive serum can reach 215。
3) recombinant antigen inducing mouse IgG antibody subclass measures
Mice blood sampling after immune 2 weeks is separated serum, takes 100 μ l after doubling dilution and add elisa plate, 37 DEG C of reaction 60min.After washing plate 3 times, each dilution serum is separately added into volume ratio 1:5, sheep anti-mouse igg 1 HRP, IgG2a HRP of 000 dilution, 37 DEG C of reaction 30min.Add 100 μ l substrate solutions after washing plate 5 times, add 0.25%HF after lucifuge colour developing 10min and terminate reaction, in 630nm reading, see Fig. 3.The antibody that visible PotA produces at mice Immune inducing in vivo is mainly lgG1, IgG2a significantly lower than lgG1.
4) situation is protected after immunized mice counteracting toxic substances
Two exempt from the mice after 14 days carries out challenge test, and counteracting toxic substances dosage is 2LD100SE38.Continuous Observation one week, the Clinical symptoms of record mice and death condition.
Result is as follows:
The absolute lethal bacterium amount LD100 of SE38 strain is 5CFU, and immune mouse counteracting toxic substances result is shown in Fig. 4, it was shown that PotA antigen can protect mice to be effective against the infection of strain SE38, and mouse survival rate is 60%, and 6 mices of survival are without clinical symptoms；And adjuvant and Tris-HCl to mix control group mice all dead, survival rate is 0, antibody horizontal and immune group mouse survival rate can be seen that PotA albumen adds the vaccine on mouse that adjuvant makes and has certain protection.
Embodiment 5: recombinant subunit vaccine piglet immunological protection is tested
1) experimental program
Laboratory animal: the 4 negative ablactational baby pig of week old erysipelothrix ruhsiopathiae detection, purchased from Tian Zhong pig farm, Wuhan economic cycle grass lake.
Counteracting toxic substances bacterial strain: the counteracting toxic substances bacterial strain used with embodiment 4
Experiment packet: 4 week old ablactational baby pig are divided into 5 groups, vaccine group (G4T10), immune 1 group (PotA), immune 2 groups (PotA), adjuvant and Tris-HCl mixing matched group, often group 6, vaccine group, immune 1 group, adjuvant and Tris-HCl mixing matched group be for counteracting toxic substances, immunity 2 groups is used for detecting antibody horizontal, continuous detecting 8 months.Cervical region and buttocks multi-point injection, immunity in every 2 weeks 1 time, totally 2 times, immunizing dose is 2ml/ head, vaccine group, immune 1 group, adjuvant and Tris-HCl mixing matched group ear vein weekly take blood, for the detection of serum specific antibody；Immunity is taken a blood sample once 2 groups of every months, for the detection of serum specific antibody.
2) detection of serum specific antibody
The recombiant protein PotA100ng/ hole using purification is coated elisa plate, and 4 DEG C overnight.The antibody horizontal in piglet body is detected with indirect ELISA.
3) piglet clinical symptoms after immunity
After first immunisation, every day monitors body temperature, continuous detecting 7 days, and after observing immunity, piglet searches for food and mental condition.
4) situation is protected after immune swine counteracting toxic substances
Two exempt from 14 days after carry out challenge test, counteracting toxic substances dosage is 9 × 108The SE38 strain bacterium of cfu/ head dosage, is 3 times of fatal dose LD100.Continuous Observation 14 days, record Clinical symptoms and death condition.
5) immune effect assessment
After immunity, piglet does not have clinical onset symptom, immunity 1 group, adjuvant and Tris-HCl mixing group latter second day body temperature of immunity can rise, and third body temperature is recovered normally substantially, and period piglet feed intake has no minimizing, the of short duration rising of body temperature is less to the growth effect of piglet, and Temperature changing is shown in Fig. 5；
Antibody horizontal after piglet immunological PotA is detected and shows: after first immunisation, the antibody horizontal of induction in first week is more weak, on average has 24, the antibody horizontal of coming weeks induction gradually rises, and may be up to 2 in 4th week20, protection can be provided for piglet, see Fig. 6；After immunity, PotA immunity piglet is all healthy, and without disease symptom, injection site does not have red speckle；After counteracting toxic substances, immune 1 group has 3 piglets dead in 7 days, survives 3, see Fig. 7.The piglet that health survived is sentenced euthanasia and carries out cuing open inspection point bacterium, and kidney,spleen,liver, the heart are all without being separated to SE38 bacterial strain.Adjuvant and Tris-HCl mixing group piglet all fall ill, and lethargy is slow in action, and the rash block of skin is " diamond-skin disease " shape, have piglet dead successively, last all extremely complete.The experimental result of body animal further illustrates PotA subunit vaccine prepared by the present invention can provide good protected effect for piglet.
Carry out the antibody horizontal detection of 8 months to immune 2 groups, after first immunisation, the 28th～90 day is antibody peak, and antibody titer meansigma methods is 220Left and right, is gradually reduced later, and to 180 days, antibody horizontal was still higher, and antibody titer meansigma methods is more than 29, within 210 days, though antibody can be detected, but antibody horizontal is relatively low, antibody titer meansigma methods only has 26, illustrate that antibody horizontal at least can maintain 6 months.
Embodiment 6: safety examination
For accuracy and the inspection vaccine product quality problems of guarantee test data, adopt 3 batches of vaccine products that 35 age in days piglets and pregnant 70 age in days sows are carried out safety examination.01 batch is preserve the vaccine product of 1 one months, and 02 batch is preserve the vaccine product of 2 months, and 03 batch is the vaccine of fresh preparation.
1. experimental program:
1) subunit vaccine of 3 crowdes of present invention is inoculated 35 age in days health ablactational baby pig respectively through buttocks muscles, the every batch of vaccine injection 5, every inoculation 2ml, observes 14, and measures body temperature.
2) by the subunit vaccine of 3 crowdes of present invention respectively through the buttocks muscles inoculation gestation healthy sow of 70 days, the every batch of vaccine injection 5, inoculate with 1 single dose 2ml, observe its clinical manifestation and farrowing situation for every.
2. result of the test
The safety to 1 single dose inoculation of ablactational baby pig of the subunit vaccine of 2.1 present invention
After the subunit vaccine of 3 crowdes of present invention is inoculated 35 age in days health ablactational baby pig respectively with 2ml, the every batch of vaccine injection 5, piglet body temperature, to breathe situation, mental status, appetite etc. all normal, has no abnormal changes.Illustrate that this vaccine product is to ablactational baby pig safety vaccine rotten (table 1) very well and in storage life.
3 batches of subunit vaccines of table 1 present invention inoculate the mean body temperature after 35 age in days ablactational baby pig
The safety (product subcase) that pregnant animal (in-pig) is inoculated by the subunit vaccine of 2.1 present invention
The healthy gestation of the subunit vaccine inoculation of 3 crowdes of present invention sow body temperature, breathing, appetite, the mental status all normal (table 2) between the whole observation period on the 70th as a result, farrowing is normal, it does not have the situations (table 3) such as miscarriage, stillborn fetus occur.
Mean body temperature change after healthy in-pig of single dose inoculation of the subunit vaccine of 23 crowdes of present invention of table
Farrowing situation after the subunit vaccine of single dose inoculation present invention of the healthy in-pig of table 3
The erysipelothrix ruhsiopathiae of the popular serotype of China is provided that the protective rate of 50% by this subunit vaccine; and tonsil bacterial strain is also had higher prevention and control ability; there are the potentiality resisting other type erysipelothrix ruhsiopathiae; it is expected to obtain better effect through adding other albumen, it is possible to for the anti-system of China's pig erysipelas.
SEQUENCELISTING
<110>a kind of erysipelothrix rhusiopathiae antigen albumen and application
<120>Hua Zhong Agriculture University
<130>Hua Zhong Agriculture University
<160>2
<170>PatentInversion3.5
<210>1
<211>1044
<212>DNA
<213>artificial sequence
<400>1
atggaagcattaattcaatttacaaatattgtgaagagctttgaagatcaacttgtctta60
aaaggcatcaacttggatatctttgagaatgagtttgtgacactacttggcccttcaggc120
tgtggaaaaacaacacttttaagaatcttaggtggatttttagagcagagttctggtgaa180
gtatatttcgaaggtattgagatttcgaaattagccccttataaacgtgagattaataca240
gtttttcaacggtatgcactttttccacatatggatgtttatgacaacattgcatttggt300
cttcgtatcaagaaaaccaatgaagatattatcaaacaaaaagttgagaagatgttgaat360
attgttggcttaaacggttttgaacaccgtcctgtcacactcttatctggtggtcaacaa420
caacgtgttgcgattgctcgagcacttgtaaatgaaccgatggtccttctgcttgatgaa480
cccttaggtgcattggatttaaaaatgcgtaaagaaatgcaacgtgaacttaaggaaatc540
caagaaaatgtggggattacctttgtctatgttacccatgatcaagaagaagcgttaacc600
atgtcagataaaattgtcgtgatgaatgaaggggaaatccaacaaatcggaaaaccaatg660
gatatctataatgaacctgaaaatcgttttgttgcgaccttcatcggggattctaatatt720
attgaaggaacgatgattgaagatcgccttgtggaatttgatggcgttcaatttgaatgc780
gttgatgcagggttctcaaataatgaagttgtagatattgtaatccgacctgaagacatt840
gatattgttgatgtggaacttggtaaactaaccggtgttgtagagtcaattctatttaag900
ggtgttcattacgagattgtcgttaaaacggaacatcgtgactttatcattcatacaacg960
gataattcagaagaaggaaaagaagccggcatccatttcttccctgaagacatccatgtt1020
atgtacacaatggagtcgtattaa1044
<210>2
<211>347
<212>PRT
<213>artificial sequence
<400>2
MetGluAlaLeuIleGlnPheThrAsnIleValLysSerPheGluAsp
151015
GlnLeuValLeuLysGlyIleAsnLeuAspIlePheGluAsnGluPhe
202530
ValThrLeuLeuGlyProSerGlyCysGlyLysThrThrLeuLeuArg
354045
IleLeuGlyGlyPheLeuGluGlnSerSerGlyGluValTyrPheGlu
505560
GlyIleGluIleSerLysLeuAlaProTyrLysArgGluIleAsnThr
65707580
ValPheGlnArgTyrAlaLeuPheProHisMetAspValTyrAspAsn
859095
IleAlaPheGlyLeuArgIleLysLysThrAsnGluAspIleIleLys
100105110
GlnLysValGluLysMetLeuAsnIleValGlyLeuAsnGlyPheGlu
115120125
HisArgProValThrLeuLeuSerGlyGlyGlnGlnGlnArgValAla
130135140
IleAlaArgAlaLeuValAsnGluProMetValLeuLeuLeuAspGlu
145150155160
ProLeuGlyAlaLeuAspLeuLysMetArgLysGluMetGlnArgGlu
165170175
LeuLysGluIleGlnGluAsnValGlyIleThrPheValTyrValThr
180185190
HisAspGlnGluGluAlaLeuThrMetSerAspLysIleValValMet
195200205
AsnGluGlyGluIleGlnGlnIleGlyLysProMetAspIleTyrAsn
210215220
GluProGluAsnArgPheValAlaThrPheIleGlyAspSerAsnIle
225230235240
IleGluGlyThrMetIleGluAspArgLeuValGluPheAspGlyVal
245250255
GlnPheGluCysValAspAlaGlyPheSerAsnAsnGluValValAsp
260265270
IleValIleArgProGluAspIleAspIleValAspValGluLeuGly
275280285
LysLeuThrGlyValValGluSerIleLeuPheLysGlyValHisTyr
290295300
GluIleValValLysThrGluHisArgAspPheIleIleHisThrThr
305310315320
AspAsnSerGluGluGlyLysGluAlaGlyIleHisPhePheProGlu
325330335
AspIleHisValMetTyrThrMetGluSerTyr
340345
Claims (5)
1. an erysipelothrix rhusiopathiae antigen albumen, its aminoacid sequence is shown in SEQIDNO.2.
2. the nucleotide sequence of albumen described in coding claim 1.
3. nucleotide sequence according to claim 2, its sequence is shown in SEQIDNO.1.
4. the application in preparing swine erysipelas vaccine of the albumen described in claim 1.
5. the application in preparation against erythema Erysipelothrix medicine of the albumen described in claim 1.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610245012.XA CN105753949B (en) | 2016-04-19 | 2016-04-19 | A kind of erysipelothrix rhusiopathiae antigen albumen and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610245012.XA CN105753949B (en) | 2016-04-19 | 2016-04-19 | A kind of erysipelothrix rhusiopathiae antigen albumen and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105753949A true CN105753949A (en) | 2016-07-13 |
| CN105753949B CN105753949B (en) | 2018-11-06 |
Family
ID=56325083
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610245012.XA Active CN105753949B (en) | 2016-04-19 | 2016-04-19 | A kind of erysipelothrix rhusiopathiae antigen albumen and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105753949B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107974458A (en) * | 2017-11-03 | 2018-05-01 | 华中农业大学 | Express gene gapdh and its recombination bacillus coli and the application of bacillus rhusiopathiae suis recombinant protein GAPDH |
| CN113403288A (en) * | 2021-07-23 | 2021-09-17 | 江苏省农业科学院 | Erysipelothrix rhusiopathiae GAPDH molecular antigen polypeptide for serum antibody detection and preparation method and application thereof |
-
2016
- 2016-04-19 CN CN201610245012.XA patent/CN105753949B/en active Active
Non-Patent Citations (3)
| Title |
|---|
| OGAWA Y.等: "登录名：F5WUW9_ERYRF", 《UNIPROTKB》 * |
| 吾鲁木汗·那孜尔别克 等: "红斑丹毒丝菌免疫原性蛋白的鉴定及其编码基因的克隆和测序", 《微生物学报》 * |
| 晏鹏飞 等: "猪丹毒丝菌C43150株表面保护性抗原A的免疫功能区分析", 《新疆农业科学》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107974458A (en) * | 2017-11-03 | 2018-05-01 | 华中农业大学 | Express gene gapdh and its recombination bacillus coli and the application of bacillus rhusiopathiae suis recombinant protein GAPDH |
| CN113403288A (en) * | 2021-07-23 | 2021-09-17 | 江苏省农业科学院 | Erysipelothrix rhusiopathiae GAPDH molecular antigen polypeptide for serum antibody detection and preparation method and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105753949B (en) | 2018-11-06 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103263666B (en) | Porcine circovirus 2 type, porcine mycoplasmal pneumonia bivalent inactivated vaccine and preparation method thereof | |
| CN105816868B (en) | Inactivated vaccine for mycoplasma synoviae | |
| CN106554944B (en) | Porcine epidemic diarrhea virus low-virulent strain, vaccine composition prepared from porcine epidemic diarrhea virus low-virulent strain and application of vaccine composition | |
| CN107899008B (en) | Sick three subunit vaccines of a kind of pig epidemic diarrhea, transmissible gastroenteritis of swine, pig fourth type coronavirus | |
| CN110872578B (en) | Variant infectious bursal disease virus, subunit vaccine, preparation method and application thereof | |
| CN110183520B (en) | Swine erysipelas SpaA protein and application thereof in preparation of vaccines | |
| CN107412762B (en) | Newcastle disease, avian influenza, bursa of fabricius and avian adenovirus quadruple vaccine | |
| AU2018278927A1 (en) | Methods and compositions for dengue virus vaccines | |
| CN105733987A (en) | Mycoplasma synoviae | |
| CN106146626B (en) | A kind of erysipelothrix ruhsiopathiae subunit vaccine and preparation method and application | |
| CN108135993B (en) | Pestivirus vaccine for congenital tremor | |
| CN115141812A (en) | Acremonium carbonum vaccine strain and application thereof | |
| CN109609468B (en) | Six-gene-deleted porcine pseudorabies virus, porcine pseudorabies vaccine and preparation method thereof | |
| CN103191421B (en) | Application of serotype 5 haemophilus parasuis (HPs) vaccine strain | |
| CN104628865A (en) | Pseudorabies virus epitope polypeptide gene engineering vaccine | |
| CN102727883B (en) | Combined live vaccine against porcine reproductive and respiratory syndrome and swine fever, and application thereof | |
| CN105753949A (en) | Erysipelothrix rhusiopathiae antigen protein and application thereof | |
| CN105770881A (en) | Mycoplasma gallisepticum (MG) and mycoplasma synoviae (MS) combined inactivate vaccine | |
| CN103468647B (en) | Swine flu H1N1 and H3N2 subtype bivalent inactivated vaccine | |
| CN106854647B (en) | Duck viral hepatitis bivalent yolk antibody and preparation method and application thereof | |
| CN109055320B (en) | Infectious bronchitis virus isolate and application thereof in vaccine preparation | |
| CN111729091A (en) | Method for testing efficacy of porcine epikavirus inactivated vaccine by using domestic rabbit | |
| CN104511015A (en) | Vaccine composition, preparation method and application thereof | |
| CN101235363A (en) | Pig transmissible gastroenteritis virus vaccine strain and application thereof | |
| CN113957007B (en) | Inactivated vaccine for mycoplasma synoviae |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |