CN105648073B - A kind of cerebral arterial thrombosis kit for screening and its application - Google Patents
A kind of cerebral arterial thrombosis kit for screening and its application Download PDFInfo
- Publication number
- CN105648073B CN105648073B CN201610109886.2A CN201610109886A CN105648073B CN 105648073 B CN105648073 B CN 105648073B CN 201610109886 A CN201610109886 A CN 201610109886A CN 105648073 B CN105648073 B CN 105648073B
- Authority
- CN
- China
- Prior art keywords
- mirna
- expression
- cerebral
- primer
- arterial thrombosis
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Pathology (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses miRNA-98 to prepare the application in ischemic cerebral apoplexy kit for screening, the present invention discloses miRNA-98 and adjusts the expression of PAFR by targeting negativity, and then influences PAFR and the downstream relevant signal transduction process of inflammation and play a role in cerebral apoplexy generation.The present invention provides new mechanism of action for application of the miRNA-98 in cerebral arterial thrombosis diagnosis.
Description
Technical field
The invention belongs to technical field of gene detection, and in particular to a kind of cerebral arterial thrombosis kit for screening and its answer
With.
Background technique
RNA is one of most important material base in organism, it constitutes the frame of life together with DNA and protein.
But for a long time, RNA had once been regarded as merely " transition " between DNA and protein, it obtains the suitable of oneself from DNA there
Then hereditary information is converted to protein by sequence.However, a series of studies have shown that these microRNAs in fact manipulate
Many cell functions, it can react on DNA by the combination of complementary series, to close or adjust the expression of gene.Recently
It was found that a kind of non-protein coding RNA family, microRNA (miRNA, i.e. Microrna), can by with specific mRNA tie
The protein translation process for closing or adjusting specific mRNA carrys out controlling gene expression.The miRNA being had confirmed that in human genome at present
There are more than 1,000 kinds, the expression of regulation 30% protein coding gene of the mankind may be participated in.
MicroRNA is referred to as miRNA, and normal length is 19~25 nucleotide, is widely present in various animals and plants even
It is a kind of in upper highly conserved small molecule single stranded RNA of evolving in unicellular eukaryote.MiRNA is located at gene intron area
Domain, nucleus interior coding miRNA genetic transcription at pri-microRNA (pri-miRNA).Pri-miRNA is in one kind
Under the action of Drosha RNase, about 70 length of nucleotides are cut into, the miRNA precursor (pre- with loop-stem structure
miRNA).Under the action of the caryoplasm that pre-miRNA is relied in Ran-GTP/5 Exportin of cytoplasm albumen, transported out of core
It is defeated into cytoplasm.Under the action of Dicer enzyme, pre-miRNA is cut into the double-strand miRNA of 21~25 length of nucleotides:
miRNA.Subsequent double-strand miRNA:miRNA untwists, and mature miRNA enters endochylema RISC (silencing complex of RNA induction)
Middle performance gene silencing function.Are produced from 3 ' ends noncoding region (3 ' UTR) of the mRNA (mRNA) of miRNA and downstream specific gene
Raw base pair complementarity, causes the degradation of the mRNA or inhibits its translation, protein expression is caused to fail.We are by these downstreams
Gene is referred to as the target gene of miRNA, they usually have important biological function in cell, and miRNA is by adjusting target base
Important function is exercised in the expression of cause in cell, the development with embryo, and growth and development, the proliferation of cell, differentiation are closely related.
Scientist is it has proven convenient that the nucleotides sequence of miRNA is listed in highly conserved between different plant species, and mutation rate is extremely low, and expression has gene cluster
Collect phenomenon, space-time and tissue specificity.MiRNA determines cell point in the express spectra of post-transcriptional level regulation protein gene
The process and diversity of a series of important vital movements such as change, embryonic development.It has been found that miRNA is not only cell Proliferation, differentiation
With the important regulating and controlling factor of apoptosis, 50% or more miRNA is located in tumor-related gene group region, including the area LOH, chromosome
Amplification region and fragile site etc..Identified, express spectra of the miRNA in a variety of hematological system tumors and solid tumor changes,
This discloses disease mechanism for the angle that we regulate and control from RNA and provides fundamental basis, and provides newly for medical diagnosis on disease and treatment
Gene target and molecular labeling.
In human genomic sequence, miR-98 is a kind of MicroRNA, is located at Xp11.22.The sequence of miR-98 is 5 '-
UGAGGUAGUAAGUUGUAUUGUU-3 ' (GeneBank:GeneID:407054).MiR-98 is in upper highly conserved, difference of evolving
There are homologys between species.
It is shown according to the data that the World Health Organization (WHO) is announced, cerebral apoplexy is the great disease that the whole world threatens human health
One of disease is the third-largest fatal disease disabled and be only second to cancer and cardiovascular disease primary at present.Epidemiology is aobvious
Show, stroke onset is in the trend of rejuvenation and cumulative year after year.Cerebral apoplexy is broadly divided into ischemic according to the difference of the cause of disease and goes out
Hemorrhagic cerebral apoplexy, wherein cerebral arterial thrombosis accounts for 87%.Research, which discloses, influences the principle pathological mechanism packet that cerebral apoplexy occurs, develops
Include energy metabolism impairment, neuron excessive depolarising, Excitotoxicity, ionic homeostasis is unbalance, inflammation and dysimmunity,
Apoptosis and autophagy etc..Controlling cerebral apoplexy case fatality rate and improving life quality is that Medical studies problem urgently to be resolved.At present
U.S. FDA ratifies the only tissue type plasminogen activator (tPA) for treating cerebral apoplexy, when due to its stringent treatment
Between window and easily induce the complication such as cerebral hemorrhage and significantly limit its clinical extensive use, the medicament research and development of cerebral apoplexy still accepting a heavy burden
Road is remote.With going deep into for genetic engineering research, scientist shows keen interest to genetic engineering development drug.
Summary of the invention
The technical problem to be solved by the present invention is to provide a kind of cerebral arterial thrombosis diagnostic kit.
Technical solution: cerebral arterial thrombosis kit for screening carries out stem-loop real-time PCR and detects miR-98
Level,
RT primer: SEQ ID NO:9:CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGAACAATAC；
PCR primer:
Forward primer sequence SEQ ID NO:1:5 '-GGCGCAGTAAGTTGTATTGTT-3 '；
Reverse primer sequences SEQ ID NO:2:5 '-GTGCAGGGTCCGAGGT-3 '.The primer sequence of PCR.
Application of the above-mentioned cerebral arterial thrombosis kit for screening in preparation stroke types screening agent.
A kind of cerebral arterial thrombosis screening primer, including following primer:
RT primer: SEQ ID NO:9:CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGAACAATAC；
PCR primer:
Forward primer sequence SEQ ID NO:7:5 '-GGCGCAGTAAGTTGTATTGTT-3 '；
Reverse primer sequences SEQ ID NO:8:5 '-GTGCAGGGTCCGAGGT-3 '.
Application of the above-mentioned cerebral arterial thrombosis screening primer in preparation stroke types screening agent.
In clinical application of the invention, design primer detects miR-98 in patients serum with real-time PCR method
Expression.When MiR-98 expression reduces at least up to 50%, acute ischemic cerebral apoplexy is prompted.Detection maturation
The expression of microRNA sequence, the most commonly used is stem-loop real time-PCR.Experimental principle is illustrated in fig. 11 shown below.
It is miRNA- that the present invention, which discloses platelet activating factor receptor (platelet activating factor, PAFR),
The gene that 98 targetings are adjusted.PAFR is the specificity of platelet activating factor (platelet activating factor, PAF)
Receptor.PAF is a kind of and the closely related endogeneous activity phosphoric acid medium of arachidonic acid metabolic, by participation allergy and inflammation
Property reaction Various Tissues and cell (such as macrophage, endothelial cell, blood platelet, polymorphonuclear cell) generate, act on PAFR
Participate in extensive pathophysiological process.PAF extremely release and in conjunction with PAFR after, cerebral injury can be caused by following mechanism: (1)
Increase nerve cell calcium ion concentration, upsets cell membrane function, coup injury is caused to neuron；(2) promote platelet aggregation
Collection and activation, discharge vaso-active substance, cause blood vessel embolism etc., aggravate brain edema；(3) chemotactic and activation inflammatory cell, promote
Into the release of inflammatory factor, starting and exacerbation inflammatory damage etc..A large amount of zooperies and clinical test show that acute cerebral infarction is suffered from
PAF content significantly increases in person's blood plasma and Cerebral Infarction Model murine brain.Above-mentioned three kinds of mechanism prompt PAF participates in the hair of cerebral infarction
The pathologic process of hair tonic exhibition, and it is closely related with lapsing to for ischemic cerebrovascular disease.
Present invention discloses miRNA-98 to influence the expression of PAFR, ischemic in conjunction with the promoter region of PAFR
MiRNA-98 sharply declines in property patients with cerebral apoplexy serum, causes the expression of PAFR to increase, ischemic cerebral stroke patients
PAF discharges extremely in serum, and cerebral injury is further resulted in conjunction with PAFR.Therefore, the expression and ischemic of miR-98
Cerebral apoplexy is related closely, if the expression of detection miR-98 is lower than 50% or more of normal expression level.Such as Fig. 2
Shown, miR-98 level is 0.89 in our actually detected value normal healthy controls serum, and miR-98 water in patients with cerebral apoplexy serum
It puts down as 0.19, be only the 21% of normal healthy controls；In zoological specimens, miR-98 is only sham-operation group in stroke groups animal blood serum
53%, ischemic penumbra miR-98 are sham-operation group 28%, set time separation accordingly.It then can determine that detected person belongs to ischemic
Cerebral apoplexy.The expression detection kit of miR-98 can be completely used for carrying out in detection screening cerebral apoplexy crowd.
The utility model has the advantages that by the verifying to miR-98 to PAFR gene target, to patients with acute hemorrhagic cerebral apoplexy blood
Clearly, in cerebral arterial thrombosis model mouse serum and penumbral brain tissue miRNA-98 expression detection, and to cerebral apoplexy
The detection of PAF and cerebral arterial thrombosis model mouse intracerebral PAFR expression, illustrates miR-98 in cerebral arterial thrombosis in patients serum
Effect in diagnosis.
Detailed description of the invention
The influence that Fig. 1 hsa-miR-98-5p expresses PAFR.
The content (A) of miR-98 in Fig. 2 patients with cerebral apoplexy and normal healthy controls crowd's serum；Cerebral arterial thrombosis rat blood serum
(B) and the expression quantity of penumbra region (C) miR-98.
The level of platelet activating factor in Fig. 3 patients with cerebral apoplexy and normal healthy controls crowd's serum.
The expression of Fig. 4 cerebral arterial thrombosis rat penumbra region platelet activating factor receptor.
The expression of Fig. 5 cerebral arterial thrombosis rat penumbra region p65.
The expression of Fig. 6 cerebral arterial thrombosis rat penumbra region p-IKK β albumen.
The expression of Fig. 7 cerebral arterial thrombosis rat penumbra region p-p38 albumen.
The expression of Fig. 8 cerebral arterial thrombosis rat penumbra region p-JNK albumen.
The expression of Fig. 9 cerebral arterial thrombosis rat penumbra region Bcl-2 (A) and Bax (B) albumen.
The expression of Figure 10 cerebral arterial thrombosis rat penumbra region cleaved caspase-3 albumen.
Figure 11 stem-loop real time-PCR schematic diagram.
Figure 12 miRNA-98 and PAFR promoter region match schematic diagram.
Specific embodiment
According to following embodiments, the present invention may be better understood.However, as it will be easily appreciated by one skilled in the art that real
It applies content described in example and is merely to illustrate the present invention, without sheet described in detail in claims should will not be limited
Invention.
The experimental method of the dated actual conditions in end in embodiment is substantially all and writes according to Sambrook, J et al.
" Molecular Cloning:A Laboratory guide (the 3rd edition) " (Molecular Cloning:A Laboratory Manual, 3rdEd. Huang Peitang
Etc. translating, Science Press .2002.8) described in condition and method or according to condition proposed by material supplier and method into
Row, it is well known standard method that other technologies being not described in, which correspond to for those skilled in the art,.
Material of the invention: microorganism, cell line, plasmid or the other expression vectors and culture medium referred in the application
There is supply of commodities or can not be that uniquely, can use respectively to the present invention for obtained by the public, they are only for example with other approach
Other suitable tool and biomaterial replace.
Embodiment 1: prediction miRNA-98 acts on the target site of PAFR, detects using luciferase reporter gene
The interaction of miRNA-98 and PAFR promoter region.
(1) it matches shown in schematic diagram 12；
(2) design primer
PTAFR-miR98-5p F (SEQ ID NO:1): XhoI:cacaactcgagTCATTTCCTGTGTACCGGGC；
PTAFR-miR98-5p R (SEQ ID NO:2): BamHI:aaggatccTAAGGGACCTGCAAAGCCTG；
PTAFR-miR98-5pM R (SEQ ID NO:3): CTCCATCCTTTAACCTCATAGGTAATGACCCTAACTC
CATCGAAATTCAGTGCCTGGT；
PTAFR-miR98-5pM F (SEQ ID NO:4): GATGGAGTTAGGGTCATTACCTATGAGGTTAAAGGAT
GGAGATGGGATTGTTATACGCC；
PCR product size 442bp.
(3) pLUC-PTAFR Reporter gene vector is constructed:
Contained 3 ' UTR sequence is following (SEQ ID NO:5):
(4) pLUC-PTAFRMut Reporter gene vector is constructed:
Contained 3 ' UTR sequence is following (SEQ ID NO:6):
(note: " _ " is primer sequence position,For miRNA action site)
(5) prediction and verification test of miR-98 target gene.
Detection method: by hsa-miR-98-5p mimics (with control be control) respectively with containing prediction target gene
The luciferase reporter vector transient cotransfection 293T cell of PTAFR-3'UTR or its mutant, lytic cell after 48 hours are used
Kit detects Dual-Luciferase activity (Promega, Cat#E1980), and verifying miRNA inhibits candidate targets translation skill.
Testing result: the influence such as table 1, Fig. 1 that hsa-miR-98-5p expresses PTAFR WT&Mut.
Interpretation of result: due to the Dual-Luciferase report of hsa-miR-98-5p mimics and the 3'UTR of gene containing PTAFR segment
Gene co-transfection verification test is accused relative to negative control (double fluorescence of mimic control and the 3'UTR of gene containing PTAFR segment
Plain enzyme reporter gene cotransfection test) have significant difference (p value 0.001), fluorescence ratio is the 65.8% of negative control.hsa-
MiR-98-5p mimics has inhibiting effect to the gene expression dose in the site of predicting function containing PTAFR-3'UTR, but predicts to make
Obviously weakened with inhibiting effect after site mutation.Therefore, hsa-miR-98-5p works likely via PAFR.
Table 1 by hsa-miR-98-5p mimics respectively with containing prediction target gene PTAFR-3'UTR or its mutant it is glimmering
Dual-Luciferase activity of the light element enzyme after report carrier transient cotransfection 293T cell 48 hours
Embodiment 2: the inspection of patients with cerebral apoplexy serum, ischemic Stroke Models animal blood serum and penumbra region miRNA-98 expression
It surveys
Detection method: Real-time PCR
Testing result: as shown in Fig. 2A~C.
Interpretation of result: compared with healthy control group, miRNA-98 is significantly reduced in patients with cerebral apoplexy serum；With sham-operation group
Animal is compared, and the expression of cerebral arterial thrombosis animal blood serum and penumbra region miRNA-98 significantly reduce.
Embodiment 4: the detection of platelet activating factor in patients with cerebral apoplexy serum.
Detection method: using PAF content in ELISA assay kit detection patients serum.
As a result it measures: as shown in Figure 3.
Interpretation of result: compared with healthy control group, 3.4 times of PAF raising in patients with cerebral apoplexy serum, up to 505.7 ±
93.6pg/ml。
Embodiment 5: the detection that PAFR is expressed in cerebral arterial thrombosis animal model penumbral brain tissue.
Method: PAFR protein expression is detected using western blotting method.
As a result: as shown in Figure 4.
Interpretation of result: compared with sham-operation group animal, cerebral apoplexy animal ischemic penumbra PAFR expression is significantly risen.
The detection of embodiment 6:PAFR downstream signaling pathway expression.
Method: p65, pIKK β, p-p38MAPK, p-JNK, Bcl-2, Bax are detected using western blotting method
And the expression of the albumen such as cleaved caspase-3.
As a result: result is as shown in Figure 5-10.
Interpretation of result: compared with sham-operation group animal, p65, pIKK β, p-p38MAPK, p-JNK, cleaved
Caspase-3, Bax are significantly increased, and Bcl-2 expression significantly reduces.
Statistical analysis in the present invention carries out data using 11.0 software of SPSS (Release 11.0, SPSS Inc.)
Processing, data are indicated with means standard deviation.T inspection is carried out, is as a result that difference has significant with P < 0.05.
Embodiment 7: luciferase reporter gene verifying analysis.
Construct 3 '-UTR luciferase reporter gene plasmid extraction of gene:
Cell culture: HEK293T cell, which is used, contains 10%FBS, 1% dual anti-(100 μ g/ml streptomysins, 100M/ml penicillin)
DMEM culture medium, 37 DEG C, cultivate in 5%CO2 incubator.An appropriate number of cell inoculation to cell is trained in the day before transfection
It supports in plate, not antibiotic culture medium is added in every hole, cell density when transfection is enable to reach 50%.
1.DNA-FugenHD mixing:
By every 96 hole, 0.2 μ g Plasmid DNA, the dosage of 0.3 μ LFugeneHD, one group of experiment, three multiple holes, in PCR pipe according to
0.45 μ g miRNAmimics, miRNA NC of secondary addition is as control.0.15 μ g sensor reporter gene, 30 μ L Opti-MEM
Culture dilution plasmid, is eventually adding 0.9 μ L FugeneHD, is stored at room temperature 15min after mixing.
2. transfection:
10 μ L are taken to drop evenly in every hole cell in DNA-FugeneHD mixture, every three Kong Weiyi experimental groups are set
In 37 DEG C, 5%CO2 incubator continues to cultivate.
3. luciferase assays:
After 48h is completed in transfection, using Luciferase Reporter Assay System (be purchased from Promega company) into
Row detection.
(1) 5 × cell pyrolysis liquid (5 × lysis buffer) is diluted to 1 with distilled water × working solution, absorb transfection
1 × cell pyrolysis liquid that 80 μ L have diluted is added in each hole, is placed on decolorization swinging table and shakes 1h for culture medium in each hole, receives
Collect the cell pyrolysis liquid in each hole, 12,000rpm, it is centrifuged 1min precipitated impurities.
(2) it takes above-mentioned cell pyrolysis liquid in opaque each hole of 96 orifice plate, sequentially adds firefly fluorescence to specifications
Plain enzyme and renilla luciferase substrate are detected by Tecan Infinite F200/M200 type multi-function microplate reader.
Embodiment 8: target gene clone.
(1) 3 '-UTR design of primers
3 ' non-translational region sequence of gene is obtained from ncbi database, is designed to that, to PCR amplification primer, primer sequence is primer
Sequence is laboratory report Green mark part.
Pcr amplification reaction is carried out using genomic DNA as template, obtains 3 '-UTR genetic fragments.
Reaction system is as follows:
PCR condition: 94 DEG C, 5min；94 DEG C, 30sec；60 DEG C, 30sec (miRNA)/60 DEG C, 3min (UTR)；72 DEG C,
40sec；Circulation 35 times, 72 DEG C of extension 5min of last time.
(2) agarose gel electrophoresis separation and glue recycle segment
1. separating PCR product through 1.5% or 1% agarose gel electrophoresis
2. cutting the blob of viscose (about 100 μ L of volume) containing PCR product to be placed in 1.5ml EP pipe, 500 μ L sol solutions are added,
55 DEG C of colloidal sol 10min, are during which mixed by inversion 2-3 times；
3. adsorption column on mixed liquor, 12,000rpm, are centrifuged 1min, repeated centrifugation once abandons waste liquid afterwards；
4. the DNA on adsorption column is rinsed, 12,000rpm, it is centrifuged 1min, abandons waste liquid, repetition rinsing is primary, after abandoning waste liquid
12,000rpm, it is centrifuged 2min, removes residual rinse liquid；
5. drying at room temperature adsorption column 5min takes appropriate TE buffer to receive by adsorption column replacement into new 1.5ml EP pipe
Collect PCR product.Stand 2min, 12,000rpm, centrifugation 1min.
(3) 3 '-UTR segments and pLUC carrier double digestion
37 degree of digestions rear electrophoresis recycling in 3 hours.
(4) connection reaction:
It is about 1 with mole ratio by PLUC and 3 '-the UTR PCR fragment with identical restriction enzyme site of digestion after purification:
1 μ L 10 × connection buffer is added in 3 ratio mixing, and 1 μ L T4DNA ligase, aseptic double-distilled water to system volume, which is added, is
10μL
Linked system is as follows:
| 10×Ligation buffer | 0.5μl |
| Piece segment DNA (XhoI/BamH I) | 3.0μl |
| Vector plasmid (XhoI/BamH I) | 1.0μl |
| T4DNA Ligase(10U/μl) | 0.5μl |
Competent cell TOP10 is transformed into after 22 DEG C of connection 2h.
(5) recombinant plasmid transformed Escherichia coli:
1. taking freshly prepared 100 μ L of competent cell, 10 μ L connection products, after mixing, ice bath 20min are added；
2. 42 DEG C of heat shock 60s, at once ice bath 2min；
3. 800 μ L LB liquid mediums are added, 37 DEG C of mild shaking recovery cell 45min；
4. take appropriate converted product to be coated on the LB plate of Amp+, 37 DEG C of culture carton upside down culture 16h, observation bacterium colony life
Long situation.
(6) screening and identification of recombinant bacterial strain
Expression vector double digestion system:
It is detected after digestion 3-4h in 1.5% agarose gel electrophoresis at 37 DEG C.
Recombinant plasmid sequencing identification: bacterium solution will be correctly cloned through bacterium colony PCR and plasmid PCR identification and send sequencing, verifying weight
The sequence information of group clone insert, the correct plasmid containing aim sequence is with the name of gene name.
Embodiment 9: focal brain ischemia-reperfusion injury model preparation.
Rats by intraperitoneal injection chloraldurate (10%, 1ml/100g) is anaesthetized, skin of neck disinfection and midsection,
Arteria carotis communis (CCA) and external carotid artery (ECA) are separated, by the ligation of ECA distal end, detachment, keeps ECA stump free, in stump
Proximal part threading is spare, ligatures CCA, cuts off at stump in ECA, insertion line bolt to internal carotid (ICA), depth about 2cm, and
ECA stump and line bolt are fixed afterwards, are pulled out Outlet bolt progress blood flow after ischemic 90min again and are filled again.
Embodiment 10: real-time quantitative PCR
1, cDNA is synthesized
(1) RT mixed reaction solution is prepared:
RT primer (SEQ ID NO:9): SLRT-miR-98-5p:5 '-CTCAACTGGTGTCGTGGAGTCGGCAATTCA
GTTGAGAACAATAC-3’
(2) RT reaction: 16 DEG C of 30min is carried out in PCR amplification instrument；42℃40min；85℃5min.After reaction, by it
It is placed on stand-by on ice or -20 DEG C of preservations.
2, real-time quantitative PCR
(1) Realtime PCR reaction system is configured.System configurations are as follows:
Forward primer F (SEQ ID NO:7): 5 '-GGCGCAGTAAGTTGTATTGTT-3 '；
Reverse primer R (SEQ ID NO:8): 5 '-GTGCAGGGTCCGAGGT-3 '；
(2) PCR reaction is carried out in Real-time PCR instrument:
U6 and all indexs are pressed following procedure and are carried out: 95 DEG C, 10min；40 (95 DEG C, 10 seconds of PCR cycle；60 DEG C,
60 seconds (collecting fluorescence).
In order to establish the melting curve of PCR product, after amplified reaction, (95 DEG C, 10 seconds are pressed；60 DEG C, 60 seconds；95 DEG C,
15 seconds)；And 99 DEG C (it is 0.05 DEG C/sec that instrument carries out Ramp Rate automatically) are heated slowly to from 60 DEG C.
3, result is with calculating: the purpose miRNA and internal reference (U6) of each sample carry out Realtime PCR respectively and react.Data
Using 2-△△CTMethod is analyzed.
Embodiment 11: detected by Western blot measurement.
1. extracting total protein of cell.
2.SDS-PAGE electrophoresis:
(1) it cleans, glass plate, potsherd is installed.
(2) perfusion separation gel, 37 DEG C of standing 25min are prepared.
(3) perfusion concentration glue is prepared, 20min is stored at room temperature.
(4) add protein sample and molecular weight marker, each period albumen applied sample amount is 40 μ g.
(5) constant pressure electrophoresis (concentration glue 80V, separation gel 160V).
3. half dry type transferring film:
(1) after electrophoresis, gloves are worn, cut glue (corner cut referring to molecular weight marker according to destination protein molecular weight ranges
Label), it cuts same size nitrocellulose filter (corner cut label) one and filter paper 2 is opened.
(2) glue, film and filter paper 10min are impregnated in transferring film buffer.
(3) tile from bottom to up on transferring film instrument: filter paper, film, gel, filter paper catch up with bubble removing, especially attention film and gel
Between prohibit stay bubble.Dry surplus liquid, 0.8mA × membrane area (cm2) electric current transferring film 1.5 hours.
(4) immunoblotting
A. transferring film terminates, and examines whether marker has turned on film (or Ponceaux dyeing) to determine transferring film effect.TBST
After cleaning film, 4 DEG C of 5% skimmed milk power (TBST preparation) closings are overnight.
B. plus primary antibody Caspase-3/7 (activated form) monoclonal antibody (1:500 and 1:500), room temperature shake 2h.
C.TBST is rinsed 3 times, each 10min.
D. plus secondary antibody (1:200), room temperature shake 1h.
E.TBST is rinsed 3 times, each 10min.
(5) ECL is detected
The mixing of A.AB liquid, after film does not drip, tiling is thereon.
B. after reacting 5min, according to fluorescence intensity darkroom tabletting 5s~30min.
C. develop 15~30s, and washing is fixed 1~3min.
D. picture scanning and quantitative analysis.
Embodiment 12: immunohistofluorescence stain.
The physiological saline and 4% paraformaldehyde of 100ml is perfused through left ventricle respectively for rat, and broken end takes brain, is placed in 4% poly
Fixed in formaldehyde, 4 DEG C overnight.Brain tissue is after conventional serial dehydration, paraffin embedding, on slicer (Leica, Germany)
Serial section (5 μm) collects forebrain (containing telocoele) brain piece, takes one to be used to test every six.Through dimethylbenzene, graded ethanol dewaxing water
Change, PBS buffer solution is washed 3 times, and PBS buffer solution is washed 3 times, each 2min.Slice is immersed into 0.01M, 6.0 Citrate buffer of PH
In liquid, micro-wave oven powers off after being heated to boiling, cooling.It is added dropwise primary antibody (rabbit-anti GFAP polyclonal antibody), 4 DEG C of overnight incubations.
0.02M PBS washes 3 each 2min.Fluorescence secondary antibody: Alexa is added488 goat anti-mouse IgGs (1:800,
Invitrogen), Alexa488 rabbit-anti goat IgGs (1:800, Invitrogen) are incubated at room temperature 2 hours, and wet box is kept away
Light saves.
Embodiment 13: cell count.
The slice 6 for randomly selecting the immunofluorescence dyeing of every rat is opened, and under the microscope by the random choosing of every slice
6 visuals field are taken, NeuN, GFAP and Iba1 in each visual field of analytical calculation are carried out by 5.0 software of Image Pro Plus and dyed
The cell being positive, with mm2For unit expression.
Claims (1)
1. application of the cerebral arterial thrombosis screening primer in preparation stroke types screening agent, which is characterized in that described to lack
Hemorrhagic cerebral apoplexy screening primer includes following primer:
RT primer:
SEQ ID NO:9:CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGAACAATAC；
PCR primer:
Forward primer sequence SEQ ID NO:7:5 '-GGCGCAGTAAGTTGTATTGTT-3 '；
Reverse primer sequences SEQ ID NO:8:5 '-GTGCAGGGTCCGAGGT-3 '.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610109886.2A CN105648073B (en) | 2016-02-26 | 2016-02-26 | A kind of cerebral arterial thrombosis kit for screening and its application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610109886.2A CN105648073B (en) | 2016-02-26 | 2016-02-26 | A kind of cerebral arterial thrombosis kit for screening and its application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105648073A CN105648073A (en) | 2016-06-08 |
| CN105648073B true CN105648073B (en) | 2019-01-29 |
Family
ID=56491862
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610109886.2A Active CN105648073B (en) | 2016-02-26 | 2016-02-26 | A kind of cerebral arterial thrombosis kit for screening and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105648073B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106337089B (en) * | 2016-11-24 | 2018-08-21 | 汕头大学医学院第一附属医院 | A kind of lncRNA for cerebral arterial thrombosis diagnosis |
| CN108714152B (en) * | 2018-05-11 | 2020-09-18 | 南京医科大学 | Application of microRNA98 in preparation of medicine for treating cerebral arterial thrombosis |
| CN112760366A (en) * | 2021-01-25 | 2021-05-07 | 桂林医学院 | Cerebral arterial thrombosis screening kit and preparation method thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2013022786A2 (en) * | 2011-08-05 | 2013-02-14 | University Of Louisville Research Foundation, Inc. | Microrna biomarkers |
| CN105349666A (en) * | 2015-11-30 | 2016-02-24 | 北京泱深生物信息技术有限公司 | Cerebral-arterial-thrombosis miRNA marker |
-
2016
- 2016-02-26 CN CN201610109886.2A patent/CN105648073B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2013022786A2 (en) * | 2011-08-05 | 2013-02-14 | University Of Louisville Research Foundation, Inc. | Microrna biomarkers |
| CN103842522A (en) * | 2011-08-05 | 2014-06-04 | 路易斯维尔大学研究基金会 | Microrna biomarkers |
| CN105349666A (en) * | 2015-11-30 | 2016-02-24 | 北京泱深生物信息技术有限公司 | Cerebral-arterial-thrombosis miRNA marker |
Non-Patent Citations (2)
| Title |
|---|
| miR-98 and let-7g protect the blood-brain barrier under neuroinflammatory conditions;Slava Rom;《Journal of Cerebral Blood Flow & Metabolism》;20150701;第35卷;1957-1965 |
| 缺血性脑卒中与血小板活化关系的研究;周建平等;《右江医学》;20091231;第37卷(第4期);392-394 |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105648073A (en) | 2016-06-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Yan et al. | Long non-coding RNA MEG3 functions as a competing endogenous RNA to regulate ischemic neuronal death by targeting miR-21/PDCD4 signaling pathway | |
| Guo et al. | LncRNA MALAT1 protects cardiomyocytes from isoproterenol‐induced apoptosis through sponging miR‐558 to enhance ULK1‐mediated protective autophagy | |
| Kim et al. | miR‐186 is decreased in aged brain and suppresses BACE 1 expression | |
| Lagendijk et al. | MicroRNA-23 restricts cardiac valve formation by inhibiting Has2 and extracellular hyaluronic acid production | |
| Sanuki et al. | miR-124a is required for hippocampal axogenesis and retinal cone survival through Lhx2 suppression | |
| Zhao et al. | MicroRNA-34a induces endothelial progenitor cell senescence and impedes its angiogenesis via suppressing silent information regulator 1 | |
| Mo et al. | MicroRNA‐365 modulates astrocyte conversion into neuron in adult rat brain after stroke by targeting Pax6 | |
| Cai et al. | Rpph1 upregulates CDC42 expression and promotes hippocampal neuron dendritic spine formation by competing with miR-330-5p | |
| Mi et al. | CircRNA AFF4 promotes osteoblast cells proliferation and inhibits apoptosis via the Mir-7223-5p/PIK3R1 axis | |
| Martínez et al. | Pum2 shapes the transcriptome in developing axons through retention of target mRNAs in the cell body | |
| Liu et al. | miR-184 and miR-150 promote renal glomerular mesangial cell aging by targeting Rab1a and Rab31 | |
| Loffreda et al. | miR-129-5p: A key factor and therapeutic target in amyotrophic lateral sclerosis | |
| CN105648073B (en) | A kind of cerebral arterial thrombosis kit for screening and its application | |
| Tsujimura et al. | MicroRNA-214 promotes dendritic development by targeting the schizophrenia-associated gene quaking (Qki) | |
| Yu et al. | Retracted: Downregulation of long noncoding RNA H19 rescues hippocampal neurons from apoptosis and oxidative stress by inhibiting IGF2 methylation in mice with streptozotocin‐induced diabetes mellitus | |
| Cao et al. | MiR-7 regulates the PI3K/AKT/VEGF pathway of retinal capillary endothelial cell and retinal pericytes in diabetic rat model through IRS-1 and inhibits cell proliferation | |
| Navarro-González et al. | Nrg1 intracellular signaling is neuroprotective upon stroke | |
| Zhang et al. | MiR-127-3p targeting CISD1 regulates autophagy in hypoxic–ischemic cortex | |
| CN110384800A (en) | Application of the LncRNA XLOC_075168 in the drug that preparation promotes angiogenesis | |
| Hao et al. | Hypoxia-induced miR-15a promotes mesenchymal ablation and adaptation to hypoxia during lung development in chicken | |
| Xu et al. | Mechanism of lncRNA-ANRIL/miR-181b in autophagy of cardiomyocytes in mice with uremia by targeting ATG5 | |
| Hu et al. | MicroRNA-132 regulates total protein of Nav1. 1 and Nav1. 2 in the hippocampus and cortex of rat with chronic cerebral hypoperfusion | |
| CN114807142A (en) | Circular RNA-circ-Magi1 and application thereof | |
| CN102041316A (en) | Application of micro ribonucleic acid (miRNA)-219 compound as marker of brain glioma | |
| Li et al. | Targeting choroidal vascular dysfunction via inhibition of circRNA-FoxO1 for prevention and management of myopic pathology |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |