CN105647896A - Protein related to synthesis of terpene compound and application thereof - Google Patents
Protein related to synthesis of terpene compound and application thereof Download PDFInfo
- Publication number
- CN105647896A CN105647896A CN201610078482.1A CN201610078482A CN105647896A CN 105647896 A CN105647896 A CN 105647896A CN 201610078482 A CN201610078482 A CN 201610078482A CN 105647896 A CN105647896 A CN 105647896A
- Authority
- CN
- China
- Prior art keywords
- plant
- encoding gene
- nes2
- albumen
- terpene compound
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/88—Lyases (4.)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
- C12N15/8202—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by biological means, e.g. cell mediated or natural vector
- C12N15/8205—Agrobacterium mediated transformation
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
- C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
- C12N15/8279—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance
- C12N15/8286—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance for insect resistance
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P7/00—Preparation of oxygen-containing organic compounds
- C12P7/02—Preparation of oxygen-containing organic compounds containing a hydroxy group
- C12P7/04—Preparation of oxygen-containing organic compounds containing a hydroxy group acyclic
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y402/00—Carbon-oxygen lyases (4.2)
- C12Y402/03—Carbon-oxygen lyases (4.2) acting on phosphates (4.2.3)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/10—Plasmid DNA
- C12N2800/101—Plasmid DNA for bacteria
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Biotechnology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biomedical Technology (AREA)
- General Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Cell Biology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Insects & Arthropods (AREA)
- Pest Control & Pesticides (AREA)
- Nutrition Science (AREA)
- Medicinal Chemistry (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention relates to protein related to synthesis of a terpene compound and application thereof. The protein has an amino acid sequence shown as SEQ ID NO2, and an encoding gene has a nucleotide sequence shown as SEQ ID NO1. Experiments show that the NES2 protein expressed in escherichia coli has FPP and GPP synthesis activity. An agrobacterium-mediated method is adopted for obtaining trans NES2 gene rice, the result shows that a trans NES2 plant can attract cotesia chilonis female worms remarkably, and a new method is provided for biological prevention and control.
Description
Technical field
The invention belongs to field of plant molecular biology, particularly to the albumen that the synthesis of a kind of terpene compound is relevant, encode its gene and application thereof.
Background technology
The indirect defenses reaction of plant finds first on Semen Maydis, and after the feature of this defense reaction is taken food by plant-feed insect, plant relies on the release of specificity volatile matter to attract natural enemies of insects, thus reaching the purpose of defence plant-feed insect. Many plants can improve the amount of specificity volatile matter release after being taken food by plant-feed insect, the volatile matter of some plant-feed insects induction can attract the natural enemy (predatism or parasitics) of plant-feed insect, these volatile matters just become medium (signal) material of plant indirect defenses, so the core of plant indirect defenses research is the specific volatility semiochemicals of plant and regulatory mechanism thereof. Relative to the research of the ecological aspect having certain Research foundation, plant indirect defenses reaction research in molecular biology is also very weak. Utilize Protocols in Molecular Biology and the specific volatile matter of transgenic technology research plant can farthest remove ambient interferences, it is easy to ground find plant-feed insect induction after expression specificity rise volatile matter. Current plant indirect defenses reaction research in molecular biology is substantially carried out in following two: be after having how many genes directly to participate in plant-feed insect induction on the one hand, the biosynthesis of plant specificity volatile matter; Another aspect is the synthesis how these genes regulate and control volatile matter, and product is which type of effect what and these products have.
Plant terpenes (monoterpene, sesquiterpene, di-terpene) compounds is that plant is the most common after being induced by plant-feed insect, the most various plant volatile monoid. Terpenes volatile matter includes monoterpenes, sesquiterpenoids, Diterpenes and homoterpene (E) 4,8 dimethyl 1,3,7 the ninth of the ten Heavenly Stems triolefin ((E) 4,8 dimethyl 1,3,7 nonatriene, DMNT) and (E, E) 4,8,12 trimethyls 1,3,7,11 13 carbon tetraene ((E, E) 4,8,12 trimethyltrideca 1,3,7,11 tetraene, TMTT) etc. DMNT and TMTT is a modal class in plant fragrance of a flower volatile matter and insect Induced volatiles, and both materials are widely present in monocotyledon and dicotyledon. The precursor of DMNT and TMTT respectively (E) nerolidol and (E, E) geranyl linalool.In arabidopsis, research finds that CYP450 enzyme gene can catalysis (E) nerolidol and (E, E) geranyl linalool generation DMNT and TMTT. Some particular kind of terpene compound functions in plant indirect defenses, already by synthetic n-compound, have studied from ecological aspect. On gene level, from the expression of regulation and control plant sesquiterpene synthases gene, also demonstrate part terpene compound function in plant indirect defenses. All of terpene compound is all by sesquiterpene synthases regulation and control synthesis, and sesquiterpene synthases is synthesis plant terpenes volatile matter end synzyme. Therefore, the plant specificity volatile matter that research sesquiterpene synthases and sesquiterpene synthases gene are induced for determining plant-feed insect is significant.
Summary of the invention
It is an object of the present invention to provide a kind of albumen relevant to terpene compound synthesis and encoding gene thereof.
A kind of albumen relevant to terpene compound synthesis, has the aminoacid sequence as shown in SEQIDNO:2.
Described terpene compound is linalool and (E) nerolidol.
The encoding gene of above-mentioned albumen.
Above-mentioned encoding gene, has the 41st 1660 shown nucleotide sequence of 5 ' end of the nucleotide sequence shown in SEQIDNO:1 or SEQIDNO:1.
Recombinant vector containing above-mentioned encoding gene or transgenic cell line or recombinant bacterium.
Above-mentioned recombinant vector, for be inserted in expression vector by above-mentioned encoding gene, obtains expressing the carrier of described albumen, and described expression vector is pET28a, and encoding gene is inserted between XhoI and the NdeI of expression vector; Described recombinant bacterium is that above-mentioned recombinant vector is imported the recombinant bacterium that purpose bacterium obtains, and described purpose bacterium is escherichia coli.
Above-mentioned albumen or above-mentioned encoding gene or above-mentioned recombinant vector or above-mentioned recombinant bacterium at synthesis terpene compound and/or attract the application in Cotesia chilonis.
A kind of method cultivating release terpene compound transgenic plant, obtains transgenic plant for the encoding gene of above-mentioned albumen is imported purpose plant, and the terpene compound burst size of render transgenic plant is higher than described purpose plant.
A kind of method cultivating anti-striped rice borer transgenic paddy rice, transgenic plant is obtained for the encoding gene of above-mentioned albumen is imported purpose plant, the terpene compound burst size of render transgenic plant is higher than described purpose plant, so that the anti-striped rice borer ability of transgenic plant is higher than described purpose plant.
Above-mentioned terpene compound is specially linalool and (E) nerolidol.
The encoding gene of above-mentioned albumen imports purpose plant especially by above-mentioned recombinant vector; Above-mentioned purpose plant is specially monocotyledon.
Above-mentioned monocotyledon is specially Oryza sativa L. further.
The experiment proves that, the immediately bean that the present invention obtains is that NES2 gene has FPP and GPP synthesizing activity at expression in escherichia coli, can catalyged precursor compound geranyl pyrophosphoric acid (geranylpyrophosphate, GPP) synthesis linalool, catalysis farnesyl pyrophosphate (farnesylpyrophosphate, FPP) synthesis (E) nerolidol and catalysis cattle base cattle base pyrophosphoric acid (Geranylgeranylpyrophosphate, GGPP) (E is generated, E) geranyl linalool, adopt agriculture bacillus mediated body of laws to obtain and turn NES2 Oryza sativa L., GC and GC MS analyzes the Oryza sativa L. showing to turn seedling stage NES2 and discharges linalool, (E) the oxidative breakdown product DMNT and oxidative breakdown product TMTT of nerolidol,4 are shown by the reaction of the Y-shaped smell sensing apparatus detection Cotesia chilonis female worm Rice Volatiles to turning NES2, turn the plant of NES2 and Cotesia chilonis is had extremely notable sucking action (P < 0.0l), compared with wild rice, the plant turning NES2 can significantly attract Cotesia chilonis. Show that the coding region sequence of immediately bean NES2 can be applicable to be improved the research of the crops insect resistaces such as Oryza sativa L., Semen Maydis and vegetable by transgenic technology.
Albumen provided by the invention, the protein of the aminoacid sequence composition shown in SEQIDNO2, or aminoacid sequence shown in SEQIDNO:2 through the replacement of one or several amino acid residue and/or disappearance and/or interpolation and with terpene compound synthesis and/or attract Cotesia chilonis associated protein by 1) derivative protein. Above-mentioned albumen can synthetic, it is possible to first synthesize its encoding gene, then carries out biological expression and obtain. The encoding gene of the albumen in above-mentioned (2) can by lacking the codon of one or several amino acid residue by the DNA sequence shown in SEQIDNO1, and/or carry out the missense mutation of one or several base pair, and/or connect the coded sequence of the label shown in table 2 at its 5 ' end and/or 3 ' ends and obtain. The replacement of one or several amino acid residue, replacement and/or interpolation in the aminoacid sequence of above-mentioned albumen, have plenty of owing to abiogenous variation causes, and has plenty of to be processed by induced mutations and causes.
Above-mentioned encoding gene is the DNA molecular shown in SEQIDNO1, or from the DNA molecular shown in the 41st 1660 nucleotide of 5 ' end, or hybridize with the DNA sequence of aforementioned definition under strict conditions and the DNA molecular of coding and terpene compound synthesis and/or attraction Cotesia chilonis associated protein; Or the DNA sequence of aforementioned definition at least has 70%, at least have 75%, at least have 80%, at least have 85%, at least have 90%, at least have 95%, at least have 96%, at least have 97%, at least have 98% or at least have the DNA molecular of 99% homology and coding and terpene compound synthesis and/or attraction Cotesia chilonis associated protein.
Accompanying drawing explanation
Fig. 1. the immediately pcr amplification of bean NES2 gene
M:DNA molecular weight standard (D2000); P:PCR product
Fig. 2. the PCR of recombiant plasmid pet28a NES2 identifies
Wherein M:DNA molecular weight standard (D2000); P:PCR product
The SDS electrophoretogram of Fig. 3 .pET28a-NES2 purification
M: albumen Maker, P: be purified to pET28a-NES2 albumen.
Fig. 4. the GC MS of fusion protein NES2 vitro enzyme life birth thing analyzes
A: with the enzyme life birth thing of the GPP 11.97min being substrate; B: the mass spectrum of linalool standard specimen 11.97min; C: with the enzyme life birth thing of the FPP 19.18min being substrate; The mass spectrum of the 19.18min of D:(E)-nerolidol standard specimen; E: the mass spectrum of linalool standard specimen 11.97min; C: with the enzyme life birth thing of the GGPP 24.16min being substrate; F:(E, E) mass spectrum of 24.16min of geranyl linalool standard specimen.
Fig. 5. the NES2 gene expression component analysis of transgenic paddy rice and wild rice.
Fig. 6 turns the volatile matter analysis of NES2 trans-genetic hybrid rice plant and wild rice plant.
1. linalool; 2.DMNT; 3.DMNT
Fig. 7. turn linalool, DMNT and the TMTT burst size of NES2 trans-genetic hybrid rice and wild rice.
Fig. 8. the selection to turning NES trans-genetic hybrid rice plant and wild rice plant of the Apanteles female worm.
Detailed description of the invention
Below in conjunction with embodiment, the present invention is described in further detail.
The experimental technique used in following embodiment if no special instructions, is conventional method.
Material used in following embodiment, reagent etc., if no special instructions, all commercially obtain.
Following embodiment is spent 11. public can obtain from Plant Protection institute, Chinese Academy of Agricultral Sciences in wild rice) plant (temperature (22 scholar 2) DEG C in Plant Protection institute, Chinese Academy of Agricultral Sciences's growth cabinet; humidity 60% 80%, photoperiod L:D=16:8).
Cotesia chilonis in following embodiment, the public can obtain from Plant Protection institute, Chinese Academy of Agricultral Sciences; Cotesia chilonis is inoculated into striped rice borer upper (artificial breeding), temperature (20 scholar 2) DEG C, humidity 60% 80%, photoperiod L:D=16:8.
In following embodiment, plasmid extraction kit is purchased from Biomega company, restriction endonuclease is purchased from NEB company, high-fidelity enzyme pfu, T easy carrier, coli strain DH5 ��, Reverse Transcription box is purchased from Beijing Quan Shi King Company, rTaqDNA polymerase is purchased from TaKaRa company, the extraction test kit of total serum IgE is purchased from Tian Gen biochemical technology company limited, substrate FPP (ProductNumber:F6892), GPP (ProductNumber:G6772) and other chemical reagent such as GGPP (ProductNumber:G6025) and dichloromethane are all purchased from sigma company, other chemical reagent are domestic analytical pure, primer and order-checking complete by Beijing Hua Da gene.
The extraction of embodiment 1, immediately bean total serum IgE and the synthesis of cDNA
Immediately extracting of the total serum IgE of bean is extracted with reference to the instruction manual in Tian Gen biochemical technology company limited RNAsimple total RNA extraction reagent box. Agarose gel electrophoresis detects and measures concentration by NanoDrop. The synthesis of cDNA the first chain adopts the primerscriptTM1ststrandcDNASynthesisSystem Reverse Transcription box of TAKATA company, the instruction manual in method reference reagent box. Meanwhile, in order to obtain full length gene, SMARTer is usedTMRACEcDNA amplification kit, carries out the synthesis of cDNA, the instruction manual in method reference reagent box.
2, design of primers and gene clone
According to Herba Medicaginis MtTPS3 (AY766249), at bean gene networking station http://phytozome.jgi.doe.gov/pz/portal.html#; ! Info? alias=Org_PvulgarisV1.0 carries out blast, it is thus achieved that immediately bean TPS Gene Partial conserved sequence. Separately design 5' and 3'RACE primer with primer5.0, obtain full length sequence 5RACEprimer1:TCCCATAAACGTCGAAGATGTCA by RACE amplification; 5RACEprimer2TGAGTTCAATCCTTTGGTCTGAA; 3RACEprimer1:GAAGGAGCCAAGAAGAAAGATGAGA; 3RACEprimer2:AATGAGCACCAGCACGTGTCAGCTG, primer is synthesized by Beijing Hua Da genome company. Full length gene is obtained by Chao Shi PCR.
Immediately bean seed, the public can obtain from Plant Protection institute, Chinese Academy of Agricultral Sciences.
With the cDNA of immediately bean for template, expanded by RACE, obtain 1740bpPCR product (Fig. 1), the 3'UTR sequence of 5'UTR and the 80bp containing 40bp. After purpose fragment utilizes the TA method cloned to be connected to T easy carrier (purchased from Beijing Quan Shi King Company), it is built into NES2 sequencing vector, through order-checking (see SEQIDNO1), the gene coding region that this 1740bpPCR product contains is positioned at the 41st 1660, being NES2 by this unnamed gene, the protein designations of this gene code is NES2;The aminoacid sequence of this albumen is the SEQIDNO1 in sequence table, totally 539 aminoacid. Similarity through sequence alignment, NES2 and Herba Medicaginis MtTPS3 nucleotide is 48%.
NES2 sequencing vector is that the sequence 1 in sequence table is inserted the carrier that T easy carrier obtains.
Embodiment 2, NES2 Function Identification
One, NES2 application in synthesis terpene compound linalool and (E) nerolidol
1, vector construction
With T NES2 sequencing vector for template, utilize high-fidelity enzyme TranStartFastPfuDNAPolymerase and primer NESF (5'ACATTTAGAAGACTCTGGACAAACACTA 3')/NESR (5'TTCTAAAAAATAAGTATTTTCAGAATTATA 3'), obtain the purpose fragment with A end (there is the nucleotide of sequence 1 in sequence table) of 1920bp. The above-mentioned purpose fragment with A end being connected with carrier pEASY El with reference to full formula gold biology company limited pEASY ElExpressionKit description, the connection product obtained is applied to the LB plate overnight containing Amp (50mg/ml) and cultivates after proceeding to Bacillus coli communis.
Picking monoclonal utilizes T7F (5 ' TAATACGACTCACTATA 3') and genes of interest downstream primer NESR to detect, and obtains positive colony (Fig. 2). Positive colony is extracted plasmid and sends to order-checking, this plasmid is the carrier obtained between XhoI and the NheI restriction enzyme site restriction enzyme site of the method insertion vector pET28a utilizing TA to clone from the 41st 1780 nucleotide of 5 ' end sequence in sequence table 1, called after pET28a NES2.
PET28a NES2 is converted BL21 (DE3) competent cell, conversion process is shown in full formula gold biology company limited BL21 (DE3) ChemicallyCompetentCell description, obtain BL21 (DE3)/pET28a NES2, T7F and genes of interest downstream primer is utilized to carry out PCR detection BL21 (DE3)/pET28a NES2, it was demonstrated that pET28a NES2 has proceeded in escherichia coli.
2, the abduction delivering of NES2 albumen, separation and purification
Being cultivated in adding the LB culture medium of IPTG of l ��M by BL21 (DE3)/pET28a NES2, condition is 16 DEG C of 180rpm, induction 12h, obtains cultured products, and by cultured products in 4 DEG C, the centrifugal l0min of 1000rpm collects supernatant.
Supernatant is utilized AKTAFPLCsystem (Amersham), HiLoad_16/60_superdex_75_prep_grade (global) molecular sieve prepackage column separating purification 4m1 loading ring, elution flow rate: lml/min, every lml collect once; Eluent 50mMNa2HPO4, 300mMNaC1,250mMimidazole, NaOH adjusts pH to 8.0, it is thus achieved that the NES2 albumen (Fig. 3) (for collecting the eluent of 2 column volumes) of purification.
3, NES2 proteinase activity is identified
Utilize albumen ultrafilter membrane centrifuge tube, be 7.0,50mMPBS (by by the NaH of 39m10.2M by eluent (the purification NES2 albumen) pH collecting 2 column volumes2PO4, and the Na of 61m10.2M2HPO4, obtain after mixing) displacement, and by protein concentration 4 �� g/ml. For preventing the pollution of organic solvent, all adopt glass drying oven below. React according to the system of table 1, system 1mL, 37 DEG C, 30min, obtain product. Purification NES2 albumen is substituted as comparison using water.
Table 1 is NES2 proteinase activity identification reaction system
Reaction adds the dichloromethane of 500 �� 1, vortex lmin, places 30min, extract product on ice after terminating in each sample vial. Careful supernatant of drawing, to new vial, utilizes stable nitrogen stream (14PSI) to blow to only surplus 2u1 (about 5min), adds the dichloromethane of 10 �� 1, stand-by.
Take l �� l sample feeding, utilize gas chromatography mass spectrometry system GC MS (HP6890/HP5973, Hewlett Packard company), chromatographic column HP 5MS (60m �� 250 �� m 0.25 ��m; Hewlett Packard company), GC MS instrument is analyzed. Heating schedule is: 40 DEG C keep 1min, are raised to 250 DEG C (1 DEG C/min) with the increment of 5min5 DEG C, and last 250 DEG C keep 17min. MS detection range is 40 550Da, and temperature is 170 DEG C.
GC MS detects the product of two groups, the appearance time (11.97min) of result (A) linalool standard specimen as shown in Figure 4 and mass spectrum; (B) appearance time (11.97min) of NES2 proteins carry GPP product and mass spectrum; (C) appearance time (19.18min) of (E) nerolidol standard specimen and mass spectrum; (D) appearance time (19.18min) of NES2 proteins carry FPP product and mass spectrum. By contrasting with the appearance time of standard specimen and mass spectrum, illustrate that purification NES2 albumen can catalysis geranyl pyrophosphoric acid (geranylpyrophosphate, GPP) synthesis linalool and catalysis farnesyl pyrophosphate (farnesylpyrophosphate, FPP) synthesis (E) nerolidol.
Two, the application that NES2 volatilizees in linalool and DMNT in Oryza sativa L.
1, the acquisition of NES2 Oryza sativa L. is turned
NES2 gene is connected to pCAMBIA 1300 EPSPS carrier. By agriculture bacillus mediated rice conversion technology, NES2 gene is forwarded to rice varieties is spent 11, by glyphosate Screening and Identification transgenic positive plant. From T0In generation, turns NES2 rice harves seed, sowing, obtains T2In generation, turns NES2 Oryza sativa L.. Extract T1It is template that generation turns the cDNA of NES2 Oryza sativa L. and wild rice, and utilizing NES2RT F:5 ' AGCACTTCCATTCCGTTTACT 3 ', NES2RT R:5 ' TCTTCACGTCTTCACCGTATTT 3 ' is primer pair, carries out qRT pcr amplification; With Oryza sativa L. Actin gene for internal reference, the primer is Actin F:5 ' TCCGGTGGATCTTCATGCTTACCT 3 ', Actin R:5 ' ATGGACCATTGCGACGAGTCTTCT 3 '
It is operated at ABIPRISM7900 real-time fluorescence quantitative PCR instrument liter, if 3 times are repeated. Result, as it is shown in figure 5, NES2 does not express in wild type rice leaf, turns in NES2 Oryza sativa L. in T2 generation and has expression.
2, generation terpene compound linalool and the DMNT of NES2 Oryza sativa L. are turned
A: the collection and confinement of gases of Oryza sativa L.
In order to avoid the impact of volatile matter in soil, utilize ddH2Plant is put in vial, and fills ddH after being cleaned by soil by O2O is to ensure plant normal growth. Utilize top to open the glass container of osculum, airtight aluminum metal base and metal holder and be assembled into the system of relative closure, Oryza sativa L. is carried out collection and confinement of gases. Assembling device according to airtight principle, make gas utilize vacuum pump to pass through to enter device after charcoal post filters, the glass tubing containing adsorbent is connected to gas outlet. The flow velocity (600m1/min) of air inlet is slightly larger than the flow velocity (400m1/min) given vent to anger.
Select 4 weeks big T2In generation, turns NES2 Oryza sativa L. and carries out gas collecting. 50mgTenaxTA polymer is adopted to be collected. Tenax glass tubing utilizes 5m1 heavily to steam ether and cleans after 3 times before using, 220 DEG C of heating 2h when lasting nitrogen passes through; PorapaKQ glass tubing utilizes the ultrapure ether of 1mL to clean more than 3 times before then using after, 132 DEG C of heating 2h when lasting nitrogen passes through. After collection and confinement of gases, Tenax glass tubing is directly used in GC MS and analyzes, PorapaKQ glass tubing then need to utilize 250 �� 1 heavily steam ether eluting 2 times (totally 500 �� 1) to Agilent vial, stand-by.With wild rice for comparison. Respectively obtain wild rice volatile matter sample and T2In generation, turns NES2 Rice Volatiles sample.
B: the volatile matter GC MS of the rice plant turning NES2 analyzes
By GC MS (Agilent company 6890N, chromatographic column parameter: the nonpolar chromatographic column of long 50m �� internal diameter 0.32mm �� film thickness 0.52 ��m; Ionization parameter: 70eV, 220 DEG C; Gas chromatogram furnace temperature is maintained at 30 DEG C 5 minutes, and then 5 DEG C per minute are warming up to 250 DEG C degrees Celsius. Volatile matter sample and T to wild rice plant2In generation, turns the volatile matter sample of NES2 rice plant and detects, and standard sample linalool, DMNT and TMTT are also detected by this condition, by finding after contrasting with the appearance time and mass spectrum of standard specimen, and T2In generation, turns the volatile matter showed increased (Fig. 6) of NES2 Oryza sativa L., product is linalool, DMNT and TMTT, build standard curve with linalool and DMNT simultaneously, carry out the quantitative study of volatile matter, finding linalool, the content of DMNT and TMTT is at wild type rice plant and turns significant difference between NES2 rice plant (p < 0.05) (Fig. 7).
Three, NES2 gene application in attracting Cotesia chilonis
With Y-shaped smell sensing apparatus detect above-mentioned each plant volatiles on the female worm of Apanteles on the impact taking food reaction, specific as follows:
Cotesia chilonis is raised with striped rice borer in illumination box, selects the female worm of Cotesia chilonis and carries out behavioral study. Y shape olfactometer principal arm 20cm, two side arms 15cm, angle 60 �� between side arm. Pushing air into system by LS 2800 type air pump, air-flow enters Y tube both sides by glass rotameter after activated carbon, distilled water purify humidification, and flow speed control is at 0.5L/min. During test, every for transgenic paddy rice strain is put in a glass jar, as odor source, puts into a certain side arm, put into another side arm using wild rice as comparison. Access parasitic wasp from base tube end, every parasitic wasp observes 5min, as parasitic wasp gets over sidewall 1/3 place and stops more than 1min and is designated as this material is responded, is otherwise designated as reactionless. Test temperature is (25 �� 2) DEG C. Repeat 3 times, every time 30 parasitic wasps of test.
Result is as shown in Figure 8, for Y-shaped smell sensing apparatus detection turn the Rice Volatiles of NES2 on the female worm of Apanteles on the impact taking food reaction, result shows, through Chi-square test transgenic line and Wild type control plants difference extremely notable (�� 2=28.75, P < 0.01). T is described2In generation, turns NES2 Rice Volatiles sample and Cotesia chilonis has significant sucking action.
Claims (12)
1. an albumen relevant to terpene compound synthesis, has the aminoacid sequence as shown in SEQIDNO:2.
2. albumen according to claim 1, described terpene compound is linalool and (E) nerolidol.
3. the encoding gene of the albumen described in claim 1 or 2.
4. encoding gene according to claim 3, has the 51st 1860 shown nucleotide sequence of 5 ' end of the nucleotide sequence shown in SEQIDNO:1 or SEQIDNO:1.
5. contain the recombinant vector of encoding gene described in claim 3 or 4 or transgenic cell line or recombinant bacterium.
6. recombinant vector according to claim 5, for being inserted in expression vector by the encoding gene described in claim 3 or 4, obtains the carrier of expressing protein, and described expression vector is pET28a, and encoding gene is inserted between XhoI and the NdeI of expression vector;Or described recombinant bacterium is that above-mentioned recombinant vector is imported the recombinant bacterium that purpose bacterium obtains, and described purpose bacterium is escherichia coli.
7. the albumen described in claim 1 or the encoding gene described in Claims 2 or 3 or the recombinant vector described in claim 5 or described recombinant bacterium at synthesis terpene compound and/or attract the application in Cotesia chilonis.
8. the method cultivating release terpene compound transgenic plant, obtains transgenic plant for the encoding gene of the albumen described in claim 1 is imported purpose plant, and the terpene compound burst size of render transgenic plant is higher than described purpose plant.
9. the method cultivating anti-striped rice borer transgenic paddy rice, transgenic plant is obtained for the encoding gene of the albumen described in claim 1 is imported purpose plant, the terpene compound burst size of render transgenic plant is higher than described purpose plant, so that the anti-striped rice borer ability of transgenic plant is higher than described purpose plant.
10. method according to claim 8 or claim 9, described terpene compound is linalool and (E) nerolidol.
11. method according to claim 8 or claim 9, the encoding gene of described albumen imports purpose plant especially by the recombinant vector described in claim 5, and described purpose plant is specially monocotyledon.
12. method according to claim 11, described monocotyledon is Oryza sativa L..
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610078482.1A CN105647896B (en) | 2016-02-04 | 2016-02-04 | One kind albumen relevant to terpene compound synthesis and its application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610078482.1A CN105647896B (en) | 2016-02-04 | 2016-02-04 | One kind albumen relevant to terpene compound synthesis and its application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105647896A true CN105647896A (en) | 2016-06-08 |
| CN105647896B CN105647896B (en) | 2018-12-28 |
Family
ID=56489399
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610078482.1A Expired - Fee Related CN105647896B (en) | 2016-02-04 | 2016-02-04 | One kind albumen relevant to terpene compound synthesis and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105647896B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108849890A (en) * | 2018-06-06 | 2018-11-23 | 江苏省农业科学院 | Application of the rice sesquiterpene synthases TPS46 gene in terms of preventing and treating pink rice borer |
-
2016
- 2016-02-04 CN CN201610078482.1A patent/CN105647896B/en not_active Expired - Fee Related
Non-Patent Citations (5)
| Title |
|---|
| CARLA BRILLADA等: "Metabolic engineering of the C16 homoterpene TMTT in Lotus japonicus through overexpression of (E,E)-geranyllinalool synthase attracts generalist and specialist predators in different manners", 《NEW PHYTOLOGIST》 * |
| FENGQI LI等: "Expression of lima bean terpene synthases in rice enhances recruitment of a beneficial enemy of a major rice pest", 《PLANT, CELL AND ENVIRONMENT》 * |
| GEN-ICHIRO ARIMURA等: "Herbivore-induced terpenoid emission in Medicago truncatula:concerted action of jasmonate, ethylene and calcium signaling", 《PLANTA》 * |
| LI FENG-QI等: "Functional characterization of (E)-β-caryophyllene synthase from lima bean and its up-regulation by spider mites and alamethicin", 《JOURNAL OF INTEGRATIVE AGRICULTURE》 * |
| 李峰奇: "利马豆和水稻DMNT/TMTT合成通路关键基因的鉴定与功能研究", 《中国优秀博士学位论文全文数据库》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108849890A (en) * | 2018-06-06 | 2018-11-23 | 江苏省农业科学院 | Application of the rice sesquiterpene synthases TPS46 gene in terms of preventing and treating pink rice borer |
| CN108849890B (en) * | 2018-06-06 | 2020-10-16 | 江苏省农业科学院 | Application of rice terpene synthase TPS46 gene in preventing and treating sesamia inferens |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105647896B (en) | 2018-12-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104769121B (en) | Vanillin synthase | |
| CN105647880A (en) | CYP450 gene participating in DMNT and TMTT biosynthesis and coding product and application of CYP450 gene | |
| CN105063068A (en) | Encoding mutation EPSPS (5-enolpyruvyl-shikimate-3-phosphate synthase) gene, and expression vector, expression product and application of encoding mutation EPSPS gene | |
| CN108047320A (en) | The application of Protein G mMYB12 and encoding gene in isoflavones accumulation and salt tolerance is improved | |
| CN113717978B (en) | sgRNA for reducing cotton gossypol content and expression vector and application thereof | |
| CN104561053A (en) | Wheat salt-tolerant gene TaBASS2 and application thereof | |
| CN112322648A (en) | ABC transporter gene MRP1S and preparation method and application thereof | |
| CN104593411B (en) | Application of the barley Hvsusiba2 genes in reduction rice terrace methane release | |
| CN110904111B (en) | sgRNA sequence for targeted knockout of FcMYC2 gene, CRISPR/Cas9 vector and application thereof | |
| CN104974235A (en) | Application of phosphorus absorption-related protein ZmPht1;5 in regulation of plant phosphorus absorption | |
| Ahn et al. | Development of an efficient Agrobacterium-mediated transformation system and production of herbicide-resistant transgenic plants in garlic (Allium sativum L.) | |
| CN105647896A (en) | Protein related to synthesis of terpene compound and application thereof | |
| CN102586250A (en) | Promoter of terpene floral scent gene Hctps1 in hedychium gardneranum and application of promoter | |
| CN102597229A (en) | Down-regulation of ACC synthase for improved plant performance | |
| Venkatachalam et al. | Current perspectives on application of biotechnology to assist the genetic improvement of rubber tree (Hevea brasiliensis Muell. Arg.): An Overview | |
| CN105647897A (en) | Protein related to synthesis of terpene compound and application thereof | |
| US20060137032A1 (en) | Plant alpha farnesene synthase and polynucleotides encoding same | |
| CN103525816A (en) | Ginger flower floral specific and damage and pest induced TPS2 (Trehalose-6-Phosphate Synthase 2) promoter and application thereof | |
| CN116334094A (en) | Mint nonspecific lipid transporter gene and expression protein and application thereof | |
| CN105646683B (en) | The application of complete salt tolerant protein matter and relevant biological material in regulation plant salt endurance | |
| CN102776159A (en) | Protein associated with sesquiterpene synthesis and encoding gene and application thereof | |
| CN105441458B (en) | Salt mustard Tolerant to low P gene ThPHT1-1 and recombinant vector and application | |
| Castillo et al. | Effects of transgenic expression of Brevibacterium linens methionine gamma lyase (MGL) on accumulation of Tylenchulus semipenetrans and key aminoacid contents in Carrizo citrange | |
| CN114480484B (en) | Application of tomato transcription factor gene SlNAC2 | |
| CN116554291B (en) | Pear bZIP transcription factor PubZIP914 and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20181228 Termination date: 20200204 |