CN105647915A - Immuno comb array test paper for detecting antibody of simian B virus as well as preparation method and application - Google Patents
Immuno comb array test paper for detecting antibody of simian B virus as well as preparation method and application Download PDFInfo
- Publication number
- CN105647915A CN105647915A CN201610089045.XA CN201610089045A CN105647915A CN 105647915 A CN105647915 A CN 105647915A CN 201610089045 A CN201610089045 A CN 201610089045A CN 105647915 A CN105647915 A CN 105647915A
- Authority
- CN
- China
- Prior art keywords
- virus
- comb
- immunity
- monkey
- primer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/66—General methods for inserting a gene into a vector to form a recombinant vector using cleavage and ligation; Use of non-functional linkers or adaptors, e.g. linkers containing the sequence for a restriction endonuclease
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
- G01N33/56983—Viruses
- G01N33/56994—Herpetoviridae, e.g. cytomegalovirus, Epstein-Barr virus
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/10—Plasmid DNA
- C12N2800/101—Plasmid DNA for bacteria
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/005—Assays involving biological materials from specific organisms or of a specific nature from viruses
- G01N2333/01—DNA viruses
- G01N2333/03—Herpetoviridae, e.g. pseudorabies virus
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2469/00—Immunoassays for the detection of microorganisms
- G01N2469/20—Detection of antibodies in sample from host which are directed against antigens from microorganisms
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Biomedical Technology (AREA)
- Chemical & Material Sciences (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Organic Chemistry (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Urology & Nephrology (AREA)
- Hematology (AREA)
- Biophysics (AREA)
- Virology (AREA)
- Plant Pathology (AREA)
- Pathology (AREA)
- Food Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Cell Biology (AREA)
- Medicinal Chemistry (AREA)
- General Physics & Mathematics (AREA)
- Tropical Medicine & Parasitology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention mainly relates to immuno comb array test paper for detecting an antibody of a simian B virus as well as a preparation method and an application. A recombinant plasmid pGEX-4T-BV for establishment of an immuno comb array is shown in the sequence table Seq No.4. An upper primer BVF in a primer pair for establishment of the recombinant plasmid is shown in the sequence table Seq No.1, a lower primer BVR1 of the primer pair is shown in the sequence table Seq No.2, and a lower primer BVR2 of the primer pair is shown in the sequence table Seq No.3. The establishment method comprises the following steps: the SOE (splicing overlapping extension)-PCR (polymerase chain reaction) primer pair is designed according to the nucleotide sequence of the simian B virus, simian B genes are amplified through SOE-PCR, and the recombinant plasmid pGEX-4T-BV is established; finally, the immuno comb array for quickly detecting the antibody in blood or serum of an experimental monkey is prepared with a film chromatographic technique according to the enzyme linked immunosorbent assay principle and has good stability, specificity, sensitivity and repeatability.
Description
Technical field
The present invention relates to the detection method of a kind of biological technical field and antigen technical field, be specifically related to immunity comb Test paper and the preparation method and application of a kind of b virus of monkey antibody.
Background technology
B virus of monkey, also referred to as herpesvirus saimiri (Herpesvirussimian), is a kind of infecting both domestic animals and human cause of disease, and natural reservoir (of bird flu viruses) is macaque. Monkey only causes local or symptomless infection after infecting B virus, be similar to people and infect herpes simplex virus, and people then can cause encephalitis, encephalomyelitis after infecting, and causes respiratory paralysis death time serious. The investigation of laboratory worker is shown, existing 43 example people infect the report of B virus so far, although number is not high, but mortality rate is more than 70%, and survivor can leave neurological sequelae. The national standard of issuing and implementation in 2002, has listed B virus regular grade in and has tested the pathogenic microorganism should got rid of with monkey. In China, monkey aboundresources, more liquid. The annual outlet European and American areas such as a number of macaque, machin that do not only have, and from a number of monkey of south east asia import, therefore to the detection importing and exporting monkey B virus, it is always up one of vital task of inspection and quarantine work. Detection method currently for B virus mainly has pathogen separation, molecular biology for detection and Serologic detection. In pathogeny detection: owing to B virus is bio-safety level Four pathogenic microorganism, its cultivation need to carry out at bio-safety level Four laboratory, and therefore pathogen separation detection only carries out in the special laboratory of national regulation. In molecular Biological Detection, although PCR method can be used for the quality-monitoring of monkey group, but in most cases can not detecting the existence of viral nucleic acid, reason is that B is viral as other �� herpesviruss, can set up latent infection at host's neuroganglion and seldom activate after infection. So antibody test is to judge the important evidence whether monkey infects B virus.
Immunity comb method is able to serum virus antibody is carried out a novel in vitro diagnostic techniques of qualitative and quantitative analysis, this technological break-through ground by virus antigen point cloth on the nitrocellulose membrane with extremely strong protein adsorption power, the antigenic membrane being coated is attached at PVC board to increase film strength and hardness, cuts through machine and make immunity comb.When this immunity comb is inserted the serum sample to be checked diluted, specific antibody is combined with antigen and is bonded on film, and again through ELIAS secondary antibody substrate reactions, after dyeing, the sample of antibody positive shows as macroscopic punctation, and feminine gender then changes without color. Film can carry out quantitative analysis after image processing system datumization.
Summary of the invention
The invention aims to the defect overcoming current techniques to exist in promoting the use of, it is provided that the immunity comb Test paper of a kind of b virus of monkey antibody and preparation method and application.
The present invention is realized by following technical scheme:
1, the SOE-PCR primer sets of a kind of immunity comb for building b virus of monkey antibody, primer BVF: as shown in sequence table SeqNo.1, primer BVR1: as shown in sequence table SeqNo.2, primer BVR2: as shown in sequence table SeqNo.3.
2, the recombinant expression carrier pGEX-4T-BV of a kind of immunity comb for preparing b virus of monkey antibody, sequence is such as shown in sequence table SeqNo.4.
3, the construction method of the recombinant expression carrier pGEX-4T-BV of a kind of immunity comb for preparing b virus of monkey antibody, comprises the steps:
(1) gene order according to b virus of monkey, designs SOE-PCR amplimer, primer BVF: as shown in sequence table SeqNo.1, primer BVR1: as shown in sequence table SeqNo.2, primer BVR2: as shown in sequence table SeqNo.3;
(2) carry out SOE-PCR and expand b virus of monkey gene;
(3) recovery of b virus of monkey gene;
(4) structure of cloned plasmids pMD18T-BV and order-checking;
(5) structure of expression vector pGEX-4T-BV, sequence is such as shown in sequence table SeqNo.4.
4, the construction method of recombinant expression carrier pGEX-4T-BV of a kind of immunity comb for preparing b virus of monkey antibody as above, described step (2) adopts specifically comprising the following steps that of SOE-PCR reaction
First round PCR reaction condition:
By mixed liquor at 95 DEG C of denaturation 5min, 94 DEG C of degeneration 1min, 60 DEG C of annealing 30s, 72 DEG C extend 1min, 15 circulations, 72 DEG C of overall elongation 10min;
Above-mentioned mixed liquor is as follows:
BVF primer | 1 ��L |
BVR primer | 0.5 ��L |
2��Taq MasterMix | 15 ��L |
Ultra-pure water | Complement to 30 �� L |
Second takes turns PCR reaction condition:
By mixed liquor at 95 DEG C of denaturation 5min, 94 DEG C of degeneration 1min, 63 DEG C of annealing 30s, 72 DEG C extend 1min, 30 circulations, 72 DEG C of overall elongation 10min;
Above-mentioned mixed liquor is as follows:
BVF primer | 1 ��L |
BVR2 primer | 1 ��L |
First round PCR product | 5 ��L |
2��Taq MasterMix | 15 ��L |
Ultra-pure water | Complement to 30 �� L. |
5, the construction method of the recombinant expression carrier pGEX-4T-BV of a kind of immunity comb for preparing b virus of monkey antibody as above, the construction method of described step (5) pGEX-4T-BV specifically comprises the following steps that and utilizes EcoR I and Xho I respectively pMD18T-BV and pGEX-4T-1 to be carried out double digestion, and glue reclaims the purpose fragment of enzyme action, the purpose fragment of recovery is attached, connection product is transformed into BL21(DE3) in pLysS competent cell, utilize the positive bacterium colony of amicillin resistance screening, and extract plasmid and carry out Sma I and EcoR I double digestion and identify, positive plasmid called after pGEX-4T-BV will be identified.
6, the preparation method of the immunity comb Test paper of a kind of b virus of monkey antibody, comprises the steps:
(1) b virus of monkey albumen is expressed with recombinant expression carrier pGEX-4T-BV;
(2) purification of monkey B albumen is with quantitative;
(3) preparation of immunity comb Test paper:
(3.1) the b virus of monkey albumen expressed in step (1) is linearly coated NC film with the concentration of 0.01mg/mL, film is dried;
(3.2) close NC film overnight with the BSA confining liquid of 0.05g/mL, again dry after discarding confining liquid;
(3.3) the NC film being coated being cut into standard-sized test strips, be neatly fixed in PVC board successively at a certain distance, 12 are one group or NC film that directly cutting is coated makes immunity comb Test paper, and in valve bag, cryopreservation is standby the most finally.
7, the immunity comb Test paper of a kind of b virus of monkey antibody prepared by the preparation method of the immunity comb Test paper of a kind of b virus of monkey antibody as above.
8, the immunity comb Test paper of a kind of b virus of monkey antibody as above, its detection method is as follows:
(1) blood serum sample to be checked diluted 1:25 times is transferred in 96 hole enzyme reaction plates, flag sequence number;
(2) stretching under the serum liquid level in each reacting hole successively by immunity comb detection tooth, 37 DEG C shake 30-60min gently;
(3) immunity comb TBS-T wash buffer is taken out three times, each 3-5min, the alkali phosphatase enzyme mark anti-solution of the anti-monkey of 1:500 rabbit two diluted is added sequentially in another row enzyme reaction plate hole simultaneously, every hole >=300 �� L, washed immunity comb is stretched in each reacting hole successively, 37 DEG C of concussion 30-60min;
(4) taking out the flushing as stated above of immunity comb to be placed on for 3 times in clean square box and add nitrite ion, static, black out colour developing 1-15min, finally with distilled water flushing immunity comb also observed and recorded reaction result;
(5) aforesaid operations process is set up positive control and each 1 hole of negative control;
(6) positive control immunity comb there are obvious naked eyes to react band, royal purple or black and reactionless band on negative control comb as seen, illustrate that detection is effectively, carries out the judgement of next step testing sample on this basis;
(7) with same position place on positive control comb, the immune comb of testing sample detection occurs that the visible judgement reacting band is positive test symbol, if reactionless band occurs on the immune comb of testing sample detection, be judged to negative result.
9, the immunity comb Test paper of a kind of b virus of monkey antibody as above application in detection b virus of monkey antibody.
The invention provides a kind of Test paper not needing particular instrument equipment auxiliary, solve the present situation importing and exporting the easy test kit of experimental monkey groups B antiviral antibody detection shortage execute-in-place at present, it is possible to be applied to the detection method of extensive now sample. This reagent paper have quick, easy, economical, do not need any specific apparatus, remain the conventional sensitivity of ELISA, special advantage, overcome again many loaded down with trivial details operations, save the operating time, shorten experimental period, diagnostic detection on the spot can be carried out in the wild completely, reach the purpose of quick diagnosis, disclosure satisfy that the detection that speeds passage through customs of airport, port, harbour, there is good utilization promotion prospect.
Accompanying drawing explanation
Fig. 1 is the pcr amplification result figure of b virus of monkey antigen epitope genes,
Wherein, M:DNAMarker2000; 1: b virus of monkey epitope encoding sequence pcr amplification result; 2: water compares.
Fig. 2 is the enzyme action qualification result figure of b virus of monkey antigen epitope genes recombinant expression carrier,
Wherein, M:DNAMarkerDS5000Ladder; 1:pGEX-4T-BV double digestion is identified; 2: plasmid pGEX-4T-BV.
The SDS-PAGE that Fig. 3 is b virus of monkey epitope protein analyzes result figure,
Wherein, 1-3: empty carrier bacterium induction comparison; M: albumen Marker;4: the pGEX-4T-BV protein expression of induction.
Fig. 4 is the purification result figure of b virus of monkey epitope protein,
Wherein, M: molecular weight of albumen Marker position; 1: cut the recombinant expression protein BV32 of the b virus of monkey after glue purification.
Fig. 5 determines figure for restructuring b virus of monkey BV32 albumen the best package amount,
Wherein, 1-7 represents BV32 respectively and is coated concentration and is: 1mg/mL, 0.1mg/mL, 0.01mg/mL, 1 �� g/mL, 100ng/mL, 10ng/mL and 1ng/mL
Fig. 6 is that Western-blot analyzes restructuring b virus of monkey BV32 protein-specific,
Wherein, 1-5 represents BV32 albumen and b virus of monkey positive serum, monkey SRV1 virus-positive serum, monkey SIV virus-positive serum, monkey STLV1 virus-positive serum and monkey MeV virus-positive seroimmunity reaction result respectively.
Fig. 7 is that Western-blot analyzes restructuring b virus of monkey BV32 protein susceptibility result figure,
Wherein, 1-6 represents BV3 albumen and the 1:25/50/100/200/400/800 times of b virus of monkey positive serum reaction result diluted respectively.
Fig. 8 is immunity comb Making programme figure.
Fig. 9 is the specific assay result figure of the b virus of monkey Serum Antibody Detection immunity comb of preparation,
Wherein, "+" is 1:50 b virus of monkey positive serum controls, "-" is negative serum control, 1 is the anti-b virus of monkey positive serum of 1:50,2-5 represents the SRV1 of anti-monkey 1:25, SIV, STLV1 and MeV virus-positive serum reference respectively, 6 is PBS control, and 7-10 represents the anti-monkey SRV1 of 1:50, SIV, STLV1 and MeV virus-positive serum reference respectively.
Figure 10 is the sensitivity assays result figure of the anti-detection immunity comb of b virus of monkey serum of preparation,
Wherein, "+" is 1:50 b virus of monkey positive serum controls, "-" is negative serum control, and 1-9 represents the anti-b virus of monkey positive serum of 1:25,1:50,1:100,1:200,1:400,1:800,1:1600,1:3200 and 1:6400 times respectively, and 10 represent blank.
Detailed description of the invention
The design of embodiment 1SOE-PCR primer and synthesis
Gene order according to b virus of monkey, utilizes the principle design SOE-PCR amplimer of overlapping extension PCR (SOE-PCR), and primer sequence is as follows:
BVF:5 '-GAATTCGGGCCGGCGCGGCGGGGCGCGCCCTACGGGCCGG
CGCGGCGGGGCGCGCC-3��
BVR1:5��-GCGCCCCGCCGCGCCGGCCCGTAGGGCGCGCCCCGCCGCG-3��
BVR2:5 '-CTCGAGGTAGGGCGCGCCCCGCCGCGCCGGCCCGTAGGG
CGCGCCCCGCCGCGCCG-3��
The clone of embodiment 2 b virus of monkey BV32 gene and order-checking
(1) clone of b virus of monkey BV32 gene
SOE-PCR, PCR reaction system is carried out as follows with the primer of embodiment 1 design synthesis:
First round PCR reaction condition:
By mixed liquor at 95 DEG C of denaturation 5min, 94 DEG C of degeneration 1min, 60 DEG C of annealing 30s, 72 DEG C extend 1min, 15 circulations, 72 DEG C of overall elongation 10min.
Above-mentioned mixed liquor is as follows:
BVF primer | 1 ��L |
BVR primer | 0.5 ��L |
2��Taq MasterMix | 15 ��L |
Ultra-pure water | Complement to 30 �� L |
Second takes turns PCR reaction condition:
By mixed liquor at 95 DEG C of denaturation 5min, 94 DEG C of degeneration 1min, 63 DEG C of annealing 30s, 72 DEG C extend 1min, 30 circulations, 72 DEG C of overall elongation 10min.
Above-mentioned mixed liquor is as follows:
BVF primer | 1 ��L 4 --> |
BVR2 primer | 1 ��L |
First round PCR product | 5 ��L |
2��Taq MasterMix | 15 ��L |
Ultra-pure water | Complement to 30 �� L |
Pcr amplification result is detected, as shown in Figure 1, it was shown that experiment obtains specific DNA fragment in line through agarose gel electrophoresis.
(2) recovery of PCR primer
Reclaim test kit with DNA and reclaim overlapping type pcr amplification product. Test kit description is shown in concrete operations.
(3) structure of cloning vehicle and gene sequencing
The PCR primer that will reclaim connects pMD18-T carrier, and is transformed in DH5 �� competent cell, cultivates 18h in the LB culture medium plate containing ampicillin, the single bacterium colony of picking, 37 DEG C, 200r/min concussion be cultured to OD600During for 0.5-1, extract plasmid DNA with the little extraction reagent kit of plasmid, the positive plasmid Song Shenggong biological engineering joint-stock company order-checking identified through enzyme action.By positive plasmid called after pMD18T-BV correct for order-checking.
The structure of embodiment 3 expression vector
Utilize EcoR I and Xho I that pMD18T-BV and pGEX-4T-1 carries out double digestion respectively, and glue reclaims the purpose fragment of enzyme action. The purpose fragment of recovery being attached, linked system is as follows:
Purpose fragment | 5 ��L |
pGEX-4T-1 | 2 ��L |
T4 DNALigase | 1 ��L |
10��Ligase Buffer | 1 ��L |
ddH2O | 1 ��L |
16 DEG C overnight connect.
Connection product is transformed into BL21(DE3) in pLysS competent cell, utilize the positive bacterium colony of amicillin resistance screening, and extract plasmid and carry out Sma I and EcoR I double digestion is identified. Result is as shown in Figure 2. Positive plasmid called after pGEX-4T-BV will be identified.
The expression of embodiment 4 genes of interest and analysis
(1) abduction delivering of genes of interest
Take restructuring positive strain 10 �� L and be inoculated in the 5mL LB fluid medium of ampicillin containing 25 �� g, 37 DEG C, 200r/min shakes bacterium and be cultured to logarithmic (log) phase OD600During for 0.5-1.0 value, the IPTG adding final concentration of 0.5mmol/L continues with inducing culture 5h under condition.
(2) analysis of genes of interest
With reference to " Molecular Cloning: A Laboratory guide " (third edition), expression product is carried out SDS-PAGE electrophoresis detection. 1min will be centrifuged collect thalline with the bacterium solution of matched group 12000r/min respectively after induction, after 2 times of protein electrophoresis sample-loading buffer suspension thalline of equal-volume, put and boiling water bath boils 5-10min, carry out SDS-PAGE with the concentration glue of 5% and the separation gel of 12% and analyze expression. Result is as shown in Figure 3. Genes of interest obtains expression.
The purification of embodiment 5 destination protein is with quantitative
Adopt KCl dyeing to cut glue purification method and carry out the purification of expression product. Recombinant bacterium pGEX-4T-BV/BL21(DE3 by after induction) carry out SDS-PAGE electrophoresis, then with the KCl solution-dyed film 5min of 0.25mol/L, carefully cut the purpose band being painted silvery white and wash 3 times with PBS, finally adhesive tape being pulverized is placed in EP pipe, add 500 �� LPBS vibration mixings,-20 DEG C of freeze-thaw 3 times repeatedly, 12000r/min is centrifuged 2min, takes supernatant and is the amalgamation and expression albumen of purification. Albumen after purification is as shown in Figure 4. Adopt BAC method to carry out protein quantification, and be sub-packed in-20 DEG C and save backup.
Embodiment 6Western-blot determines best antigen coated amount
Fixing positive serum concentration (1:50), using purification quantitatively after destination protein adjust to 1mg/mL as initial detection limit, carry out 100-106Gradient dilution is coated NC film, then carries out Western-blot analysis, screens best antigen coated amount.
First purifying protein is carried out respectively SDS-PAGE electrophoresis, then and carries out albumen transfer according to a conventional method. Electricity turning rear NC film and is placed in 5%BSA confining liquid (PBS-T), 2h are closed in 37 DEG C of shakes, after washing film 3 times with TBS-T, add 37 DEG C of shakes of positive serum (primary antibodie) and hatch 1h; Taking out, wash 5 times with TBS-T, add the alkali phosphatase enzyme mark rabbit anti-solution of anti-monkey IgG bis-(RabbitAnti-monkeyIgG/AP, 1:500 dilute), 1h is hatched in 37 DEG C of shakes, washes 5 times with TBS-T. NC film is immersed alkali phosphatase assay chromogenic substrate solution (BICP/NBT, SchleicherandSchuell company) in, static, observe once every 30s after black out colour developing 1min, to color development stopping when band is obvious or background occurs, with the rearmounted absorbent paper of rinsed with deionized water is dried observation, Taking Pictures recording result. As it is shown in figure 5, maximum detectable limit is 104The amount concentration of extension rate. Judge from naked eyes visibility, with 102The amount concentration (0.01mg/mL) of extension rate is defined as best package amount.
The Western-blot specific detection of embodiment 7 expressing protein
With above-mentioned antigen the best package amount 0.01mg/mL for standard, carry out the specific assay of expressing protein. Select to intersect five kinds of monkey disease poison (b virus of monkey, monkey SIV, monkey SRV1, monkey STLV1, monkey MeV) positive serum respectively to carry out Western-blot specific detection as primary antibodie to be checked. As shown in Figure 6, restructuring b virus of monkey BV32 can identify b virus of monkey positive serum specifically and not with the monkey disease poison positive serum generation cross reaction of other reference, restructuring b virus of monkey BV32 protein-specific is described well, has reached expection requirement.
Embodiment 8 is recombinated b virus of monkey BV32 proteantigen sensitivity analysis
B virus of monkey positive serum is carried out 2 times of doubling dilutions (1:25,1:50,1:100,1:200,1:400,1:800), carries out Western-blot sensitivity analysis with the restructuring b virus of monkey BV32 albumen that purification reclaims with the 0.01mg/mL best package amount measuring concentration. As it is shown in fig. 7, restructuring b virus of monkey BV32 albumen can detect the 1:400 times of b virus of monkey positive serum diluted sensitively, thus illustrate that restructuring b virus of monkey BV32 protein susceptibility is good, reached expection requirement.
The preparation of embodiment 9 immunity comb Test paper
It is coated concentration parameter according to antigen the best that above-mentioned test method is determined, b virus of monkey antigen protein is linearly coated NC film, film is dried. Close NC film overnight with 5%BSA confining liquid, again dry after discarding confining liquid. The NC film being coated is cut into the standard-sized test strips of 10.5 �� 4mm, neatly it is fixed in the PVC board of 150 �� 1mm by 4.5mm spacing successively, article 12, be one group or NC film that directly cutting is coated make immunity comb, the most finally in valve bag 4 DEG C save backup. The flow process of concrete preparation is as shown in Figure 8.
The using method of embodiment 10 immunity comb and decision method
The blood serum sample to be checked diluted 1:25 times is transferred in 96 hole enzyme reaction plates, flag sequence number. Immunity comb detection tooth is stretched under the serum liquid level in each reacting hole successively, with concussion effect 30-60min gently under 37 DEG C of conditions. Take out immunity comb TBS-T wash buffer immunity comb three times, each 3-5min; Anti-for anti-for the alkali phosphatase enzyme mark rabbit diluted monkey two (1:500) solution is added sequentially in another row enzyme reaction plate hole (>=300 �� L/ hole) simultaneously, washed immunity comb is stretched into successively in each reacting hole, under 37 DEG C of conditions concussion effect 30-60min gently; Taking out the flushing as stated above of immunity comb to be placed on for 3 times in clean square box and add nitrite ion, static, black out colour developing 1-15min, finally with distilled water flushing immunity comb also observed and recorded reaction result. Aforesaid operations process is set up positive control and each 1 hole of negative control. Decision method is as follows: have obvious naked eyes to react reactionless band on band (royal purple or black) and negative control comb as seen on (1) positive control immunity comb, illustrates that detection is effectively, carries out the judgement of next step testing sample on this basis; (2) with same position place on positive control comb, the immune comb of testing sample detection occurs that the visible judgement reacting band is positive test symbol, if reactionless band occurs on the immune comb of testing sample detection, be judged to negative result.
The specificity of embodiment 11 b virus of monkey serum antibody immunity comb detection and sensitivity analysis
First 10 times of sample diluting liquid deionized waters being diluted to 1 times of working concentration, be then put in EP pipe, dilute positive, negative and to be checked serum to each 0.5mL in EP pipe as primary antibodie using 1:50 respectively successively, room temperature is placed standby.Positive control and negative control sera are carried out 1:50 times and dilutes each 0.5mL, then b virus of monkey positive serum 1:25-1:6400 times is diluted be used for sensitivity assays; Other monkey disease poison (SRV1, SIV, STLV1 and MeV) positive serum is diluted 1:25 times and 1:50 times and is used as specific assay; Then each dilute serum sample is transferred in 96 hole enzyme reaction plates successively (>=300 �� L/ hole), flag sequence number. Take under the serum liquid level that immunity comb is sequentially inserted in each reacting hole, with concussion effect 30-60min gently under 37 DEG C of conditions. Take out immunity comb TBS-T wash buffer immunity comb three times, each 3-5min, be then placed in absorbent paper and blot. With sample diluting liquid by anti-for alkali phosphatase enzyme mark rabbit monkey two anti-(1:500) dilution, and it is added sequentially in another row enzyme reaction plate hole (>=300 �� L/ hole), immunity comb is stretched into successively in each reacting hole, under 37 DEG C of conditions concussion effect 30-60min gently. Take out immunity comb to rinse 5 times as stated above, be then placed in absorbent paper and blot. The tablet that developed the color by BCIP/NBT is a piece of to be dissolved in 30mL deionized water after dissolving. Take 10mL nitrite ion and add in a clean square box, then immunity comb is dipped in nitrite ion, static, black out colour developing 1-15min, finally uses distilled water flushing color development stopping the upper reaction result of observed and recorded immunity comb.
Specific assay result, as it is shown in figure 9, b virus of monkey antibody mediated immunity comb all cross reaction can occur specific detection not and between other virus-positive serum to the positive serum of b virus of monkey, thus illustrates that specificity is combed in the b virus of monkey immunity of design preparation good.
As shown in Figure 10, the maximum seropositivity detection dilution factor of b virus of monkey antibody mediated immunity comb is 1:800 to sensitivity assays result, illustrates that the b virus of monkey immunity comb sensitivity of design preparation has well reached expection.
The repeatability of embodiment 12 immunity comb and Detection of Stability
(1) the repeatability detection of immunity comb
Every part of sample parallel makees 3 times (in batch) in a collection of test, 3 different tests days 6 parts of samples of replication (between criticizing). Respectively statistical analysis criticize interior and batch between repeated trials coefficient of variation situation. Result shows, in batch, the repeated trials coefficient of variation (CV) is less than 7%, and between batch, repeated trials CV is less than 10%. Illustrate that the repeatability of immunity is good.
(2) Detection of Stability of immunity comb
By same batch of 34 DEG C preservations, the positive and negative serum of b virus of monkey is detected with freshly prepd immunity comb at the interval of 1,3 and 6 months respectively simultaneously, the specificity of statistical analysis immunity comb and sensitivity do not have significant change, and again make to compare its stability of analysis for 3 times to a sample parallel. Result shows, the specificity of immunity comb does not have significant change with sensitivity, makees to compare for 3 times to a sample parallel, and CV is respectively less than 10%. Having good stability of immunity comb is described.
Embodiment 13 immunity comb practical application compares detection and evaluates
Use according to above-mentioned immunity comb describes method and criterion, after being mixed with the sick positive serum of known b virus of monkey and negative serum subpackage labelling, the immunity comb detection method utilizing preparation carries out detection respectively with the ELISA method of reference and compares, and verifies its reliability with this. The discovery of Kappa concordance statistical analysis is carried out 40 parts of suspicious monkey serum samples being compared testing result, the ELISA testing result concordance rate of newly-established immunity comb (IC-monkey BV-Ab) method and reference is 95%, Kappa=0.893, this illustrates that immunity comb (the IC-monkey BV-Ab) method set up is fine with reference method concordance, it is shown that good practicality and reliability.
< 110 > Inspection and Quarantine Center of Hainan Entry-Exit Inspection and Quarantine
The immunity comb Test paper of < 120 > b virus of monkey antibody and preparation method and application
< 160 > 4
< 210 > 1
< 211 > 56
< 212 > DNA
< 213 > BVF
< 400 > 1
GAATTCGGGCCGGCGCGGCGGGGCGCGCCCTACGGGCCGGCGCGGCGGGGCGCGCC
< 210 > 2
< 211 > 40
< 212 > DNA
< 213 > BVR1
< 400 > 2
GCGCCCCGCCGCGCCGGCCCGTAGGGCGCGCCCCGCCGCG
< 210 > 3
< 211 > 56
< 212 > DNA
< 213 > BVR2
< 400 > 3
CTCGAGGTAGGGCGCGCCCCGCCGCGCCGGCCCGTAGGGCGCGCCCCGCCGCGCCG
< 210 > 4
< 211 > 5068
< 212 > DNA
< 213 > pGEX-4T-BV
< 400 > 4
ACGTTATCGACTGCACGGTGCACCAATGCTTCTGGCGTCAGGCAGCCATCGGAAGCTGTG60GTATGGCTGTGCAGGTCGTAAATCACTGCATAATTCGTGTCGCTCAAGGCGCACTCCCGT120TCTGGATAATGTTTTTTGCGCCGACATCATAACGGTTCTGGCAAATATTCTGAAATGAGC180TGTTGACAATTAATCATCGGCTCGTATAATGTGTGGAATTGTGAGCGGATAACAATTTCA240CACAGGAAACAGTATTCATGTCCCCTATACTAGGTTATTGGAAAATTAAGGGCCTTGTGC300AACCCACTCGACTTCTTTTGGAATATCTTGAAGAAAAATATGAAGAGCATTTGTATGAGC360GCGATGAAGGTGATAAATGGCGAAACAAAAAGTTTGAATTGGGTTTGGAGTTTCCCAATC420TTCCTTATTATATTGATGGTGATGTTAAATTAACACAGTCTATGGCCATCATACGTTATA480TAGCTGACAAGCACAACATGTTGGGTGGTTGTCCAAAAGAGCGTGCAGAGATTTCAATGC540TTGAAGGAGCGGTTTTGGATATTAGATACGGTGTTTCGAGAATTGCATATAGTAAAGACT600TTGAAACTCTCAAAGTTGATTTTCTTAGCAAGCTACCTGAAATGCTGAAAATGTTCGAAG660ATCGTTTATGTCATAAAACATATTTAAATGGTGATCATGTAACCCATCCTGACTTCATGT720TGTATGACGCTCTTGATGTTGTTTTATACATGGACCCAATGTGCCTGGATGCGTTCCCAA780AATTAGTTTGTTTTAAAAAACGTATTGAAGCTATCCCACAAATTGATAAGTACTTGAAAT840CCAGCAAGTATATAGCATGGCCTTTGCAGGGCTGGCAAGCCACGTTTGGTGGTGGCGACC900ATCCTCCAAAATCGGATCTGGTTCCGCGTGGATCCCCGGAATTCGGGCCGGCGCGGCGGG960GCGCGCCCTACGGGCCGGCGCGGCGGGGCGCGCCCTACGGGCCGGCGCGGCGGGGCGCGC1020CCTACGGGCCGGCGCGGCGGGGCGCGCCCTACCTCGAGCGGCCGCATCGTGACTGACTGA1080CGATCTGCCTCGCGCGTTTCGGTGATGACGGTGAAAACCTCTGACACATGCAGCTCCCGG1140AGACGGTCACAGCTTGTCTGTAAGCGGATGCCGGGAGCAGACAAGCCCGTCAGGGCGCGT1200CAGCGGGTGTTGGCGGGTGTCGGGGCGCAGCCATGACCCAGTCACGTAGCGATAGCGGAG1260TGTATAATTCTTGAAGACGAAAGGGCCTCGTGATACGCCTATTTTTATAGGTTAATGTCA1320TGATAATAATGGTTTCTTAGACGTCAGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCC1380CTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGACAATAACCCT1440GATAAATGCTTCAATAATATTGAAAAAGGAAGAGTATGAGTATTCAACATTTCCGTGTCG1500CCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGG1560TGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATC1620TCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCA1680CTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTGTTGACGCCGGGCAAGAGCAAC1740TCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAA1800AGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTG1860ATAACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTT1920TTTTGCACAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATG1980AAGCCATACCAAACGACGAGCGTGACACCACGATGCCTGCAGCAATGGCAACAACGTTGC2040GCAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGA2100TGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTA2160TTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGC2220CAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGGGAGTCAGGCAACTATGG2280ATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCACTGATTAAGCATTGGTAACTGT2340CAGACCAAGTTTACTCATATATACTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAA2400GGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTT2460CGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTT2520TTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTT2580TGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGA2640TACCAAATACTGTCCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAG2700CACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATA2760AGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGG2820GCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGA2880GATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACA2940GGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAA3000ACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTT3060TGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTAC3120GGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATT3180CTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGA3240CCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCTGATGCGGTATTTTCTCC3300TTACGCATCTGTGCGGTATTTCACACCGCATAAATTCCGACACCATCGAATGGTGCAAAA3360CCTTTCGCGGTATGGCATGATAGCGCCCGGAAGAGAGTCAATTCAGGGTGGTGAATGTGA3420AACCAGTAACGTTATACGATGTCGCAGAGTATGCCGGTGTCTCTTATCAGACCGTTTCCC3480GCGTGGTGAACCAGGCCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGCGGCGA3540TGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGTCGT3600TGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAAATTGTCGCGG3660CGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAA3720GCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGCAACGCGTCAGTGGGC3780TGATCATTAACTATCCGCTGGATGACCAGGATGCCATTGCTGTGGAAGCTGCCTGCACTA3840ATGTTCCGGCGTTATTTCTTGATGTCTCTGACCAGACACCCATCAACAGTATTATTTTCT3900CCCATGAAGACGGTACGCGACTGGGCGTGGAGCATCTGGTCGCATTGGGTCACCAGCAAA3960TCGCGCTGTTAGCGGGCCCATTAAGTTCTGTCTCGGCGCGTCTGCGTCTGGCTGGCTGGC4020ATAAATATCTCACTCGCAATCAAATTCAGCCGATAGCGGAACGGGAAGGCGACTGGAGTG4080CCATGTCCGGTTTTCAACAAACCATGCAAATGCTGAATGAGGGCATCGTTCCCACTGCGA4140TGCTGGTTGCCAACGATCAGATGGCGCTGGGCGCAATGCGCGCCATTACCGAGTCCGGGC4200TGCGCGTTGGTGCGGATATCTCGGTAGTGGGATACGACGATACCGAAGACAGCTCATGTT4260ATATCCCGCCGTTAACCACCATCAAACAGGATTTTCGCCTGCTGGGGCAAACCAGCGTGG4320ACCGCTTGCTGCAACTCTCTCAGGGCCAGGCGGTGAAGGGCAATCAGCTGTTGCCCGTCT4380CACTGGTGAAAAGAAAAACCACCCTGGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGT4440TGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAG4500CGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTTATG4560CTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGC4620TATGACCATGATTACGGATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCC4680TGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAG4740CGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGCG4800CTTTGCCTGGTTTCCGGCACCAGAAGCGGTGCCGGAAAGCTGGCTGGAGTGCGATCTTCC4860TGAGGCCGATACTGTCGTCGTCCCCTCAAACTGGCAGATGCACGGTTACGATGCGCCCAT4920CTACACCAACGTAACCTATCCCATTACGGTCAATCCGCCGTTTGTTCCCACGGAGAATCC4980GACGGGTTGTTACTCGCTCACATTTAATGTTGATGAAAGCTGGCTACAGGAAGGCCAGAC5040GCGAATTATTTTTGATGGCGTTGGAATT5068
Claims (9)
1. the SOE-PCR primer sets that the immunity for building b virus of monkey antibody is combed, it is characterised in that primer BVF: as shown in sequence table SeqNo.1, primer BVR1: as shown in sequence table SeqNo.2, primer BVR2: as shown in sequence table SeqNo.3.
2. the recombinant expression carrier pGEX-4T-BV that the immunity for preparing b virus of monkey antibody is combed, it is characterised in that sequence is such as shown in sequence table SeqNo.4.
3. the construction method being used for preparing the recombinant expression carrier pGEX-4T-BV of the immunity comb of b virus of monkey antibody, it is characterised in that comprise the steps:
(1) gene order according to b virus of monkey, designs SOE-PCR amplimer, primer BVF: as shown in sequence table SeqNo.1, primer BVR1: as shown in sequence table SeqNo.2, primer BVR2: as shown in sequence table SeqNo.3;
(2) carry out SOE-PCR and expand b virus of monkey gene;
(3) recovery of b virus of monkey gene;
(4) structure of cloned plasmids pMD18T-BV and order-checking;
(5) structure of expression vector pGEX-4T-BV, sequence is such as shown in sequence table SeqNo.4.
4. the construction method of the recombinant expression carrier pGEX-4T-BV of a kind of immunity comb for preparing b virus of monkey antibody according to claim 3, it is characterised in that described step (2) adopts specifically comprising the following steps that of SOE-PCR reaction
First round PCR reaction condition:
By mixed liquor at 95 DEG C of denaturation 5min, 94 DEG C of degeneration 1min, 60 DEG C of annealing 30s, 72 DEG C extend 1min, 15 circulations, 72 DEG C of overall elongation 10min;
Above-mentioned mixed liquor is as follows:
Second takes turns PCR reaction condition:
By mixed liquor at 95 DEG C of denaturation 5min, 94 DEG C of degeneration 1min, 63 DEG C of annealing 30s, 72 DEG C extend 1min, 30 circulations, 72 DEG C of overall elongation 10min;
Above-mentioned mixed liquor is as follows:
��
5. the construction method of the recombinant expression carrier pGEX-4T-BV of a kind of immunity comb for preparing b virus of monkey antibody according to claim 3, it is characterized in that, the construction method of described step (5) pGEX-4T-BV specifically comprises the following steps that and utilizes EcoR I and Xho I respectively pMD18T-BV and pGEX-4T-1 to be carried out double digestion, and glue reclaims the purpose fragment of enzyme action, the purpose fragment of recovery is attached, connection product is transformed into BL21(DE3) in pLysS competent cell, utilize the positive bacterium colony of amicillin resistance screening, and extract plasmid and carry out Sma I and EcoR I double digestion and identify, positive plasmid called after pGEX-4T-BV will be identified.
6. the preparation method of the immunity comb Test paper of a b virus of monkey antibody, it is characterised in that comprise the steps:
(1) b virus of monkey albumen is expressed with recombinant expression carrier pGEX-4T-BV;
(2) purification of monkey B albumen is with quantitative;
(3) preparation of immunity comb Test paper:
(3.1) the b virus of monkey albumen expressed in step (1) is linearly coated NC film with the concentration of 0.01mg/mL, film is dried;
(3.2) close NC film overnight with the BSA confining liquid of 0.05g/mL, again dry after discarding confining liquid;
(3.3) the NC film being coated being cut into standard-sized test strips, be neatly fixed in PVC board successively at a certain distance, 12 are one group or NC film that directly cutting is coated makes immunity comb Test paper, and in valve bag, cryopreservation is standby the most finally.
7. the immunity comb Test paper of a kind of b virus of monkey antibody prepared by the preparation method of the immunity comb Test paper of a kind of b virus of monkey antibody according to claim 6.
8. the immunity comb Test paper of a kind of b virus of monkey antibody according to claim 7, it is characterised in that its detection method is as follows:
(1) blood serum sample to be checked diluted 1:25 times is transferred in 96 hole enzyme reaction plates, flag sequence number;
(2) stretching under the serum liquid level in each reacting hole successively by immunity comb detection tooth, 37 DEG C shake 30-60min gently;
(3) immunity comb TBS-T wash buffer is taken out three times, each 3-5min, the alkali phosphatase enzyme mark anti-solution of the anti-monkey of 1:500 rabbit two diluted is added sequentially in another row enzyme reaction plate hole simultaneously, every hole >=300 �� L, washed immunity comb is stretched in each reacting hole successively, 37 DEG C of concussion 30-60min;
(4) taking out the flushing as stated above of immunity comb to be placed on for 3 times in clean square box and add nitrite ion, static, black out colour developing 1-15min, finally with distilled water flushing immunity comb also observed and recorded reaction result;
(5) aforesaid operations process is set up positive control and each 1 hole of negative control;
(6) positive control immunity comb there are obvious naked eyes to react band, royal purple or black and reactionless band on negative control comb as seen, illustrate that detection is effectively, carries out the judgement of next step testing sample on this basis;
(7) with same position place on positive control comb, the immune comb of testing sample detection occurs that the visible judgement reacting band is positive test symbol, if reactionless band occurs on the immune comb of testing sample detection, be judged to negative result.
9. the immunity comb Test paper of a kind of b virus of monkey antibody according to claim 7 application in detection b virus of monkey antibody.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201610089045.XA CN105647915A (en) | 2016-02-17 | 2016-02-17 | Immuno comb array test paper for detecting antibody of simian B virus as well as preparation method and application |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201610089045.XA CN105647915A (en) | 2016-02-17 | 2016-02-17 | Immuno comb array test paper for detecting antibody of simian B virus as well as preparation method and application |
Publications (1)
Publication Number | Publication Date |
---|---|
CN105647915A true CN105647915A (en) | 2016-06-08 |
Family
ID=56488458
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201610089045.XA Pending CN105647915A (en) | 2016-02-17 | 2016-02-17 | Immuno comb array test paper for detecting antibody of simian B virus as well as preparation method and application |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN105647915A (en) |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN107653345A (en) * | 2017-11-08 | 2018-02-02 | 中国人民解放军军事医学科学院野战输血研究所 | B virus of monkey real time fluorescence quantifying PCR method and its universal primer, MGB probes and kit |
CN113025753A (en) * | 2021-03-26 | 2021-06-25 | 中国人民解放军军事科学院军事医学研究院 | Real-time fluorescence quantitative PCR method of simian B virus universal TaqMan-MGB probe |
Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN202393770U (en) * | 2011-12-12 | 2012-08-22 | 苏州西山生物技术有限公司 | Quantitative detection kit with simple protein chip for multiple viruses of experimental animal |
CN202393769U (en) * | 2011-12-09 | 2012-08-22 | 苏州西山生物技术有限公司 | Detection kit for multiple viruses with enzyme-linked immunization of comb-type spots |
-
2016
- 2016-02-17 CN CN201610089045.XA patent/CN105647915A/en active Pending
Patent Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN202393769U (en) * | 2011-12-09 | 2012-08-22 | 苏州西山生物技术有限公司 | Detection kit for multiple viruses with enzyme-linked immunization of comb-type spots |
CN202393770U (en) * | 2011-12-12 | 2012-08-22 | 苏州西山生物技术有限公司 | Quantitative detection kit with simple protein chip for multiple viruses of experimental animal |
Non-Patent Citations (2)
Title |
---|
张小飞 等: "猴B病毒囊膜蛋白gB特异性抗原表位", 《中国比较医学杂志》 * |
肖镜 等: "猴B 病毒BVgD-多肽ELISA检测方法的建立", 《实验动物科学》 * |
Cited By (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN107653345A (en) * | 2017-11-08 | 2018-02-02 | 中国人民解放军军事医学科学院野战输血研究所 | B virus of monkey real time fluorescence quantifying PCR method and its universal primer, MGB probes and kit |
CN107653345B (en) * | 2017-11-08 | 2021-04-27 | 中国人民解放军军事医学科学院野战输血研究所 | Real-time fluorescence quantitative PCR method for simian B virus, universal primer, MGB probe and kit thereof |
CN113025753A (en) * | 2021-03-26 | 2021-06-25 | 中国人民解放军军事科学院军事医学研究院 | Real-time fluorescence quantitative PCR method of simian B virus universal TaqMan-MGB probe |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Rimmelzwaan et al. | Comparison of RNA hybridization, hemagglutination assay, titration of infectious virus and immunofluorescence as methods for monitoring influenza virus replication in vitro | |
CN101553732B (en) | Rapid diagnosis method specific to avian influenza virus | |
Kaku et al. | Second generation of pseudotype-based serum neutralization assay for Nipah virus antibodies: sensitive and high-throughput analysis utilizing secreted alkaline phosphatase | |
Sambor et al. | Establishment and maintenance of a PBMC repository for functional cellular studies in support of clinical vaccine trials | |
Zhao et al. | Detection of antibodies to the nonstructural protein (NS1) of avian influenza viruses allows distinction between vaccinated and infected chickens | |
Logan et al. | Efficient generation of vesicular stomatitis virus (VSV)-pseudotypes bearing morbilliviral glycoproteins and their use in quantifying virus neutralising antibodies | |
CN103792373A (en) | Colloidal gold immunochromatography test paper for antibodies of pseudorabies viruses of gE, gB and gD and preparation method | |
Granade et al. | Rapid detection and differentiation of antibodies to HIV-1 and HIV-2 using multivalent antigens and magnetic immunochromatography testing | |
Dominguez et al. | Isolation, propagation, genome analysis and epidemiology of HKU1 betacoronaviruses | |
CN101363858B (en) | Test paper strip for detecting PRRSV antibody colloidal gold, method for making same and applications | |
CN107974513A (en) | A kind of bovine viral diarrhea virus detection kit and its application based on RPA | |
Ito et al. | Typing of viral hemorrhagic septicemia virus by monoclonal antibodies | |
Naves et al. | Serological diagnosis of equine infectious anemia in horses, donkeys and mules using an ELISA with a gp45 synthetic peptide as antigen | |
CN111537741A (en) | Double-antigen sandwich immunofluorescence chromatography kit for detecting African swine fever virus CD2v protein antibody | |
CN105647915A (en) | Immuno comb array test paper for detecting antibody of simian B virus as well as preparation method and application | |
Tencza et al. | Development of a fluorescence polarization-based diagnostic assay for equine infectious anemia virus | |
Hause et al. | Migration of the swine influenza virus δ-cluster hemagglutinin N-linked glycosylation site from N142 to N144 results in loss of antibody cross-reactivity | |
CN104569387B (en) | A kind of ELISA detects human serum HCMV pp150 IgM antibody kits | |
Gleaves et al. | Evaluation of a direct fluorescein-conjugated monoclonal antibody for detection of cytomegalovirus in centrifugation culture | |
CN105647913A (en) | Immuno comb array test paper for detecting antibody of SIV (simian immunodeficiency virus) as well as preparation method and application | |
US20220065869A1 (en) | Methods, Compositions, and Systems for Detecting Coronavirus Neutralizing Antibodies | |
Abed et al. | Development of a Western blot assay for detection of bovine immunodeficiency-like virus using capsid and transmembrane envelope proteins expressed from recombinant baculovirus | |
Simard et al. | Simple and rapid method for production of whole-virus antigen for serodiagnosis of caprine arthritis-encephalitis virus by enzyme-linked immunosorbent assay | |
DeMartini et al. | Comparison of a maedi-visna virus CA-TM fusion protein ELISA with other assays for detecting sheep infected with North American ovine lentivirus strains | |
CN105647914A (en) | Immuno comb array test paper for detecting antibody of SRV1 (simian type-Dretro virus) as well as preparation method and application |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20160608 |
|
WD01 | Invention patent application deemed withdrawn after publication |