CN105734074A - Mixed spidroin fiber preparing method - Google Patents
Mixed spidroin fiber preparing method Download PDFInfo
- Publication number
- CN105734074A CN105734074A CN201610231221.9A CN201610231221A CN105734074A CN 105734074 A CN105734074 A CN 105734074A CN 201610231221 A CN201610231221 A CN 201610231221A CN 105734074 A CN105734074 A CN 105734074A
- Authority
- CN
- China
- Prior art keywords
- preparation
- misp
- spider
- fragment
- protein fiber
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/43504—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates
- C07K14/43513—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from arachnidae
- C07K14/43518—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from arachnidae from spiders
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/10—Plasmid DNA
- C12N2800/101—Plasmid DNA for bacteria
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- General Health & Medical Sciences (AREA)
- Molecular Biology (AREA)
- Insects & Arthropods (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Tropical Medicine & Parasitology (AREA)
- Toxicology (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Peptides Or Proteins (AREA)
Abstract
The invention relates to a mixed spidroin fiber preparing method.According to the method, the araneus ventricousus minor ampullate spidroin full-length coding gene and a piriform silk complete repetition area are taken as a template, splicing is conducted with the fusion PCR technique, connection with a pLX carrier is conducted, recombination quality construction is conducted, and expression is conducted in BL21.The degeneration purification means is adopted, and a mixed spidroin solution is obtained finally and stored after freeze-drying.Reaction conditions are mild, cost is low, the process is simple, and operation is easy.Prepared mixed spidroin fiber has high biocompatibility, uniform thickness and a smooth surface, and has potential application value in fields like biomedicine.
Description
Technical field
The invention belongs to the preparation field of azelon, particularly to a kind of preparation method mixing spider's thread protein fiber.
Background technology
Spider silk is the azelon of a kind of natural polymer amount, have good mechanical performance and biology quality, as intensity is high, good springiness, quality is light, high-low temperature resistant and good biocompatibility etc., and integrated quality is considerably beyond the high performance material fiber of silkworm silk and present stage synthetic, it is one urgently strategic resource leaved for development, has imponderable using value in fields such as biomedical engineering, space flight and aviation and military affairs.But the scale of mass production of the spider's thread and Bionics application still have to be strengthened so far, mainly have following reason: 1. Aranea is flesh-eater, not easily tames, it is impossible to high-density rearing as silkworm;2. the component of natural spider silk, spinning mechanism and spinning process are extremely complex;2 is most potential method so far with engineered method Expression product recombinant spider silk protein in heterologous host.But this is faced with difficulty equally, because the central authorities of major part spider silk fibroin are the sequences highly repeated, its molecular weight can reach more than 90%, and duplicate block is rich in glycine and alanine.Not only being faced with codon usage bias problem expressing when spider silk fibroin with heterologous host, this sequence characteristic brings storehouse simultaneously needs coevolution, simultaneously this high-load cause special secondary structure, and cause gene recombinaton.Therefore the spider silk fibroin produced reaches the size of Natural spider fibroin, yields poorly, and performance is far away from natural spider's thread protein.Therefore the construction and expression of recombinant spider silk protein is become the study hotspot in this field in recent years.
Summary of the invention
The technical problem to be solved is to provide a kind of preparation method mixing spider's thread protein fiber, and the method technique is simple, and reaction condition is gentle, it is easy to operation;The novel mixing spider's thread fibrin prepared can at E. coli, and this novel mixing spider's thread fibre morphology is uniform, stable performance, has the prospect of industrialized implementation.
A kind of preparation method mixing spider's thread protein fiber of the present invention, including:
(1) with the total length encoding gene of Araneus ventricosus time ampulla gland silk MiSp for template, then pass through pcr amplification and obtain the NT end genetic fragment MiSp-NT and CT end genetic fragment MiSp-CT of time ampulla gland silk MiSp, then using the encoding gene of the complete duplicate block Rp of pyriform gland silk PySp as template, the genetic fragment PySp-Rp of a complete duplicate block is obtained by pcr amplification;
(2) three fragment gene fragment MiSp-NT, MiSp-CT, PySp-Rp in step (1) are passed through round pcr, carry out splicing according to natural spider's thread protein fiber functional module order and obtain complete genome fragment MiSpNT-PySpRp-MiSpCT, PCR primer is carried out agarose gel rear cutout glue and reclaims;
(3) above-mentioned complete genome fragment MiSpNT-PySpRp-MiSpCT, pLX plasmid are carried out double digestion respectively, mix after being then purified recovery, add the reaction of T4 ligase, obtain connecting product;
(4) above-mentioned connection product is used the method for transformation of thermal shock, proceed in DH5 α competent cell and convert, bacterium solution after converting is coated in the culture medium with Amp resistance, after 37 DEG C of incubated overnight, picking monoclonal carries out double digestion inspection, by recombiant plasmid pLX-MiSpNT-PySpRp-MiSpCT correct for enzyme action, proceed in BL21 competent cell, after 37 DEG C of incubated overnight, picking recombiant plasmid monoclonal (carries the BL21 monoclonal of recombiant plasmid) and accesses in LB culture medium, after 37 DEG C of incubated overnight, LB culture medium of transferring again is cultivated, it is cultured to the OD value of A600 between 0.6-0.8, it is subsequently adding IPTG inducing culture, collect thalline;
(5) above-mentioned thalline is resuspended in lysis buffer LysisBuffer, after height crushes bacterium, centrifugal, collect precipitation, purification, lyophilizing, obtain protein powder;
(6) after above-mentioned protein powder being added hexafluoroisopropanol dissolving, obtain solution, then inject with needle aspirate solution in the methanol of 75%, spider's thread protein fiber must be mixed;Wherein the proportionate relationship of protein powder and hexafluoroisopropanol is the proportionate relationship of protein powder and hexafluoroisopropanol is 100mg:1mL.
Described step (1) is obtained the NT end genetic fragment MiSp-NT of time ampulla gland silk MiSp by pcr amplification: particularly as follows:
nullCAACCAATCTGGACCAACCCAAATGCAGCAATGACCATGACCAACAACCTGGTCCAATGTGCGAGTCGGTCAGGTGTGCTCACAGCCGATCAGATGGACGACATGGGAATGATGGCAGACTCTGTTAACTCGCAGATGCAGAAAATGGGACCAAACCCACCTCAACACAGACTCAGGGCAATGAATACCGCCATGGCCGCAGAAGTAGCTGAAGTAGTAGCAACTTCGCCACCACAAAGTTATTCTGCAGTTTTAAATACCATTGGTGCTTGCTTGAGGGAATCAATGATGCAAGCGACAGGCTCCGTCGACAATGCATTCACAAATGAAGTAATGCAATTGGTAAAAATGTTATCTGCGGATAGCGCGAATGAAGTATCTACAGCAAGTGCATCAGGAGCCAGTTACGCAACAAGTACGTCATCTGCAGTAAGCTCATCTCAAGCAACAGGATACAGCACTGCAGCAGGTTATGGAAAC,Shown in SEQIDNO.1.
By pcr amplification obtain time ampulla gland silk MiSp CT end genetic fragment MiSp-CT particularly as follows:
GTAGCTGCATATGGTGGCGCAGGTGGAGTTGCAACATCTTCAAGTTCGGCAACTGCCAGTGGATCTCGTATAGTTACATCTGGAGGTTACGGATATGGAACCAGTGCAGCTGCAGGAGCTGGAGTTGCAGCAGGTTCATATGCAGGTGCTGTCAATCGCTTGTCTAGTGCTGAAGCTGCCAGTAGAGTATCCTCTAATATTGCAGCTATTGCATCTGGTGGTGCTTCCGCCCTCCCCAGTGTTATTTCAAATATTTACTCAGGTGTCGTTGCTTCTGGTGTTTCTTCTAATGAAGCTCTGATTCAAGCTCTGTTGGAACTCCTTTCCGCACTTGTTCATGTTTTAAGCAGTGCCTCTATCGGTAATGTTAGCTCAGTAGGAGTAGATAGTACATTGAATGTTGTTCAGGATTCAGTAGGCCAATATGTAGGTTAA.Shown in SEQIDNO.2
By pcr amplification obtain a complete duplicate block genetic fragment PySp-Rp particularly as follows:
nullGCTCCAGCACCTGCACCTAGACCAGCTCCTCGACCACTACCAGCCCCAATTCAAGCCCCAAGACCAGCACCCGCACCACAACCTGCACCGGTTTACGCACCAGCCCCAGTCGTTTCACAAGTTCAGGCAACTTCTTCCTCTCAAGCCTCGGCTCAACAGAGTGCCTTCGCACAGTCCCAACAATCTTCAGTTGTTCAATCTCAACAAAGTTCAAACGCTTATTCTGCAGCATCAACTGCCGGTTCAAGTGTGTCGCAATCTCAGGCGATTGTCTCAAGCGCTCCTGTTTATTTTAACACGCAAACTTTAAGTAGCAGCCTGTCTTCTTCTCTGCAATCACTCAGTGCACTCAATTCGTTAGCGAGTGGTCAACTGAGCTCCTGGAATGCCGCTTCTATTATAGCGAGTGCGGTAGCACCGTCACTTGGAGTGTCCCAAGCGTCGGTTCAAAATAGTATAAGCCAACAGTTGAGAAGCGTAGGGCCCGGATCTTCCACGTCCTCTGTCGCTCAAGCAATAGCAAATGGAGTGGCTAACGCAGTTGGAGCATCAGGAACAGGAGTTGCAGGACAAGAACAATCTATTTCACAATCCATATATACTTCAGTTTCCACTGCTCTATCTCAACTGGCAGCACCG,Shown in SEQIDNO.3
NT forward primer in step (1): shown in CGGGATCCCAACCAATCTGGACCAACCCA, SEQIDNO.4;
Reverse primer: CTGGTCTAGGTGCAGGTGCTGGAGCGTTTCCATAACCTGCTGCAGTG;Shown in SEQIDNO.5;
CT forward primer: shown in CTCTATCTCAACTGGCAGCACCGGTAGCTGCATATGGTGGCGCAGG, SEQIDNO.6;
Reverse primer: CCCTCGAGTTAACCTACATATTGGCCTACTGAATCCTGAAC;Shown in SEQIDNO.1 7;
PySp duplicate block forward primer is shown in GCACTGCAGCAGGTTATGGAAACGCTCCAGCACCTGCACCTAGACC, SEQIDNO.8;
Reverse primer is: shown in CCTGCGCCACCATATAGDAGCTACCGGTGCTGCAGTTGAGATGAG, SEQIDNO.9.
In described step (1), NT end genetic fragment MiSp-NT is sized to 480bp, CT end genetic fragment MiSp-CT be 435bp, genetic fragment PySp-Rp is 636bp.
Three fragment gene fragment MiSp-NT in described step (2), MiSp-CT, PySp-Rp particularly as follows: the forward primer of NT and the reverse primer of CT and three amplified productions in selecting step (1), carry out pcr amplification by round pcr again.PCR condition is: 98 DEG C of degeneration 3min, and 65 DEG C of annealing 1min, 72 DEG C extend 5min, circulate 35 times.
The gene of complete genome fragment MiSpNT-PySpRp-MiSpCT is sized to 1551bp, altogether 517 aminoacid of coding, and molecular weight of albumen is 50.7KDa.
In step (3), pLX plasmid is transformed by pET32a, only introduces 6 His labels, for Identification of Fusion Protein and purification before Insert Fragment.
Carrying out double digestion in described step (3) is: add restriction endonuclease BamH1 and XhoI, reacts 2h and carry out double digestion under 37 DEG C of conditions;Adding the reaction of T4 ligase, reaction temperature is 16 DEG C, and the time is 1h.
The volume ratio connecting product and DH5 α competent cell in step (4) is 1:10, and the recovery time is 1h;Recombiant plasmid and BL21 competent cell volume ratio that enzyme action is correct are 1:50;BL21 competent cell is BL21 (DE3) competent cell.Containing ampicillin in LB culture medium in step (4), ampicillin concentration in the medium is 100 μ g/mL;IPTG working concentration is 300 μ g/mL.
In described step (4), inducing culture temperature is 16 DEG C, and the time is 12h.
Containing only there being 20mMTris-HCL in LysisBuffer in described step (5), PH8.0, it is 1000bar that height crushes the broken bacterium pressure of bacterium;Centrifugal: centrifugal rotational speed is 12000r/min.
In step (5), thalline is resuspended in lysis buffer LysisBuffer, pre-cooling on ice, using height to crush 4 DEG C of centrifugal 30min after the broken bacterium of bacterium machine three times, precipitation and supernatant are identified through SDS-PAGE respectively. and carry out WesternblottingAnti-his specific detection.
Purification in described step (5) is particularly as follows: after precipitation is rinsed three times with the LysisBuffer containing 2M carbamide, by the resuspended precipitation of the LysisBuffer containing 8M carbamide, 12000rpm collected after centrifugation supernatant, gradient is dialysed in ultra-pure water.
In view of recombiant protein 6His MiSpNT-PySpRp-MiSpCT is in deposited components in step (5), first with the resuspended inclusion body of albumen rinsing liquid of 2mol/L, 4 DEG C of centrifugal 10min of ultrasonic mixing collect precipitation, it is repeatedly performed three rinsings, finally by the resuspended precipitation of high concentration urea lysis buffer of 8mol/L, ultrasonication 90 times, limpid to solution, 4 DEG C of centrifugal 30min after hatching 1 hour, collect supernatant, recombiant protein in supernatant is carried out gradient dialysis, remove carbamide, finally dialyse in the dialysis solution not containing carbamide, make protein renaturation, collect the supernatant in dialysis solution.
Rinsing ultrasonic power is 400W, operation setup 5son/7soff20 time;8M carbamide ultrasonic power is 400W, working time 5s, interval time 8s, totally 99 times.Gradient dialysis is dialysed at ambient temperature by the gradient of 6M → 4M → 2M → 0M.
The present invention is template initially with MiSp full-length gene and PySp duplicate block gene, fusion DNA vaccine technology is adopted to splice, then Plx-MiSpNT-PySpRp-MiSpCT restructuring quality is built, proceed in escherichia coli and express, it is purified with degeneration purification process, it is thus achieved that MiSpNT-PySpRp-MiSpCT recombinant spider silk protein solution.And wet spinning filamentation.Test result indicate that, this recombinant spider silk protein can obtain great expression in escherichia coli, and the second structure characteristic of this albumen is also similar to natural spider's thread protein, and silk fiber is uniform and smooth.
Operation is simple for the present invention, and the cost of raw material is relatively low, and spider's thread protein has good biocompatibility, environmentally safe.It is prepared into recombinant spider silk protein fiber and shows good morphological characteristic and biocompatibility.
The present invention uses SnapGene software, pcr amplification, WesternBlot and SDS-PAGE, degeneration purification, gradient is dialysed, the technique constructions such as lyophilization and this recombinant spider silk protein of purification, WesternBlot and SDS-PAGE is used for this albumen is identified, and analyze this recombinant spider silk protein fiber secondary con feature by circular dichroism spectra (CD), FTIR spectrum (ATR-FTIR), and it is as follows to use scanning electron microscope (SEM) to have rated the concrete test result of appearance features valency of this recombinant spider silk protein fibrous material:
SnapGene software building electronic cloning: Fig. 1 is that electronic cloning builds flow chart
WesternBlot and SDS-PAGE checks that result: Fig. 2 is WesternBlot and SDS-PAGE qualification result figure, as can be seen from the figure, compared to the albumen distribution in the escherichia coli before induction in SDS-PAGE glue figure, after induction between 66.2KDa and 45KDa, substantially have more a higher protein band of expression, and check in escherichia coli, not there is the albumen with His label before discovery induction through the anti-His of WesternBlot, the albumen of anti-His label occurs after induction and overlaps with the protein band position having more in SDS-PAGE glue figure.Illustrate that this mixing spider's thread protein obtains expression in escherichia coli.
C.D analysis (CD) result: Fig. 3 is recombinant spider silk protein solution second structure characteristic under different PH, as can be seen from the figure, this recombinant spider silk protein presents posivtive spike at 192nm, 2 negative peaks are then had in 208 and 222nm, illustrate that MiSpNT-PySpRp-MiSpCT recombiant protein mainly exists with the conformation of α-helix, after reducing the pH value of solution, α-helix reduces, and β-sheet increases gradually.After reduction solution pH value is described, MiSpNT-PySpRp-MiSpCT recombiant protein solution is changed to β-sheet by α-helix.
FTIR spectrum is analyzed (ATR-FTIR) and is analyzed result: Fig. 4 is mixing spider's thread protein second structure characteristic after natural drying with lyophilizing, and this recombinant spider silk protein fiber infrared absorption peak occurs in 1630cm-1 (amide I band) and 1550cm-1 (amide II is with) place;Illustrate that MiSpNT-PySpRp-MiSpCT recombinant fiber protein mainly exists with β-sheet and randomcoil or α-helix.
Scanning electron microscope (SEM) analyzes result: Fig. 5 is mixing spider's thread protein fiber configuration of surface under three kinds of amplifications, illustrates that this recombinant spider silk protein can form diameter and be about 0.22mm;The uniform fiber of smooth surface.
Beneficial effect
(1) present invention is mixed by the portion gene of the two of Araneus ventricosus kinds of bodies of gland, spliced by fusion DNA vaccine technology, and be connected with improved pLX carrier, proceed in expression thalline BL21, successful expression in escherichia coli, adopt degeneration purification process, after gradient is dialysed, it is thus achieved that this recombinant spider silk protein solution;Forming azelon under pressure after dissolving with hexafluoroisopropanol after lyophilizing, this method operating procedure is simple, and reaction condition is gentle, it is easy to operation purification, used by be environment friendly material;
(2) the MiSpNT-PySpRp-MiSpCT mixed protein fiber that prepared by the present invention has secondary structure spy's feature of natural spider's thread protein fiber, and mix spider's thread protein fiber and belong to biomimetic material, there is good water solublity and biocompatibility, Vitro Experimental Results shows this recombinant fiber protein smooth surface and even thickness, it is contemplated that, there is potential using value in the fields such as recombinant spider silk protein prepared by the present invention is biomedical.
Accompanying drawing explanation
Fig. 1 is that electronic cloning prepared by the present invention builds flow chart;
Fig. 2 is WesternBlot and the SDS-PAGE qualification result figure of embodiment 1 preparation;Wherein A is SDS-PAGE glue qualification result, and B is WesternBlot qualification result;Wherein 1 is albumen composition in escherichia coli before induction, and 2 is albumen composition in escherichia coli after induction, S be broken bacterium centrifugal after supernatant, P be broken bacterium be centrifuged after deposited components;
Fig. 3 is mixing spider's thread protein solution second structure characteristic under different PH prepared by the present invention;Wherein a is the protein solution peak value figure when three kinds of different PH;B is each secondary structure proportion of albumen under different PH;
Fig. 4 is the mixed reorganization albumen prepared of present invention FTIR spectrum figure after natural drying with lyophilizing;
Fig. 5 is the mixing spider's thread protein fiber prepared of present invention configuration of surface under different amplification (a~c).
Detailed description of the invention
Below in conjunction with specific embodiment, the present invention is expanded on further.Should be understood that these embodiments are merely to illustrate the present invention rather than restriction the scope of the present invention.In addition, it is to be understood that after having read the content that the present invention lectures, the present invention can be made various changes or modifications by those skilled in the art, and these equivalent form of values fall within the application appended claims limited range equally.
Embodiment 1
Take Araneus ventricosus MiSp genome 1 μ L, a pair each 2.5 μ L of positive anti-primer with the design of NT gene order, add 25 μ LQ5MasterMIX enzymes and be eventually adding 19 μ LddH2O mixings, NT gene is carried out pcr amplification, PCR condition is 98 DEG C of degeneration 3min, 65 DEG C of annealing 1min, 72 DEG C extend 10min, totally 35 circulations, again CT gene is carried out pcr amplification with the same terms, NT forward primer: CGGGATCCCAACCAATCTGGACCAACCCA, reverse primer: CTGGTCTAGGTGCAGGTGCTGGAGCGTTTCCATAACCTGCTGCAGTG;nullCT forward primer: CTCTATCTCAACTGGCAGCACCGGTAGCTGCATATGGTGGCGCAGG,Reverse primer: CCCTCGAGTTAACCTACATATTGGCCTACTGAATCCTGAAC designs positive anti-primer with Araneus ventricosus PySp duplicate block again,Just、Reverse primer length is 46bp,PySp duplicate block forward primer is GCACTGCAGCAGGTTATGGAAACGCTCCAGCACCTGCACCTAGACC,Reverse primer is: CCTGCGCCACCATATAGDAGCTACCGGTGCTGCAGTTGAGATGAG forward primer is with the 23bp nucleotide of NT end,23bp nucleotide and CT forward complementary pairing after reverse primer.PCR condition is: 98 DEG C of degeneration 3min, and 65 DEG C of annealing 1min, 72 DEG C extend 5min, circulate 35 times.
By three partial gene fragments after pcr amplification, again carry out pcr amplification, choose the forward primer of NT and each 2.5 μ L of reverse primer of CT, three each 2 μ L of amplified production, add 25 μ LQ5MasterMIX enzymes, be eventually adding 9 μ LddH2O mixings.Carry out pcr amplification.PCR condition is: 98 DEG C of degeneration 3min, and 65 DEG C of annealing 1min, 72 DEG C extend 5min, circulate 35 times.nullUse the agarose gel electrophoresis of 1%,Cut the fragment that clip size is about 1500bp,This fragment is recombinant fragment MiSpNT-PySpRp-MiSpCT,Use glue to return test kit to reclaim with 30 μ LddH2O eluting,Eluent is separately added into each 2 μ LBuffer5 μ L of BamH1 and Xho1 restriction endonuclease and is eventually adding the 11 rear 37 DEG C of reactions of μ LddH2O mixing 2 hours,Draw simultaneously 30 μ LpLX carriers be separately added into each 2 μ LBuffer5 μ L of BamH1 and Xho1 restriction endonuclease be eventually adding 11 μ LddH2O mixing rear 37 DEG C reaction 2 hours after,Reactant liquor use PCR primer purification kit reclaim respectively,After all using 20 μ LddH2O eluting,Draw fragment MiSpNT-PySpRp-MiSpCT6 μ L,The carrier pLX2 μ L that enzyme action is crossed,T4Ligase enzyme 1 μ L,Buffer1 μ L mixing after under room temperature condition coupled reaction 1 hour,Take 5 μ L connection products and add 50 μ LDH5 α competent cells,Convert,After 37 DEG C of incubated overnight,Picking monoclonal carries out double digestion inspection,By monoclonal correct for enzyme action,Proceed in BL21,After 37 DEG C of incubated overnight,Picking recombiant plasmid monoclonal accesses in 10mlLB,After 37 DEG C of incubated overnight,In 1LLB culture medium of transferring, 37 DEG C are cultured to OD value is add IPTG after 0.6,After 16 DEG C of incubated overnight,8000rpm collects thalline,Simultaneously respectively to bacterium solution sample preparation before and after induction.After being resuspended in the broken bacterium of 80mlLysisBuffer mesohigh, 12000rpm is centrifuged 30mins, collects precipitation, and to the precipitation after broken bacterium and supernatant sample preparation respectively, and to inducing front and back and supernatant precipitation sample preparation respectively, and carry out SDS-PAGE qualification and WesternblottingAnti-his qualification simultaneously.Then rinse after precipitating three times with the LysisBuffer containing 2M carbamide, by the resuspended precipitation of the LysisBuffer containing 8M carbamide, 12000rpm collected after centrifugation supernatant, gradient is dialysed in ultra-pure water, after using freeze dryer lyophilizing, weigh and obtain 120mg protein powder, after adding the dissolving of 1.2ml hexafluoroisopropanol, inject with 1ml needle aspirate solution in the methanol of 75%, mixed protein fiber can be obtained.
Claims (10)
1. the preparation method mixing spider's thread protein fiber, including:
(1) with the total length encoding gene of Araneus ventricosus time ampulla gland silk MiSp for template, then pass through pcr amplification and obtain the NT end genetic fragment MiSp-NT and CT end genetic fragment MiSp-CT of time ampulla gland silk MiSp, then using the encoding gene of the complete duplicate block Rp of pyriform gland silk PySp as template, the genetic fragment PySp-Rp of a complete duplicate block is obtained by pcr amplification;
(2) three fragment gene fragment MiSp-NT, MiSp-CT, PySp-Rp in step (1) are obtained complete genome fragment MiSpNT-PySpRp-MiSpCT by round pcr;
(3) above-mentioned complete genome fragment MiSpNT-PySpRp-MiSpCT, pLX plasmid are carried out double digestion respectively, mix after being then purified recovery, add the reaction of T4 ligase, obtain connecting product;
(4) above-mentioned connection product is proceeded in DH5 α competent cell convert, after 37 DEG C of incubated overnight, picking monoclonal carries out double digestion inspection, by recombiant plasmid pLX-MiSpNT-PySpRp-MiSpCT correct for enzyme action, proceeds in BL21 competent cell, after 37 DEG C of incubated overnight, picking recombiant plasmid monoclonal accesses in LB culture medium, after 37 DEG C of incubated overnight, then cultivates in LB culture medium of transferring, it is subsequently adding IPTG inducing culture, collects thalline;
(5) above-mentioned thalline is resuspended in lysis buffer LysisBuffer, after height crushes bacterium, centrifugal, collect precipitation, purification, lyophilizing, obtain protein powder;
(6) after above-mentioned protein powder being added hexafluoroisopropanol dissolving, obtain solution, then inject with needle aspirate solution in the methanol of 75%, spider's thread protein fiber must be mixed;Wherein the proportionate relationship of protein powder and hexafluoroisopropanol is 100mg:1mL.
2. a kind of preparation method mixing spider's thread protein fiber according to claim 1, it is characterized in that: in described step (1), NT end genetic fragment MiSp-NT is sized to 480bp, CT end genetic fragment MiSp-CT is 435bp, genetic fragment PySp-Rp is 636bp.
3. a kind of preparation method mixing spider's thread protein fiber according to claim 1, it is characterized in that: in described step (2), the gene of complete genome fragment MiSpNT-PySpRp-MiSpCT is sized to 1551bp, 517 aminoacid of coding altogether, molecular weight of albumen is 50.7KDa.
4. a kind of preparation method mixing spider's thread protein fiber according to claim 1, it is characterised in that: in step (3), pLX plasmid is transformed by pET32a, only introduces 6 His labels before Insert Fragment.
5. a kind of preparation method mixing spider's thread protein fiber according to claim 1, it is characterised in that: carrying out double digestion in described step (3) is: add restriction endonuclease BamH1 and XhoI, reacts 2h and carry out double digestion under 37 DEG C of conditions;Adding the reaction of T4 ligase, reaction temperature is 16 DEG C, and the time is 1h.
6. a kind of preparation method mixing spider's thread protein fiber according to claim 1, it is characterised in that: the volume ratio connecting product and DH5 α competent cell in step (4) is 1:10;Recombiant plasmid that enzyme action is correct and BL21 competent cell volume ratio are 1:50, BL21 competent cell is BL21 (DE3) competent cell.
7. a kind of preparation method mixing spider's thread protein fiber told according to claim 1, it is characterised in that: containing ampicillin in LB culture medium in step (4), ampicillin concentration in the medium is 100 μ g/mL;IPTG working concentration is 300 μ g/mL.
8. a kind of preparation method mixing spider's thread protein fiber according to claim 1, it is characterised in that: in described step (4), inducing culture temperature is 16 DEG C, and the time is 12h.
9. a kind of preparation method mixing spider's thread protein fiber according to claim 1, it is characterised in that: containing only there being 20mMTris-HCL in LysisBuffer in described step (5), PH8.0, it is 1000bar that height crushes the broken bacterium pressure of bacterium;Centrifugal: centrifugal rotational speed is 12000r/min.
10. a kind of preparation method mixing spider's thread protein fiber according to claim 1, it is characterized in that: purification in described step (5) is particularly as follows: will precipitate with after the LysisBuffer rinsing containing 2M carbamide three times, by the resuspended precipitation of the LysisBuffer containing 8M carbamide, 12000rpm collected after centrifugation supernatant, gradient is dialysed in ultra-pure water.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201610231221.9A CN105734074B (en) | 2016-04-14 | 2016-04-14 | Preparation method of mixed spider silk protein fiber |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201610231221.9A CN105734074B (en) | 2016-04-14 | 2016-04-14 | Preparation method of mixed spider silk protein fiber |
Publications (2)
Publication Number | Publication Date |
---|---|
CN105734074A true CN105734074A (en) | 2016-07-06 |
CN105734074B CN105734074B (en) | 2021-05-04 |
Family
ID=56255141
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201610231221.9A Active CN105734074B (en) | 2016-04-14 | 2016-04-14 | Preparation method of mixed spider silk protein fiber |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN105734074B (en) |
Cited By (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN107338260A (en) * | 2017-07-02 | 2017-11-10 | 东华大学 | A kind of preparation method of recombinant spider silk protein nerve trachea |
CN107365789A (en) * | 2017-07-02 | 2017-11-21 | 东华大学 | A kind of preparation method of recombinant spider silk protein nano fibrous membrane |
CN107376016A (en) * | 2017-07-02 | 2017-11-24 | 东华大学 | A kind of preparation method of recombinant spider silk protein small-caliber artificial blood vessel support |
CN109371035A (en) * | 2018-11-30 | 2019-02-22 | 东华大学 | A kind of gene and preparation method thereof of Araneus ventricosus pyriform gland silk-fibroin |
CN116064486A (en) * | 2021-10-20 | 2023-05-05 | 深圳市灵蛛科技有限公司 | Fusion protein, modified cellulose thereof and preparation method |
-
2016
- 2016-04-14 CN CN201610231221.9A patent/CN105734074B/en active Active
Non-Patent Citations (3)
Title |
---|
LIN Z等: "Engineered large spider eggcase silk protein for strong artificial fibers", 《ADV MATER》 * |
汤传龙: "基因工程仿生蜘蛛丝蛋白中重复模块对成丝性质的影响", 《中国优秀硕士学位论文全文数据库 基础科学辑》 * |
王佳 等: "盐离子对次壶腹腺丝蛋白重组模块的影响", 《生物工程学报》 * |
Cited By (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN107338260A (en) * | 2017-07-02 | 2017-11-10 | 东华大学 | A kind of preparation method of recombinant spider silk protein nerve trachea |
CN107365789A (en) * | 2017-07-02 | 2017-11-21 | 东华大学 | A kind of preparation method of recombinant spider silk protein nano fibrous membrane |
CN107376016A (en) * | 2017-07-02 | 2017-11-24 | 东华大学 | A kind of preparation method of recombinant spider silk protein small-caliber artificial blood vessel support |
CN109371035A (en) * | 2018-11-30 | 2019-02-22 | 东华大学 | A kind of gene and preparation method thereof of Araneus ventricosus pyriform gland silk-fibroin |
CN116064486A (en) * | 2021-10-20 | 2023-05-05 | 深圳市灵蛛科技有限公司 | Fusion protein, modified cellulose thereof and preparation method |
Also Published As
Publication number | Publication date |
---|---|
CN105734074B (en) | 2021-05-04 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN105734074A (en) | Mixed spidroin fiber preparing method | |
CN105755025A (en) | Recombinant spider silk protein preparation method | |
US7335739B2 (en) | Methods for the purification and aqueous fiber spinning of spider silks and other structural proteins | |
CN107475228B (en) | Keratinase mutant with improved substrate specificity and preparation method thereof | |
CN106318390B (en) | A kind of preparation method of biomass N doping fluorescent carbon point | |
CN108456246B (en) | Recombinant spider silk protein, preparation method and application thereof | |
Cai et al. | One-step heating strategy for efficient solubilization of recombinant spider silk protein from inclusion bodies | |
CN109468871A (en) | Wood nano-cellulose prepared from plant straws and method and application thereof | |
CN105079806B (en) | A kind of carbon nanomaterial and its preparation method and application that polypeptide is directly modified | |
CN110305224A (en) | A kind of modification albumen of A β 42 and its expression and purification method with impedance albumen aggregation capability | |
CN105175554B (en) | One type elastin polypeptide and 90 alpha fusion protein of heat stress proteins and its preparation method and application | |
JP6350987B2 (en) | Thermostable β-xylosidase belonging to GH family 3 | |
CN113476594A (en) | Quantum dot enhanced tumor inactivated vaccine and preparation method and application thereof | |
CN105950579A (en) | Method for extracellularly producing Q-enzyme in signal-peptide-free manner | |
CN103833838A (en) | High-performance spider-silk-like protein material and its biosynthesis method | |
CN107365789A (en) | A kind of preparation method of recombinant spider silk protein nano fibrous membrane | |
CN107805283A (en) | One kind intends spider's thread protein and its biological synthesis method | |
CN102676534B (en) | Method for preparing thymosin polypeptide by using interin | |
JP2016059308A (en) | HEAT-STABLE β-XYLOSIDASE OF GH FAMILY 3 | |
JP6286745B2 (en) | Thermostable β-glucosidase | |
CN103060359A (en) | Method for purifying recombinant protein with shortened L2 protein tag adopted | |
CN107376016A (en) | A kind of preparation method of recombinant spider silk protein small-caliber artificial blood vessel support | |
JP6650315B2 (en) | Thermostable cellobiohydrolase | |
CN107338260A (en) | A kind of preparation method of recombinant spider silk protein nerve trachea | |
Li et al. | Heterologous expression characteristics of Trichoderma viride endoglucanase V in the silkworm, Bombyx mori L. |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant |