CN105709240B - A kind of miR-26a inhibitor and its application - Google Patents

Abstract

The invention provides a miR-26a inhibitor and application thereof. The miR-26a inhibitor nucleic acid sequence is AGCCUAUCCUGGAUUACUUGAA. The provided applications comprise the application of a miR-26a inhibitor for promoting the expression of cancer suppressor gene PTPN 13; the application of the miR-26a inhibitor in preparing a medicament for treating lung cancer; miR-26a inhibitor: AGCCUAUCCUGGAUUACUUGAA and gefitinib are used for preparing the medicine for treating lung cancer. The miR-26a inhibitor disclosed by the invention can inhibit the expression of miR-26a in lung cancer so as to indirectly relieve the inhibition effect of miR-26a on cancer suppressor gene PTPN13 and achieve the purpose of inhibiting the growth of lung cancer; meanwhile, the miR-26a inhibitor has the sensitization effect of gefitinib in treating lung cancer.

Description

A kind of miR-26a inhibitor and its application

technical field

The invention belongs to the technical field of molecular biology microRNA, and relates to a miR-26a inhibitor and its application for preparing a medicine for treating lung cancer.

Background technique

Lung cancer mortality ranks first in the world for cancer deaths. Worldwide, approximately 80-85% of cases are non-small cell lung cancer (NSCLC), which includes squamous cell carcinoma (SCC), adenocarcinoma (ADC) and large cell carcinoma (LCC). Although surgery, radiotherapy and chemotherapy and molecular targeted therapy have been widely used in clinical practice, the survival period of advanced non-small cell lung cancer is short and the mortality rate is still high.

MicroRNAs are small non-coding RNAs that regulate the expression of their corresponding target genes at the post-transcriptional level. With the deepening of experimental research, it has been found that microRNAs are involved in regulating the occurrence and development of human malignant tumors. Among them, the relationship between miR-26a and the growth of non-small cell lung cancer and EGFR-TKIs resistance has attracted more and more attention. Elucidating the role of miR-26a in non-small cell lung cancer will facilitate new drug development and personalized therapy.

SUMMARY OF THE INVENTION

The inventor's research found that the expression of miR-26a in lung adenocarcinoma tissue was significantly higher than that in normal adjacent tissue; the expression of miR-26a in lung adenocarcinoma cell lines SPCA1, PC-9, H2170, and SW900 was higher than that in normal bronchial epithelial cells BEAS- 2B was significantly elevated. PTPN13 is a known tumor suppressor gene, and miR-26a plays a role in promoting the growth of non-small cell lung cancer by inhibiting the expression of PTPN13 through post-transcriptional regulation. Studies have found that PTPN13 inhibits the EGFR signaling pathway by dephosphorylating Src, and the high expression of PTPN13 can enhance the sensitivity of lung cancer cells to EGFR-TKIs. Therefore, miR-26a inhibitors can not only inhibit the growth of lung cancer, but also improve drug resistance. Sensitivity of lung cancer cells to EGFR-TKIs. Further studies have found that miR-26a inhibitors can inhibit the expression of miR-26a after transfection into cells by transfection reagents. For lung cancer cells with high miR-26a expression, inhibiting the expression of miR-26a can inhibit the expression of lung cancer cells. growth and increased sensitivity of lung cancer cells to EGFR-TKIs.

The present invention provides a miR-26a inhibitor.

The nucleic acid sequence of the miR-26a inhibitor provided by the present invention is AGCCUAUCCUGGAUUACUUGAA.

The present invention also provides the application of miR-26a inhibitor: AGCCUAUCCUGGAUUACUUGAA for promoting the expression of tumor suppressor gene PTPN13.

The invention also provides the application of miR-26a inhibitor: AGCCUAUCCUGGAUUACUUGAA for preparing a medicine for treating lung cancer.

The present invention further provides the application of miR-26a inhibitor: AGCCUAUCCUGGAUUACUUGAA combined with gefitinib for preparing a medicine for treating lung cancer.

The miR-26a inhibitor of the present invention inhibits miR-26a in lung cancer, thereby indirectly releasing the inhibitory effect of miR-26a on the tumor suppressor gene PTPN13, so as to achieve the purpose of inhibiting the growth of lung cancer; at the same time, the miR-26a inhibitor of the present invention has gefitinib The sensitizing effect of Nitrogen in the treatment of lung cancer.

1. miR-26a inhibitor synthesis: miR-26a inhibitors are chemically synthesized RNAs or DNAs that resemble miR-26a antisense sequences. According to the miR-26a sequence UUCAAGUAAUCCAGGAUAGGCUCCUAUCCUGGAUUACUUGAAUU of the present invention, multiple miR-26a inhibitors were synthesized by oligonucleotide biosynthesis technology, and after transfection into SPCA1 cells by transfection reagent, qRT-PCR was used to detect miR -26a expression, select the miR-26a inhibitory sequence with the highest inhibitory efficiency: AGCCUUAUCCUG GAUUACUUGAA.

2. The expression of miR-26a is abnormally increased in lung adenocarcinoma tissues and lung adenocarcinoma cell lines: 5 pairs of lung adenocarcinomas and their adjacent tissues and 6 non-small cell lung cancer cell lines A549 were detected by qRT-PCR. , SPCA1, PC-9, H2170, SW900, H520 expression levels of miR-26a (with normal lung bronchial epithelial cells BEAS-2B as control). The results showed that the expression of miR-26a in lung adenocarcinoma tissue and non-small cell lung cancer cell lines A549, SPCA1 and SW900 was significantly higher than that in BEAS-2B cells. 2B cells were not significantly different (Figure 1). A549, SPCA1 and SW900 were EGFR-TKIs-resistant cell lines, while PC-9, H2170 and H520 were EGFR-TKIs-sensitive cell lines, suggesting that high expression of miR-26a may be associated with EGFR-TKIs resistance in lung cancer.

3. miR-26a promotes the growth of lung cancer cells, and miR-26a inhibitors enhance the sensitivity of EGFR-TKIs-resistant cells to TKIs: MTS growth experiments found that adding miR-26a inhibitors to SPCA1 cells with high miR-26a expression can inhibit the Cell Growth; Addition of miR-26a to PC-9 cells with low miR-26a expression promotes cell growth. Further MTS study found that the application of miR-26a inhibitor to gefitinib-resistant SPCA1 cells can enhance the sensitivity of SPCA1 cells to gefitinib; while the application of miR-26a mimics to gefitinib-sensitive PC-9 cells , the sensitivity of PC-9 cells to gefitinib was attenuated (Figures 2 and 3).

4. miR-26a inhibits the expression of PTPN13: Bioinformatics prediction found that PTPN13 3'UTR has the regulatory sequence of miR-26a. In SPCA1 cells with low PTPN13 expression, miR-26a inhibitor can promote the mRNA and protein expression of PTPN13 in SPCA1 cells. In PC-9 cells with high expression of PTPN13, miR-26a mimics could inhibit the protein expression of PTPN13 in PC-9 cells. A plasmid containing the PTPN13 3'UTR was constructed, and miR-26a mimics and the plasmid were co-transfected into HEK293 cells. The luciferase gene assay confirmed that miR-26a could inhibit the expression of PTPN13. The PTPN13 3'UTR mutant plasmid had no corresponding changes ( Figure 4).

5. PTPN13 targets p-Src to dephosphorylate it. miR-26a targets PTPN13, and PTPN13 must regulate the EGFR signaling pathway to exert the sensitizing effect of TKIs. Co-immunoprecipitation studies found that Src in the EGFR signaling pathway could bind to PTPN13. PTPN13 is a phospholipase, and when combined with Src, it can dephosphorylate phospholipase. Bioinformatics calculations found that the PTPN13-Src ^pTyr416 complex had good temporal and spatial stability, and the binding sites of the PTPN13-Src complex were exactly the catalytic domain of PTPN13 and the pTyr416 site of Src. The phosphorylation level of Src ^pTyr416 was significantly increased after gene silencing of PTPN13 in H520 cells (Figure 5).

6. miR-26a antagomir combined with gefitinib can significantly reduce the volume and weight of SPCA1 cells in lung xenografts (Figure 6). The tumor-transplanted mice were divided into 4 groups: control group, gefitinib group, miR-26a antagomir intratumoral injection group, and gefitinib gavage combined with miR-26a antagomir intratumoral injection group. The miR-26a inhibitor combined with gefitinib group had the most significant reduction in tumor volume and weight.

Description of drawings

Figure 1. The expression difference of miR-26a in lung cancer tissues and cell lines; A. qRT-PCR method to detect the expression level of miR-26a in 5 pairs of non-small cell lung cancer and its adjacent normal tissues; B. qRT-PCR method The expression levels of miR-26a in normal bronchial epithelial cells BEAS-2B and 6 non-small cell lung cancer cell lines were detected.

Figure 2. The role of miR-26a in gefitinib-resistant SPCA1 adenocarcinoma cell line; A. miR-26a combined with gefitinib can significantly inhibit the growth of SPCA1 cells; B. miR-26a inhibitor (miR-26a inhibitor (miR-26a) -26a antagomir) increased the sensitivity of SPCA1 cells to gefitinib.

Figure 3. The role of miR-26a in gefitinib-sensitive PC-9 lung adenocarcinoma cell line; A. miR-26a mimics can promote the growth of PC-9 cells; B. miR-26a mimics can reduce PC-9 9 Cell sensitivity to gefitinib.

Figure 4. miR-26a inhibits the expression of PTPN13; A. There is a regulatory sequence of miR-26a at the 3' end of PTPN13; B. miR-26a inhibitor can promote the mRNA expression of PTPN13 in SPCA1 cells; C. miR-26a inhibitor can Promote the protein expression of PTPN13 in SPCA1 cells; D.miR-26a mimics can inhibit the protein expression of PTPN13 in PC-9 cells; E. The 3'UTR of PTPN13 and its mutant plasmids were co-transfected into HEK93 cells and detected by luciferase reporter plasmid .

Figure 5. PTPN13 targets p-Src to dephosphorylate it; A. IP Src can bind to PTPN13; B. The PTPN13-SrcpTyr416 complex has good temporal and spatial stability; C. The interaction site analysis of the PTPN13-SrcpTyr416 complex ; D. The phosphorylation level of Src was significantly increased after gene silencing of PTPN13.

Figure 6. Tumor growth changes in nude mice SPCA1 cell xenograft experiments; xenograft mice were divided into 4 groups: control group, gefitinib group, miR-26a antagomir intratumoral injection group, and gefitinib gavage combined with miR-26a antagomir intratumoral injection group. A. miR-26a inhibitor combined with gefitinib group had the smallest tumor volume; B. miR-26a inhibitor combined with gefitinib group had the smallest tumor weight.

Detailed ways

1. miR-26a inhibitor synthesis

According to the miR-26a sequence UUCAAGUAAUCC AGGUAGGCUCCUAUCCUGGAUUACUUGAAUU, multiple miR-26a antisense oligonucleotides were synthesized by oligonucleotide biosynthesis technology, and after transfection into SPCA1 cells by transfection reagent, miR-26a was detected by qRT-PCR. -26a expression, select the miR-26a inhibitory sequence with the highest inhibitory efficiency: AGCCUUAUCCUG GAUUACUUGAA.

2. qRT-PCR to detect the expression of miR-26a

The non-small cell lung cancer tissue and its corresponding adjacent normal lung tissue were obtained from surgical specimens. The tissue samples were taken out by the surgeon and placed in a liquid nitrogen tank that had been prepared before for preservation. BEAS-2B, SW900, H2170, H520 cell lines were purchased from ATCC, A549, SPCA1, PC-9 were provided by the Department of Biochemistry and Molecular Biology, Fourth Military Medical University, A549 cells were cultured in 10% fetal bovine serum ( FBS) in DMEM medium, BEAS-2B, SPCA1, PC-9, SW900, H2170, H520 were all cultured in modified 1640 medium containing 10% fetal bovine serum (FBS). TRIzolmethod (Life Technologies) was used to extract total RNA from non-small cell lung cancer, paracancerous tissue, normal lung epithelial cells, and lung cancer cells, which were reversed into cDNA using miScript Reverse Transcription Kit, and the expression of miR-26a was detected by qRT-PCR.

3. Cell proliferation was detected by MTS assay after cells were transfected with miR-26a inhibitor or mimics

SPCA1 cells were transfected with microRNA antagomir NC (control) and human miR26a inhibitor (miR26aantagomir), and PC-9 cells were transfected with microRNA antagomir NC and human miR26a mimics. 6-well plates were plated with SPCA1 or PC-9 cells, and the confluence of cells was observed to reach 70% in 8-12 hours, and the cells were in good condition. Dilute 20ul antagomir NC, human miR26a antagomir and human miR26a mimics with 400ul serum-free 1640. Gently mix the transfection reagent, and pipette 6ul (per well) into the diluted antagomir NC, human miR26a antagomir, and human miR26a mimics, mix well with a pipette and let stand for 20 min. Add 400ul of microRNA-transfection reagent mixture (dropwise) to each well, and shake the 6-well plate to mix well. Add gefitinib 15 μM as needed, and incubate at 37°C in a 5% CO ₂ incubator for 48 hours before performing the MTS experiment.

(1) Observe that the cells grow well, routinely digest the cells with 0.25% trypsin to collect the cells, count the cells according to the experimental requirements, adjust the cell concentration to 8×10 ⁴ /ml according to the counting results, and mix the cell suspension gently with a pipette After that, 100ul were added to the 96-well plate, and the edges were filled with sterile PBS, and 100ul of medium was added to the control group.

(2) Incubate for 4 hours in a 5% carbon dioxide incubator at 37°C, and observe under an inverted microscope.

(3) 20ul of MTS solution (50ul of PMS+1 ml of MTS solution) was added to each well, and incubated at 37°C for 3 hours.

(4) Measure the absorbance value of each well at 490 nm, and repeat the above experiment at 0, 24, 48, 72, and 96 hours.

(5) At the same time, set blank wells (medium and MTS solution, no cells) and control wells (without treatment media and MTS solution, with cells), and set 3 duplicate wells in each group.

4.miR-26a inhibits the expression of PTPN13

(1) Bioinformatics predicted that PTPN13 3'UTR has the regulatory sequence of miR-26a.

(2) In SPCA1 cells with low expression of PTPN13, the effect of miR-26a inhibitor on the mRNA expression of PTPN13 was detected by qRT-PCR.

(3) In SPCA1 cells with low expression of PTPN13, Western-blot method was used to detect the effect of miR-26a inhibitor on the expression of PTPN13 protein.

(4) In PC-9 cells with high PTPN13 expression, Western-blot method was used to detect the effect of miR-26a mimics on PTPN13 protein expression.

(5) A plasmid containing PTPN13 3'UTR was constructed, and miR-26a mimics and the plasmid were co-transfected into HEK293 cells. The luciferase gene assay confirmed that miR-26a could inhibit the expression of PTPN13. The PTPN13 3'UTR mutated plasmid had no corresponding change. The specific method is as follows:

Using the BEAS-2B genomic DNA as the template and the PTPN13 3'UTR primer synthesized by the Biotechnology Institute as the primer, the agarose gel electrophoresis showed 612 white light bands after PCR, and the pictures were taken with restriction sites (EcoRⅠ, PstⅠ) The primers were subjected to 50ul system PCR, and the bright area was recovered from the gel, and then ligated with the SV40-PGL3basic vector recovered from the double-enzyme-cut gel, transformed, cloned, and placed in LB medium containing ampicillin, and incubated at 37°C for 16 hours with shaking on a shaker. The bacterial solution was used as template PCR, and the bacterial solution containing the bright area was incubated with LB5ml containing ampicillin at 37°C for 16 hours, and the plasmid was extracted.

HEK293 cells were plated in a 24-well plate. After 10 hours, the cells were uniform and the confluence was 70%. The PTPN133'UTR-612 wild-type plasmid and PTPN13 3'UTR mutant plasmid and miR-26a were co-transfected into HEK293 cells,48 After 1 hour, the luciferase reporter gene experiment was performed, and each group was set up with 5 replicate wells. It was found that the Luciferase in the group transfected with PTPN13 wild-type miR-26a was significantly lower than that in the control group, indicating that miR-26a could target PTPN13.

5. PTPN13 targets p-Src to dephosphorylate it

(1) Using anti-Src antibody for co-immunoprecipitation, and using anti-PTPN13 antibody for Western-blot, it was found that Src in the EGFR signaling pathway can bind to PTPN13.

(2) The PTPN13-Src ^pTyr416 complex was found to have good temporal and spatial stability by bioinformatics calculations, and the binding sites of the PTPN13-Src complex were exactly the catalytic domain of PTPN13 and the pTyr416 site of Src.

(3) The expression of PTPN13 was targeted and silenced in H520 cells by gene silencing technology, and the phosphorylation level of Src ^pTyr416 was detected by Western-blot technology.

6. Nude mouse xenograft experiments to detect the growth of SPCA1 cell xenografts

Subcutaneous injection of SPCA1 cells was used to do nude mice xenograft experiments. The experiments were divided into the following 4 groups:

(1) NC group (only nude mice inoculated with SPCA1 tumor cells);

(2) Gefitinib gavage group;

(3) miR-26a antagomir intratumoral injection group;

(4) miR-26a antagomir intratumoral injection combined with gefitinib gavage group.

Human lung cancer cell SPCA1 was cultured in 1640 medium containing 10% fetal bovine serum, to which 100ul/100ml double antibody containing 100IU/ml penicillin and 100IU/ml streptomycin was added, and cultured at 37°C in a 5% carbon dioxide incubator , the cells were in good condition, digested and centrifuged with PBS to wash and collect (to remove the influence of the secondary antibody), and the cells were inoculated into the armpits of nude mice at 1×10 ⁷¹ within half an hour. There were 5 mice in each group, and the transplanted tumor growth was visible in about 4-5 days. The experiment was carried out when the tumor grew to about 100 mm ³ . The gefitinib group was given gefitinib by gavage (25 mg/kg/day), and the miR-26a inhibitor group was given intratumoral injection of miR-26a antagomir (more than 40 ug). (point injection, 2 times/week), the gefitinib and miR-26a inhibitor co-action group were given the same gefitinib gavage and miR-26a inhibitor intratumoral injection at the same time; the tumor volume was measured with a vernier caliper every 3 days , and the transplanted tumor volume was calculated according to the formula V=(width ² × length/2).

表示，以SPSS13.0软件进行处理，采用配对t检验或单因素方差分析。统计结果P＜0.05定为具有统计学意义。All experimental results are taken as mean ± standard deviation

Expressed with SPSS13.0 software for processing, using paired t test or one-way analysis of variance. Statistical results P<0.05 was considered to be statistically significant.

Claims (1)

1. The application of the miR-26a inhibitor and gefitinib in preparation of a medicine for treating lung cancer is disclosed, wherein the nucleic acid sequence of the miR-26a inhibitor is AGCCUAUCCUGGAUUACUUGAA.

Images