CN105713973A - Labeled primers and method for identifying pelochelys bibroni with specific area of mitochondrial D-loop region - Google Patents
Labeled primers and method for identifying pelochelys bibroni with specific area of mitochondrial D-loop region Download PDFInfo
- Publication number
- CN105713973A CN105713973A CN201610170843.5A CN201610170843A CN105713973A CN 105713973 A CN105713973 A CN 105713973A CN 201610170843 A CN201610170843 A CN 201610170843A CN 105713973 A CN105713973 A CN 105713973A
- Authority
- CN
- China
- Prior art keywords
- soft
- shelled turtle
- mitochondrial
- loop region
- primer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Analytical Chemistry (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides labeled primers for identifying pelochelys bibroni with the specific area of a mitochondrial D-loop region. The primer group includes D1F: 5'-ATTAATTCATGCTTGTAGGAC-3', and D1R: 5'-CGGGGTAGGGGGTTTAG-3'. The invention further provides a method for identifying pelochelys bibroni with the specific area of the mitochondrial D-loop region. The method includes the steps that the primer group is adopted to perform PCR amplification on whole genome DNA of the sample to be detected, and then electrophoresis is performed; if two bands of pelochelys bibroni specific polymorphism fragments can be obtained, it is judged that the species of the sample to be detected is pelochelys bibroni; otherwise, a contrary result is obtained.
Description
Technical field
The present invention relates to a kind of labeled primer utilizing specific regions, Mitochondrial D-loop Region to identify soft-shelled turtle and method.
Background technology
Soft-shelled turtle (Pelochelyscantorii) is that soft-shelled turtle belongs to one of only three kinds, and be otherwise known as " in water giant panda ".Soft-shelled turtle lives in fresh water, is the one that in Trionychidae, build is maximum.Soft-shelled turtle is widely distributed in Southeast Asian countries, SOUTHERN CHINA, India and Pakistani seashore.But, because hunting, the destruction of habitat and the pollution of environment, distribution and the quantity of soft-shelled turtle sharply reduce.In 1996, soft-shelled turtle was put into World Conservation Union (IUCN) world's endangered animal Red List susceptible species, and is promoted to endangered species in 2000.Because the state that soft-shelled turtle is critically endangered, it is also classified as first class of protection animal by China.
The rareness of soft-shelled turtle makes people lack the understanding to it, and morphological characteristic cannot separately as the standard accurately judged, authentication method is not accurate enough.Soft-shelled turtle and Trionyx sinensis Wiegmann are closely similar in juvenile stage, and the individuality in field can not get effective protection.Because not having Professional knowledge, the people one-tenth soft-shelled turtle caught in field of mistake sometimes is used as wild big Trionyx sinensis Wiegmann and sells.This problem has increased the weight of the minimizing of soft-shelled turtle germ plasm resource further, thus have impact on the effectiveness of protective measure.
Mitochondrial genome is the cyclic DNA of 16-18kb size, encodes 13 albumen, 22 tRNA, 2 rRNA.Mitochondrial DNA has simple in construction, high mutation rate, lacks gene recombinaton and the characteristic of strict matrocliny.Because this feature, mitochondrial DNA is widely used in species identification, phyletic evolution, the research of the aspects such as population diversity.
Summary of the invention
One of the object of the invention is to provide a kind of labeled primer utilizing specific regions, Mitochondrial D-loop Region to identify soft-shelled turtle.
The present invention realizes the purpose of the present invention by the following technical solutions: a kind of labeled primer utilizing specific regions, Mitochondrial D-loop Region to identify soft-shelled turtle, for following primer sets:
D1F:5 '-ATTAATTCATGCTTGTAGGAC-3 '
D1R:5 '-CGGGGTAGGGGGTTTAG-3 '.
Mitochondrial DNA (mtDNA) control zone, also known as D-loop district, is one section of noncoding region, is usually located between tRNAPro and tRNAPhe gene.Structure is complex, is divided into 3 sections: terminator sequence district, central authorities conserved region and conserved sequence district.Owing to lacking the pressure of coding, the tempo of evolution of control zone is relatively fast, the variation of its sequence does not only have the replacement between nucleotide, also has the tandem sequence repeats of the disappearance of different length nucleotide sequence, insertion or different copy number, it is mtdna sequence and the maximum region of length variation, it is usually used in the genetic diversity in planting, evolutionary analysis etc..Although mtDNA aberration rate is high, but there is also some conserved sequences, these conserved sequences can undertake the effect of marker gene.The present inventor adopts the dead young soft-shelled turtle sample extraction mitochondrial DNA of the brilliant of Guangdong Province and Guangning, Zhaoqing and the mitochondrial DNA contrast of Xiamen soft-shelled turtle on NCBI and Yongjia soft-shelled turtle, find that the mitochondrion DNA control area of soft-shelled turtle exists the special construction of repeated fragment, and this special construction does not all find in the testudinate species being currently known.Visible, mitochondrion DNA control area sequence is almost identical in planting, widely different between planting, differentiates between can be used for kind.Thus, the present invention designs specific primer according to described special construction and is used for realizing the qualification to soft-shelled turtle.The present inventor also adopts multiple soft-shelled turtle individuality to be verified, and eliminates due to the probability of the produced special construction of single idiovariation, it is ensured that the popularity of primer application and reliability.The repeated fragment design primer pair that inventor exists for the mitochondrion DNA control area of soft-shelled turtle, and verify the specificity of involved primer.The design attitude that place is forward primer of dotted line mark in Fig. 1, the place of solid line mark is the design attitude of downstream primer, and the expection clip size of each primer set amplifies is in Table 1.Through checking, the D1 primer pair specificity of design is the strongest.
The two of the purpose of the present invention are for providing a kind of method identifying soft-shelled turtle.It is specially, a kind of method utilizing specific regions, Mitochondrial D-loop Region to identify soft-shelled turtle, adopt above-mentioned primer sets that the complete genome DNA of sample to be tested is carried out pcr amplification, then electrophoresis is carried out, if obtaining the band of two soft-shelled turtle specific polymorphic fragments, namely the species judging testing sample are soft-shelled turtles, otherwise then obtain adverse consequences.
Or, after electrophoresis, cut glue recovery soft-shelled turtle specific polymorphic fragment and be attached carrier order-checking, acquired results and the contrast of existing soft-shelled turtle mitochondrial DNA, thus can judge whether the species of testing sample are soft-shelled turtles more definitely.
The loop parameter of pcr amplification reaction of the present invention is: 94 DEG C of 4min that unwind, 94 DEG C of degeneration 30s, 59 DEG C of annealing 30s, and 72 DEG C extend 30s, 30 circulations, and 72 DEG C extend 10min.
The invention has the beneficial effects as follows:
(1) there is the special construction design specific primer of repeated fragment in the present invention according to soft-shelled turtle mitochondrion DNA control area, utilize designed specific primer that the complete genome DNA of sample to be tested is expanded, according to whether the electrophoresis after amplification occurs that the specific polymorphic fragment of soft-shelled turtle judges whether the species of sample to be tested are soft-shelled turtle.
(2) present invention utilizes mtDNA labelling, but need not individually extract mtDNA for identifying, only need to extract full-length genome according to a conventional method, utilize mtDNA a small amount of in full-length genome can obtain qualification result passed through pcr amplification and electrophoresis by primer after, simple to operate, cycle time is short, can identify in high volume, within one day, can obtain qualification result.
Accompanying drawing explanation
Fig. 1 be different soft-shelled turtle mitochondrial DNA in the comparison of aminoacid sequence of control zone,
The place of dotted line mark is primer D1 and the design position in D3 forward primer D-loop district；What black line marked is the design attitude of the downstream primer of D1 and D3, has two basic change position in sequence.
Fig. 2 is special primer screening amplified fragments electrophoretogram,
1 is primer D1 amplification；2 and 3 is primer D2 amplification；4 is primer D3 amplification；5 is DL5000mark.
Fig. 3 is special primer amplified fragments electrophoretogram,
1-4 is Guangning soft-shelled turtle amplified production；5-8 is brilliant soft-shelled turtle amplified production；9 is DL2000mark；10-15 is Mauremys mutica amplified production；16-22 is Trionyx sinensis (Wiegmann) amplified production.
Detailed description of the invention
Following example are used merely to explain the present invention, and protection scope of the present invention is not intended to be limited to following example.The those of ordinary skill of described technical field, according to above present disclosure, all can realize the purpose of the present invention.
Material and method
1.1 materials
In the brilliant of Guangdong Province and Guangning, Zhaoqing, find the living materials having soft-shelled turtle respectively.They are protected in pond and cultivate, and female soft-shelled turtle sexual maturity is laid eggs, successfully hatching children soft-shelled turtle.The tissue of experiment takes from the young soft-shelled turtle sample of death, with utilizing tissue E.Z.N.A.TMTissueDNAKit (OmegaBio-Tek, Guangzhou, China) extracts the soft-shelled turtle complete genome DNA of distribution two places, and-20 degree save backup.
Extraction step is specific as follows:
1) go bail for muscular tissue 30 μ about the g being stored in dehydrated alcohol, and with the ethanol on deionized water wash fingernail, and it is dry to be placed on filter paper.
2) proceed in 1.5ml centrifuge tube cleaning the tissue dried, add 200 μ LBufferTL, shred.
3) 20 μ LOB protease are added, mixing, it is placed in shaking table, 55 DEG C, 180r/min clears up 1-3h.
4), after digestion, 1000g is centrifuged 5min, Aspirate supernatant, is transferred in 1.5ml centrifuge tube, abandons precipitation.
5) 220ulBufferBL is added, mixing, 70 DEG C of water-baths are placed 10min, period mixes 2-3 time.
6) 220ul dehydrated alcohol, mixing are added after taking out.
7) being transferred to by the mixed liquor in previous step and be enclosed within 2ml collecting pipe in HiBindDNA post, in room temperature, the centrifugal 1min of 8000g, is attached on filter membrane by DNA, abandons filtrate.
8) by posts transfer to another group 2ml collecting pipe, add 500 μ LHBBuffer, room temperature 8000g and be centrifuged 1min, abandon filtrate.
9) again by posts transfer to another group 2ml collecting pipe, adding the DNAWashBuffer of 650 μ L ethanol dilutions, in room temperature, the centrifugal 1min of 8000g, outwells filtrate
10) by same group of collecting pipe repeat the above steps 9).
11) pillar is relay in collecting pipe, the centrifugal 3min of 15000g in room temperature.
12) pillar is contained on 1.5ml centrifuge tube, opens pillar lid, in dry 3min, add the sterilized water of 50ul70 DEG C of preheating.At room temperature place 3min.Under room temperature, 10000g is centrifuged 2min, and the filtrate obtained is DNA solution.
13) agarose gel electrophoresis detects purity and the integrity of DNA, NanoQTM microspectrophotometer detection DNA concentration, and is diluted to final concentration 20ng/ μ L with deionized water, is placed in-20 DEG C and saves backup.
The design of specific primer and screening
There is the part (Fig. 1) repeated in D-loop district, devise 2 pairs of primers (table 1) according to repeating part.Because there is repeated fragment, length polymorphism will be presented through PCR electrophoresis primer amplification result.
Carrying out pcr amplification respectively with the complete genome DNA of the primer pair soft-shelled turtle of design, compare with reference to intended polymorphic bands size and electrophoresis result, screening reaches intended primer.
PCR adopts 20 μ l reaction systems, the template DNA (20ng) of 1 μ l, the PremixTaq of 10 μ lTM(TakaraBiotechnology, Dalian, China), the upstream and downstream primer (10mM) of 0.5 μ l, 8 μ l water are mended to 20 μ l.The loop parameter of pcr amplification reaction is: 94 DEG C of 4min that unwind, 94 DEG C of degeneration 30s, 59 DEG C of annealing 30s, and 72 DEG C extend 30s, 30 circulations, and 72 DEG C extend 10min.
Electrophoresis result is as in figure 2 it is shown, the primer of design utilizes soft-shelled turtle genomic DNA amplification to carry out primary dcreening operation, and primer D1-3 presents polymorphic bands.But D2-3 is not enough due to specificity, except obtaining the fragment of expection size, also occur in that the fragment outside expection size.And primer D1 does not have assorted band, obtain the purpose band of expection size simultaneously, selected as main screening primer.
Primer amplification sequencing fragment is verified
Pcr amplification product utilizes E.Z.N.A glue reclaim test kit (Omega) purification reclaim:
(1) with tbe buffer liquid preparation 1.2%(w/v) agarose gel (containing 0.5 μ g/mLDNAgreen).
(2) DNA sample adding loading wells, 220V voltage, room temperature carries out electrophoresis 13min.
(3) under uviol lamp, observe DNA band migration position, when purpose band separates and knows, cut the gel containing target DNA with clean blade, proceed in 1.5mL centrifuge tube.
(4) reclaim, according to E.Z.N.A glue, the method recovery purified pcr product that test kit operating procedure (Omega) is introduced.
(5) weigh the weight of sky centrifuge tube, cut the gel with purpose fragment and be contained in 1.5mL centrifuge tube and claim its weight, determine its volume approx.Generally, the density of gel is 1g/mL, and then the volume of gel can by following conversion with the relation of weight: the weight of gel slice is 0.2g then its volume is 0.2mL；Add the BindingBuffer of equimultiple gel volume, mixture is placed in 55 DEG C of-65 DEG C of water-baths temperature bath 7min and melts completely to gel, mix once every 2-3min therebetween.
(6) shifting DNA-agarose solution to the HiBindTMDNA pillar of 700 μ L, and pillar is contained in a dry 2mL collecting pipe, under room temperature, 10,000 × g is centrifuged 1min, discards liquid.
(7) HiBindDNA pillars can hold at most the solution of 700 μ L, if the volume of DNA-agarose mix is more than 700 μ L, can first shift 700 μ L solution to pillar, after being centrifuged, continues remaining solution plus on pillar.But each HiBindTM pillar at most can in conjunction with 25-30 μ gDNA.If it is expected that yield is relatively big, then sample is added separately in suitable number of post.
(8) pillar is recovered in collecting pipe again, add in 300 μ LBindingBuffer to HiBindDNA pillars；Under room temperature, 10,000 × g is centrifuged 1min, removes filter liquor completely.
(9) again being recovered in collecting pipe by pillar, add in 700 μ LSPWWashbuffer to HiBindDNA pillars, under room temperature, 10,000 × g is centrifuged 1min, goes to abandon filter liquor.
(10) again being recovered in collecting pipe by pillar, repeat to add in 700 μ LSPWWashbuffer to HiBindDNA pillars, under room temperature, 10,000 × g is centrifuged 1min, discards filter liquor；
(11) after discarding filter liquor, pillar is recovered in collecting pipe again, the liquid that the centrifugal 1min of 10,000 × g is remaining to dry base for post matter.
(12) pillar being contained on a clean 1.5mL centrifuge tube, add on 30 ~ 50 μ L eluents or aquesterilisa on pillar film, 10,000 × g is centrifuged 1min, and the solution in centrifuge tube is exactly the DNA product of purification, is stored in-20 DEG C.
The DNA of recovery is connected in pMD18-TVector carrier, is transformed into competent cell DH5a, after 37 DEG C of cultivation 8h, check order after selecting positive colony detection.Two clip size results of primer D1 amplification are 107bp and 370bp respectively, identical with expected results.By same for the sequence of sequencing result NCBI(NationalCenterforBiotechnologyInformation) upper it has been determined that the mitochondrial DNA of soft-shelled turtle compare, the similarity of comparison result is 99%, therefore determines primer D1 and the D3 DNA fragmentation that DNA fragmentation is soft-shelled turtle obtained by pcr amplification.
How individual and negative control is verified
After filtering out primer, taking 6 samples and adopt primer D1 to carry out pcr amplification, then electrophoresis, whether the primer observing screening normally can act in great amount of samples, it is judged that the application feasibility of primer.Utilizing Trionyx sinensis (Wiegmann), the complete genome DNA of Mauremys mutica expands as negative control simultaneously, it is determined that whether primer only occurs in that length polymorphism in soft-shelled turtle or have amplification ability.Electrophoresis result as shown in Figure 3 is it can be seen that adopt two polymorphic fragments of appearance that the soft-shelled turtle sample of primer amplification provided by the invention can be stable, and Trionyx sinensis Wiegmann can not run complete band, and Mauremys mutica can only amplify a kind of fragment, thus proving the specificity of the primer of the present invention.
PCR adopts 20 μ l reaction systems, the template DNA (20ng) of 1 μ l, the PremixTaqTM (TakaraBiotechnology of 10 μ l, Dalian, China), the upstream and downstream primer (10mM) of 0.5 μ l, 8 μ l water are mended to 20 μ l.The loop parameter of pcr amplification reaction is: 94 DEG C of 4min that unwind, 94 DEG C of degeneration 30s, 59 DEG C of annealing 30s, and 72 DEG C extend 30s, 30 circulations, and 72 DEG C extend 10min.
Sequence table
<110>China's Pearl River Fishery Research Institute of Aquatic Science Research Institute
<120>a kind of labeled primer utilizing specific regions, Mitochondrial D-loop Region to identify soft-shelled turtle and method
<160>4
<210>1
<211>21
<212>DNA
<213>artificial sequence
<223>primer
<400>1
ATTAATTCATGCTTGTAGGAC21
<210>2
<211>17
<212>DNA
<213>artificial sequence
<223>primer
<400>2
CGGGGTAGGGGGTTTAG17
<210>3
<211>21
<212>DNA
<213>artificial sequence
<223>primer
<400>3
GGATTTTGGGGTTTGAACGAG21
<210>4
<211>19
<212>DNA
<213>artificial sequence
<223>primer
<400>4
TTTTGGGGTTTGACGAGAG19
Claims (5)
1. utilize specific regions, Mitochondrial D-loop Region to identify a labeled primer for soft-shelled turtle, it is characterized in that, for following primer sets:
D1F:5 '-ATTAATTCATGCTTGTAGGAC-3 '
D1R:5 '-CGGGGTAGGGGGTTTAG-3 '.
2. one kind utilizes the method that soft-shelled turtle is identified in specific regions, Mitochondrial D-loop Region, it is characterized in that, adopt primer sets described in claim 1 that the complete genome DNA of sample to be tested is carried out pcr amplification, then electrophoresis is carried out, if obtaining the band of two soft-shelled turtle specific polymorphic fragments, namely the species judging testing sample are soft-shelled turtles, otherwise then obtain adverse consequences.
3. the method utilizing specific regions, Mitochondrial D-loop Region qualification soft-shelled turtle described in claim 2, is characterized in that, the loop parameter of described pcr amplification reaction is: 94 DEG C of 4min that unwind, 94 DEG C of degeneration 30s, 59 DEG C of annealing 30s, 72 DEG C extend 30s, 30 circulations, 72 DEG C extend 10min.
4. one kind utilizes the method that soft-shelled turtle is identified in specific regions, Mitochondrial D-loop Region, it is characterized in that, adopt primer sets described in claim 1 that the complete genome DNA of sample to be tested is carried out pcr amplification, then electrophoresis is carried out, cut glue recovery soft-shelled turtle specific polymorphic fragment and be attached carrier order-checking, acquired results and the contrast of existing soft-shelled turtle mitochondrial DNA, thus can judge whether the species of testing sample are soft-shelled turtles more definitely.
5. the method utilizing specific regions, Mitochondrial D-loop Region qualification soft-shelled turtle described in claim 4, is characterized in that, the loop parameter of described pcr amplification reaction is: 94 DEG C of 4min that unwind, 94 DEG C of degeneration 30s, 59 DEG C of annealing 30s, 72 DEG C extend 30s, 30 circulations, 72 DEG C extend 10min.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610170843.5A CN105713973B (en) | 2016-03-24 | 2016-03-24 | A kind of labeled primer and method using Mitochondrial D-loop Region specific regions identification soft-shelled turtle |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610170843.5A CN105713973B (en) | 2016-03-24 | 2016-03-24 | A kind of labeled primer and method using Mitochondrial D-loop Region specific regions identification soft-shelled turtle |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105713973A true CN105713973A (en) | 2016-06-29 |
| CN105713973B CN105713973B (en) | 2019-04-26 |
Family
ID=56159199
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610170843.5A Expired - Fee Related CN105713973B (en) | 2016-03-24 | 2016-03-24 | A kind of labeled primer and method using Mitochondrial D-loop Region specific regions identification soft-shelled turtle |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105713973B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106566833A (en) * | 2016-09-26 | 2017-04-19 | 南开大学 | New gene MDL1, and quantitative detection method thereof |
| CN114317525A (en) * | 2021-01-20 | 2022-04-12 | 中国水产科学研究院珠江水产研究所 | Method for obtaining non-destructive turtle genome DNA sample, extraction method and application |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101838684A (en) * | 2009-12-25 | 2010-09-22 | 华东理工大学 | PCR identification method of Chinese medicament turtle-derived component |
| CN103074433A (en) * | 2013-01-14 | 2013-05-01 | 吉林市雷博科技有限公司 | Turtle shell DNA detection kit and identification method |
| CN103255220A (en) * | 2013-05-04 | 2013-08-21 | 吉林市雷博科技有限公司 | Tortoise shell DNA detection kit and identification method |
| CN103865921A (en) * | 2014-02-27 | 2014-06-18 | 中国水产科学研究院珠江水产研究所 | Method for amplifying o complete sequence of mitochondria of golden coin turtle by using DNA extracted from nails |
| CN104946729A (en) * | 2014-03-28 | 2015-09-30 | 中国中医科学院中药研究所 | PCR (Polymerase Chain Reaction) specific primers and detection method for authenticating tortoise shell |
-
2016
- 2016-03-24 CN CN201610170843.5A patent/CN105713973B/en not_active Expired - Fee Related
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101838684A (en) * | 2009-12-25 | 2010-09-22 | 华东理工大学 | PCR identification method of Chinese medicament turtle-derived component |
| CN103074433A (en) * | 2013-01-14 | 2013-05-01 | 吉林市雷博科技有限公司 | Turtle shell DNA detection kit and identification method |
| CN103255220A (en) * | 2013-05-04 | 2013-08-21 | 吉林市雷博科技有限公司 | Tortoise shell DNA detection kit and identification method |
| CN103865921A (en) * | 2014-02-27 | 2014-06-18 | 中国水产科学研究院珠江水产研究所 | Method for amplifying o complete sequence of mitochondria of golden coin turtle by using DNA extracted from nails |
| CN104946729A (en) * | 2014-03-28 | 2015-09-30 | 中国中医科学院中药研究所 | PCR (Polymerase Chain Reaction) specific primers and detection method for authenticating tortoise shell |
Non-Patent Citations (1)
| Title |
|---|
| XIAO CHEN ET AL: "complete mitochondrial genome of the endangered Asian giant softshell turtle pelochelys cantorii(Testudinata:Trinoychidae)", 《MITOCHONDRIAL DNA》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106566833A (en) * | 2016-09-26 | 2017-04-19 | 南开大学 | New gene MDL1, and quantitative detection method thereof |
| CN106566833B (en) * | 2016-09-26 | 2020-04-28 | 南开大学 | MDL1 and quantitative detection method thereof |
| CN114317525A (en) * | 2021-01-20 | 2022-04-12 | 中国水产科学研究院珠江水产研究所 | Method for obtaining non-destructive turtle genome DNA sample, extraction method and application |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105713973B (en) | 2019-04-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104513865B (en) | Reverse transcription PCR detects test kit and the detection method thereof of Chikungunya virus | |
| CN103789301B (en) | The Auele Specific Primer of Portunus trituberculatus Miers microsatellite marker and screening method | |
| CN110105436A (en) | The ELISA detection kit and the preparation method and application thereof of 3 type antibody of pig circular ring virus | |
| CN102634591B (en) | Genetically modified rice BT63 and LAMP (loop mediated isothermal amplification) detection primer group, detection kit and detection method of derived variety thereof | |
| CN105273065B (en) | 1 type duck hepatitis A virus VP2 recombinant protein of one kind, ELISA kit and preparation method thereof | |
| CN104673934A (en) | Koi herpesvirus RT-LAMP detection primer group, kit and detection method thereof | |
| CN105713973A (en) | Labeled primers and method for identifying pelochelys bibroni with specific area of mitochondrial D-loop region | |
| Vicenova et al. | First detection of pike fry-like rhabdovirus in barbel and spring viraemia of carp virus in sturgeon and pike in aquaculture in the Czech Republic | |
| CN114164184A (en) | Newcastle disease virus gene VI type vaccine strain and application thereof | |
| CN106011276B (en) | For identifying that the species specificity PCR of the balcony frog identifies primer and method and application | |
| CN102876777B (en) | The special primer of brown croaker EST microsatellite marker and screening method | |
| CN108998572A (en) | For expanding the universal primer group and its application of canine distemper virus whole genome sequence | |
| CN103397110B (en) | Execute Maron shellfish lattice virus isothermal amplification fast detection method | |
| Abubakar et al. | Field and molecular epidemiology of peste des petits ruminants in Pakistan | |
| Barbezange et al. | Molecular study of the quasispecies evolution of a typical pigeon paramyxovirus type 1 after serial passages in pigeons by contact | |
| CN105349700B (en) | A kind of MVM plants of quick discriminating minute parvovirus of mice and MPV plants of HRM detection methods and primer | |
| CN105506075B (en) | One kind SNP marker relevant to Pear black spot resistance and application | |
| CN107630008A (en) | Genotype Ⅶ NDV marker vaccine strain and its application | |
| CN113337621B (en) | Molecular monitoring method for starfish larvae in coral reef area | |
| CN105695629A (en) | Primers and method for identifying genotype I and genotype II DRVs (duck reoviruses) | |
| CN106957851A (en) | A kind of endoplasmic reticulum spike and the method for triggering er stress | |
| CN111172244B (en) | Method for rapidly identifying schistosoma japonicum infected oncomelania | |
| Xu et al. | A new species of Rhodambulyx Mell, 1939 (Lepidoptera: Sphingidae) from Southwest Chongqing, China | |
| CN113293215A (en) | Molecular detection method of Spodoptera frugiperda resistance gene to Bacillus thuringiensis Bt Cry1F toxin | |
| CN117418023B (en) | Double-band onyx and imogolix species-specific markers, specific primers, application and identification method and kit |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20190426 Termination date: 20210324 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |