CN105709240B - miR-26a inhibitor and application thereof - Google Patents
miR-26a inhibitor and application thereof Download PDFInfo
- Publication number
- CN105709240B CN105709240B CN201610167807.3A CN201610167807A CN105709240B CN 105709240 B CN105709240 B CN 105709240B CN 201610167807 A CN201610167807 A CN 201610167807A CN 105709240 B CN105709240 B CN 105709240B
- Authority
- CN
- China
- Prior art keywords
- mir
- inhibitor
- cells
- lung cancer
- expression
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
- A61K31/7105—Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/535—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with at least one nitrogen and one oxygen as the ring hetero atoms, e.g. 1,2-oxazines
- A61K31/5375—1,4-Oxazines, e.g. morpholine
- A61K31/5377—1,4-Oxazines, e.g. morpholine not condensed and containing further heterocyclic rings, e.g. timolol
Abstract
The invention provides a miR-26a inhibitor and application thereof. The miR-26a inhibitor nucleic acid sequence is AGCCUAUCCUGGAUUACUUGAA. The provided applications comprise the application of a miR-26a inhibitor for promoting the expression of cancer suppressor gene PTPN 13; the application of the miR-26a inhibitor in preparing a medicament for treating lung cancer; miR-26a inhibitor: AGCCUAUCCUGGAUUACUUGAA and gefitinib are used for preparing the medicine for treating lung cancer. The miR-26a inhibitor disclosed by the invention can inhibit the expression of miR-26a in lung cancer so as to indirectly relieve the inhibition effect of miR-26a on cancer suppressor gene PTPN13 and achieve the purpose of inhibiting the growth of lung cancer; meanwhile, the miR-26a inhibitor has the sensitization effect of gefitinib in treating lung cancer.
Description
Technical Field
The invention belongs to the technical field of microRNA in molecular biology, and relates to a miR-26a inhibitor and application thereof in preparation of a medicament for treating lung cancer.
Background
Lung cancer mortality is the first cancer death worldwide. Worldwide, non-small cell lung cancer (NSCLC) including Squamous Cell Carcinoma (SCC), Adenocarcinoma (ADC) and Large Cell Carcinoma (LCC) is in about 80-85% of cases. Although surgery, radiotherapy and chemotherapy and molecular targeted therapy are widely used clinically, the life cycle of advanced non-small cell lung cancer is short and the disease death rate is still high.
The microRNA is non-coding small RNA and regulates the expression of a target gene corresponding to the microRNA at a post-transcriptional level. With the deepening of experimental research, the microRNA is found to participate in the regulation of the occurrence and the development of human malignant tumors, wherein the relation between miR-26a and non-small cell lung cancer growth and EGFR-TKIs drug resistance draws more and more attention. Elucidation of the role of miR-26a in non-small cell lung cancer will contribute to the development of new drugs and individualized treatment.
Disclosure of Invention
The research of the inventor finds that the expression of the lung adenocarcinoma tissue is obviously increased compared with that of normal paracarcinoma tissue miR-26 a; the expression of miR-26a in lung adenocarcinoma cell lines SPCA1, PC-9, H2170 and SW900 is obviously higher than that of normal bronchial epithelial cell BEAS-2B. PTPN13 is a known cancer suppressor gene, and miR-26a plays a role in promoting the growth of non-small cell lung cancer by inhibiting the expression of PTPN13 through post-transcriptional regulation. Researches show that PTPN13 inhibits an EGFR signal path by dephosphorizing Src, and high expression of PTPN13 can enhance the sensitivity of lung cancer cells to EGFR-TKIs, so that the miR-26a inhibitor not only has the effect of inhibiting the growth of lung cancer, but also can improve the sensitivity of drug-resistant lung cancer cells to EGFR-TKIs. Further research shows that the miR-26a inhibitor has the effect of inhibiting miR-26a expression after being transfected into cells through a transfection reagent, and can inhibit the growth of lung cancer cells and increase the sensitivity of the lung cancer cells to EGFR-TKIs after the miR-26a expression of the lung cancer cells with high miR-26a expression is inhibited.
The invention provides a miR-26a inhibitor.
The nucleic acid sequence of the miR-26a inhibitor provided by the invention is AGCCUAUCCUGGAUUACUUGAA.
The invention also provides a miR-26a inhibitor: AGCCUAUCCUGGAUUACUUGAA for promoting the expression of cancer suppressor gene PTPN 13.
The invention also provides a miR-26a inhibitor: AGCCUAUCCUGGAUUACUUGAA application in preparing medicine for treating lung cancer.
The invention further provides a miR-26a inhibitor: AGCCUAUCCUGGAUUACUUGAA and gefitinib are used for preparing the medicine for treating lung cancer.
The miR-26a inhibitor disclosed by the invention can inhibit miR-26a in lung cancer so as to indirectly relieve the inhibition effect of miR-26a on cancer suppressor gene PTPN13 and achieve the purpose of inhibiting the growth of lung cancer; meanwhile, the miR-26a inhibitor has the sensitization effect of gefitinib in treating lung cancer.
miR-26a inhibitor synthesis: the miR-26a inhibitor is RNA or DNA which is chemically synthesized and is similar to miR-26a antisense sequence. According to the miR-26a sequence UUCAAGUAAUCCAGGAUAGGCUCCUAUCCUGGAUUACUUGAAUU, an oligonucleotide biosynthesis technology is adopted to synthesize a plurality of miR-26a inhibitors respectively, after the inhibitors are transfected into SPCA1 cells through a transfection reagent, a qRT-PCR method is adopted to detect the expression of miR-26a, and the miR-26a inhibition sequence with the highest inhibition efficiency is selected: AGCCUAUCCUG GAUUACUUGAA are provided.
The expression of miR-26a in lung adenocarcinoma tissues and lung adenocarcinoma cell lines is abnormally increased: the expression level of miR-26a in 5 pairs of lung adenocarcinoma and paracarcinoma tissues thereof and 6 non-small cell lung cancer cell lines A549, SPCA1, PC-9, H2170, SW900 and H520 is detected by adopting a qRT-PCR method (normal lung bronchial epithelial cell BEAS-2B is taken as a control). As a result, the expression of miR-26a in lung adenocarcinoma tissues and non-small cell lung cancer cell lines A549, SPCA1 and SW900 is obviously increased compared with that of BEAS-2B cells, and the expression of miR-26a in cell lines PC-9, H2170 and H520 is not obviously different from that of BEAS-2B cells (figure 1). A549, SPCA1 and SW900 are EGFR-TKIs resistant cell lines, and PC-9, H2170 and H520 are EGFR-TKIs sensitive cell lines, suggesting that high expression of miR-26a may be related to drug resistance of lung cancer EGFR-TKIs.
The miR-26a promotes the growth of the lung cancer cells, and the miR-26a inhibitor enhances the sensitivity of EGFR-TKIs drug-resistant cells to TKIs: MTS growth experiments show that the miR-26a inhibitor is added into the SPCA1 cells with high miR-26a expression to inhibit the cell growth; the miR-26a is added into the PC-9 cells with low miR-26a expression, so that the cell growth can be promoted. Further MTS research finds that the sensitivity of the SPCA1 cells to gefitinib can be enhanced by applying the miR-26a inhibitor to gefitinib-resistant SPCA1 cells; and the miR-26a mimics are applied to the Gefitinib-sensitive PC-9 cells, so that the sensitivity of the PC-9 cells to Gefitinib can be weakened (figures 2 and 3).
miR-26a inhibits expression of PTPN 13: bioinformatics predicts that PTPN 133' UTR has a regulatory sequence of miR-26 a. In SPCA1 cells with low expression of PTPN13, the miR-26a inhibitor can promote mRNA expression and protein expression of PTPN13 of SPCA1 cells. In PC-9 cells with high expression of PTPN13, miR-26a mimics can inhibit protein expression of PTPN13 of the PC-9 cells. Constructing a plasmid containing PTPN133 'UTR, co-transfecting miR-26a mimics and the plasmid into HEK293 cells, and verifying that miR-26a can inhibit PTPN13 plasmid expressing PTPN 133' UTR mutation without corresponding change through a luciferase gene experiment (figure 4).
PTPN13 targeting p-Src to dephosphorylate it. miR-26a targets PTPN13, and PTPN13 must regulate an EGFR signal pathway to play a role in sensitizing TKIs. Research on co-immunoprecipitationSrc in the EGFR signaling pathway can now bind to PTPN 13. PTPN13 is a phospholipase and in combination with Src performs phospholipase dephosphorylation. The bioinformatics calculation finds PTPN13-SrcpTyr416The temporal spatial stability of the complex is good and the binding site of PTPN13-Src complex is exactly the catalytic domain of PTPN13 and pTyr416 site of Src. Src after Gene silencing PTPN13 in H520 cellspTyr416The phosphorylation level of (c) was significantly increased (fig. 5).
The lung transplantation tumor volume and weight of the SPCA1 cells can be obviously reduced by combining miR-26a antagomir and gefitinib (figure 6). The transplanted tumor mice were divided into 4 groups: a control group, a gefitinib group, a miR-26a antagomir intratumoral injection group and a gefitinib intragastric gavage combined miR-26a antagomir intratumoral injection group. The miR-26a inhibitor and gefitinib combined tumor volume and weight are most obviously reduced.
Drawings
FIG. 1. expression differences of miR-26a in lung cancer tissues and cell lines; a, detecting the expression level of miR-26a in 5 pairs of non-small cell lung cancer and paracancer normal tissues by a qRT-PCR method; and B, detecting the expression level of miR-26a in normal bronchial epithelial cells BEAS-2B and 6 non-small cell lung cancer cell lines by using a qRT-PCR method.
FIG. 2. effect of miR-26a in Gefitinib-resistant SPCA1 adenocarcinoma cell line; the miR-26a and gefitinib can obviously inhibit the growth of the SPCA1 cells; a miR-26a inhibitor (miR-26a antagomir) can increase the sensitivity of SPCA1 cells to gefitinib.
FIG. 3. role of miR-26a in Gefitinib-sensitive PC-9 lung adenocarcinoma cell line; miR-26a mimics can promote the growth of PC-9 cells; miR-26a mimics can reduce the sensitivity of PC-9 cells to gefitinib.
FIG. 4.miR-26a inhibits expression of PTPN 13; a, a control sequence of miR-26a exists at the 3' end of PTPN13; miR-26a inhibitor can promote mRNA expression of PTPN13 of SPCA1 cells; the miR-26a inhibitor can promote protein expression of PTPN13 of SPCA1 cells; miR-26a mimics can inhibit protein expression of PTPN13 of PC-9 cells; luciferase reporter plasmid detection after co-transfection of the 3' UTR of ptpn13 and its mutant plasmid in HEK93 cells.
FIG. 5 targeting p-Src dephosphorylating PTPN 13; ip Src can bind PTPN 13; the PTPN13-SrcPTyr416 compound has good time-space stability; interaction site analysis of ptpn13-SrcpTyr416 complex; D. the phosphorylation level of Src is obviously improved after gene silencing PTPN 13.
FIG. 6 shows experimental tumor growth changes of SPCA1 cell transplantation tumor in nude mice; the transplanted tumor mice were divided into 4 groups: a control group, a gefitinib group, a miR-26a antagomir intratumoral injection group and a gefitinib intragastric gavage combined miR-26a antagomir intratumoral injection group. The miR-26a inhibitor and gefitinib combined group has the minimum tumor volume; the miR-26a inhibitor and gefitinib combined tumor weight is minimum.
Detailed Description
Synthesis of miR-26a inhibitor
According to the miR-26a sequence UUCAAGUAAUCC AGGAUAGGCUCCUAUCCUGGAUUACUUGAAUU, a plurality of miR-26a antisense oligonucleotides are respectively synthesized by adopting an oligonucleotide biosynthesis technology, after the antisense oligonucleotides are transfected into SPCA1 cells by a transfection reagent, the expression of miR-26a is detected by adopting a qRT-PCR method, and the miR-26a inhibition sequence with the highest inhibition efficiency is selected: AGCCUAUCCUG GAUUACUUGAA are provided.
qRT-PCR detection of miR-26a expression
The non-small cell lung cancer tissue and the paracancerous normal lung tissue corresponding to the non-small cell lung cancer tissue are both taken from an operation sample, and the tissue sample is immediately placed in a liquid nitrogen tank which is prepared before after being taken out by an operator for preservation. The BEAS-2B, SW900, H2170 and H520 cell lines were purchased from ATCC, A549, SPCA1 and PC-9 were provided by fourth university of military medical science, biochemistry and molecular biology laboratory, A549 cells were cultured in DMEM medium containing 10% Fetal Bovine Serum (FBS), and BEAS-2B, SPCA1, PC-9, SW900, H2170 and H520 were cultured in modified Medium 1640 containing 10% Fetal Bovine Serum (FBS). Total RNA of non-small cell lung cancer, paracarcinoma tissues, normal lung epithelial cells and lung cancer cells is extracted by TRIzolmethyl ethod (Life technologies), reversed into cDNA by a MiScript Reverse Transcription Kit, and the expression of miR-26a is detected by qRT-PCR.
3. MTS (methyl thiazolyl tetrazolium) experiment detection cell proliferation level after cell transfection of miR-26a inhibitor or mimics
SPCA1 cells are transfected with microRNA antagomir NC (control) and human miR26a inhibitor (miR26aantagomir), and PC-9 cells are transfected with microRNA antagomir NC and human miR26a mimics. The cells were plated in 6-well plates with SPCA1 or PC-9 cells and were observed to have 70% confluency and good cell status for 8-12 hours. 20ul antagomir NC, human miR26a antagomir and human miR26a mics were diluted with 400ul serum-free 1640. The transfection reagent was gently mixed, 6ul (per well) was aspirated and added to the diluted antagomir NC, human miR26a antagomir, human miR26a mimics, and mixed by pipette and left to stand for 20 min. 400ul of microRNA-transfection reagent mixture (added dropwise) was added to each well, and the 6-well plate was shaken gently and mixed well. Adding Gefitinib 15 μ M at 37 deg.C and 5% CO respectively2The MTS experiment was performed after 48 hours incubation in the incubator.
(1) Observing the growth state of the cells, collecting the cells by conventional digestion with 0.25% trypsin, counting the number of the counting plates according to the experimental requirements, and adjusting the cell concentration to 8 × 10 according to the counting result4After gently mixing the cell suspension in a pipette, 100ul of the suspension was added to a 96-well plate, the edges were carefully filled with sterile PBS, and 100ul of the medium was added to the control group.
(2) Incubated at 37 ℃ in a 5% carbon dioxide incubator for 4 hours, and observed under an inverted microscope.
(3) 20ul of MTS solution (PMS50ul + MTS solution 1ml) was added to each well and incubated at 37 ℃ for 3 hours.
(4) The absorbance was measured at 490nm wells and the above experiment was repeated at 0, 24, 48, 72, and 96 hours.
(5) Meanwhile, blank wells (medium and MTS solution, no cells) and control wells (no treatment medium and MTS solution, cells) were set, and 3 duplicate wells were set for each group.
Inhibition of expression of PTPN13 by miR-26a
(1) Bioinformatics predicts that PTPN 133' UTR has a regulatory sequence of miR-26 a.
(2) In SPCA1 cells with low expression of PTPN13, a qRT-PCR method is adopted to detect the influence of miR-26a inhibitor on mRNA expression of PTPN 13.
(3) In SPCA1 cells with low PTPN13 expression, a Western-blot method is adopted to detect the influence of a miR-26a inhibitor on the expression of PTPN13 protein.
(4) In a PC-9 cell with high PTPN13 expression, a Western-blot method is adopted to detect the influence of miR-26a mimics on PTPN13 protein expression.
(5) Constructing a plasmid containing PTPN 133' UTR, co-transfecting miR-26a mimics and the plasmid into HEK293 cells, and verifying that miR-26a can inhibit expression of PTPN13 through a luciferase gene experiment. The plasmid with the PTPN 133' UTR mutation has no corresponding change. The specific method comprises the following steps:
the method comprises the steps of performing PCR by taking BEAS-2B genome DNA as a template and PTPN 133' UTR primer synthesized by the former worker as a primer, performing agarose gel electrophoresis to obtain 612 white bright bands, photographing, performing gel recovery from the bright bands after performing PCR by using primers with enzyme cutting sites (EcoR I and Pst I) in a 50ul system, connecting SV40-PGL3basic vector recovered by double-enzyme gel cutting, performing transformation, selecting and cloning, placing the vector in an LB (lysogeny broth) culture medium containing ampicillin, performing shaking incubation for 16 hours at 37 ℃ by using a shaking table as template PCR, performing plasmid extraction after performing shaking incubation for 16 hours by using a shaking table by adding LB5ml37 ℃ containing the bright bands and LB5ml containing the ampicillin, and performing double-enzyme digestion identification after quantifying.
Laying HEK293 cells in a 24-hole plate, observing the cells to be uniform after 10 hours, wherein the confluence reaches 70%, co-transfecting PTPN133 'UTR-612 wild type plasmids, PTPN 133' UTR mutant plasmids and miR-26a in the HEK293 cells, carrying out Luciferase reporter gene experiments after 48 hours, and setting 5 multiple holes in each group, wherein the results show that the Luciferase of the wild type miR-26a group transfected with PTPN13 is obviously reduced compared with a control group, which indicates that miR-26a can target and act on PTPN 13.
PTPN13 targeting p-Src to dephosphorylate it
(1) By adopting anti-Src antibody for co-immunoprecipitation and anti-PTPN13 antibody for Western-blot, it is found that Src in EGFR signal channel can be combined with PTPN 13.
(2) The research of bioinformatics calculation finds that PTPN13-SrcpTyr416The temporal spatial stability of the complex is good and the binding site of PTPN13-Src complex is exactly the catalytic domain of PTPN13 and pTyr416 site of Src.
(3) The expression of PTPN13 is targeted and silenced in H520 cells by adopting a gene silencing technology, and Src is detected by adopting a Western-blot technologypTyr416The phosphorylation level of (c).
6. Nude mouse transplanted tumor experiment for detecting growth of SPCA1 cell transplanted tumor
The SPCA1 subcutaneous injection method is adopted to carry out nude mouse transplantation tumor experiments, and the experiments are divided into 4 groups as follows:
(1) NC group (nude mice inoculated with SPCA1 tumor cells only);
(2) gefitinib gavage group;
(3) an intratumoral miR-26a antagomir injection group;
(4) the miR-26a antagomir intratumorally injection group is combined with gefitinib gavage.
Culturing human lung cancer cell SPCA1 in 1640 culture medium containing 10% fetal calf serum, adding 100IU/ml penicillin and 100IU/ml streptomycin double antibody 100ul/100ml, culturing at 37 deg.C in 5% carbon dioxide incubator, digesting, centrifuging, washing with PBS, collecting (removing secondary antibody effect), and culturing with 1 × 10% cell culture medium71Inoculating to the axilla of nude mice within half an hour, setting 5 mice per group, and allowing the transplanted tumor to grow for about 4-5 days until the tumor grows to about 100mm3Experiments are carried out, the gefitinib group uses gefitinib intragastric administration (25mg/kg/day), the miR-26a inhibitor group is used for miR-26a antagomir intratumoral injection (40ug multi-point injection, 2 times/week), and the gefitinib intragastric administration and miR-26a inhibitor intratumoral injection are carried out simultaneously under the combined action of the gefitinib and the miR-26a inhibitor; measuring the tumor volume with vernier caliper every 3 days according to the formula V ═ width2× length/2) the graft volume was calculated.
All experimental results were taken as mean ± sd
Indicated, treatment with SPSS13.0 software, using paired t-test or one-way anova. Statistical results P < 0.05 were assigned to be statistically significant.
Claims (1)
- The application of the miR-26a inhibitor and gefitinib in preparation of a medicine for treating lung cancer is disclosed, wherein the nucleic acid sequence of the miR-26a inhibitor is AGCCUAUCCUGGAUUACUUGAA.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610167807.3A CN105709240B (en) | 2016-03-23 | 2016-03-23 | miR-26a inhibitor and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610167807.3A CN105709240B (en) | 2016-03-23 | 2016-03-23 | miR-26a inhibitor and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105709240A CN105709240A (en) | 2016-06-29 |
| CN105709240B true CN105709240B (en) | 2020-07-07 |
Family
ID=56157945
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610167807.3A Active CN105709240B (en) | 2016-03-23 | 2016-03-23 | miR-26a inhibitor and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105709240B (en) |
Family Cites Families (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102319247A (en) * | 2010-11-25 | 2012-01-18 | 上海聚类生物科技有限公司 | Mir-26a-targeted anti-osteosarcoma small molecular compound |
| WO2012093384A1 (en) * | 2011-01-03 | 2012-07-12 | Rosetta Genomics Ltd. | Compositions and methods for treatment of ovarian cancer |
| CN112426538A (en) * | 2011-08-04 | 2021-03-02 | 耶达研究及发展有限公司 | micro-RNAs and compositions comprising micro-RNAs |
| CN102488903A (en) * | 2011-12-31 | 2012-06-13 | 南京医科大学第二附属医院 | Application of miR-224 to preparation of medicament for treating non-small cell lung cancer |
| US20140363469A1 (en) * | 2012-01-19 | 2014-12-11 | Alnylam Pharmaceuticals, Inc. | Viral attenuation and vaccine production |
| CN106367474B (en) * | 2015-07-21 | 2020-01-31 | 益善生物技术股份有限公司 | 18 miRNA detection probes and liquid phase chip |
-
2016
- 2016-03-23 CN CN201610167807.3A patent/CN105709240B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN105709240A (en) | 2016-06-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Yang et al. | MicroRNA-218 functions as a tumor suppressor in lung cancer by targeting IL-6/STAT3 and negatively correlates with poor prognosis | |
| Lin et al. | Inhibitory effects of miR-146b-5p on cell migration and invasion of pancreatic cancer by targeting MMP16 | |
| Spaccarotella et al. | STAT3-mediated activation of microRNA cluster 17~ 92 promotes proliferation and survival of ALK-positive anaplastic large cell lymphoma | |
| Zhou et al. | miR-503 regulates metastatic function through Rho guanine nucleotide exchanger factor 19 in hepatocellular carcinoma | |
| CN108165549B (en) | Universal expression framework of artificial circular RNA and application thereof | |
| CN107630092B (en) | Application of miR-505-3p in diagnosis, prognosis and treatment of bone metastasis of prostate cancer | |
| CN111518886A (en) | MicroRNA related to sorafenib drug resistance of tumor cells and application thereof | |
| Wong et al. | In vivo genome-wide CRISPR activation screening identifies functionally important long noncoding RNAs in hepatocellular carcinoma | |
| CN113046357A (en) | Levatinib drug resistance gene DUSP9, and screening method and application thereof | |
| CN105709240B (en) | miR-26a inhibitor and application thereof | |
| KR101325186B1 (en) | An Anticancer Agent Comprising Double-stranded miRNAs as an Active Ingredient | |
| CN107502610A (en) | One kind targeting STAT3 signal paths miRNA and its preparation method and application | |
| CN113528528A (en) | shRNA for promoting apoptosis of imatinib-resistant chronic myelocytic leukemia cell K562/G01 and application thereof | |
| CN103667430B (en) | A kind of purposes and its related drugs of eight polynucleotides binding protein expression gene | |
| CN113528522A (en) | miR-339-enhancer-target gene network activation model and application thereof | |
| CN102229928B (en) | Small-interfering RNA (Ribonucleic Acid) of human RBBP6 (Retinoblastoma-binding Proteingene) and application thereof | |
| Fang et al. | MIIP inhibits malignant progression of hepatocellular carcinoma through regulating AKT. | |
| CN110538179B (en) | Application of YG1702 in preparation of ALDH18A1 specific inhibitor | |
| CN116676391B (en) | Application of USP21-MOF (universal serial bus-metal-oxide-fiber) regulation shaft in preparation of drug for targeted treatment of esophageal squamous cell carcinoma | |
| Cheng et al. | MicroRNA-294 Promotes Cell Proliferation, Migration and Invasion in SMMC-7721 Hepatoma Carcinoma Cells by Activating the JNK/ERK Signaling Pathway | |
| CN117568347B (en) | Application of PPEF1 as neuroblastoma drug target | |
| CN103667424A (en) | Usage of human EIF3H gene and related medicaments | |
| CN116904469B (en) | Inhibitor for p300 protein expression, preparation method and application thereof | |
| CN116676392B (en) | Application of USP10-MOF-ANXA2 signal path as drug target in preparation of drug for treating esophageal squamous cell carcinoma | |
| Liu et al. | miR-383-5p serves as a tumor suppressor in bladder cancer by suppressing PI3K/AKT signaling pathway |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |