CN105624144B - The construction method of saccharomyces cerevisiae ring chromosome - Google Patents
The construction method of saccharomyces cerevisiae ring chromosome Download PDFInfo
- Publication number
- CN105624144B CN105624144B CN201610088968.3A CN201610088968A CN105624144B CN 105624144 B CN105624144 B CN 105624144B CN 201610088968 A CN201610088968 A CN 201610088968A CN 105624144 B CN105624144 B CN 105624144B
- Authority
- CN
- China
- Prior art keywords
- chromosome
- saccharomyces cerevisiae
- ring
- cerevisiae
- apart
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/102—Mutagenizing nucleic acids
- C12N15/1027—Mutagenizing nucleic acids by DNA shuffling, e.g. RSR, STEP, RPR
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/14—Fungi; Culture media therefor
- C12N1/16—Yeasts; Culture media therefor
- C12N1/18—Baker's yeast; Brewer's yeast
- C12N1/185—Saccharomyces isolates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
- C12R2001/00—Microorganisms ; Processes using microorganisms
- C12R2001/645—Fungi ; Processes using fungi
- C12R2001/85—Saccharomyces
- C12R2001/865—Saccharomyces cerevisiae
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Biomedical Technology (AREA)
- General Engineering & Computer Science (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Crystallography & Structural Chemistry (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Botany (AREA)
- Medicinal Chemistry (AREA)
- Tropical Medicine & Parasitology (AREA)
- Virology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to the construction methods in synthetic biology field, more particularly to saccharomyces cerevisiae ring chromosome.The present invention utilizes the characteristic of saccharomyces cerevisiae homologous recombination, the cyclisation of chromosome is realized by deleting the telomere area of S. cerevisiae chromosomal, so as to obtain ring chromosome ringV_s and ringV_b.Present invention comparison, which has been fruitful, to be had the advantages that：The artificial cyclisation to S. cerevisiae chromosomal is realized using the method for homologous recombination；Being cyclized site can unrestricted choice；A kind of new model is provided for the research of ring chromosome disease.
Description
Technical field
The present invention relates to the construction methods in synthetic biology field, more particularly to saccharomyces cerevisiae ring chromosome.
Background technology
Chromosomal DNA sequence carries the hereditary information of biology, and chromosome space structure is another in addition to DNA sequence dna
An important factor for a influence biological heredity.Most Eukaryotic linear structures of chromosome, there is two telomeres；And
Prokaryotic chromosome is then essentially annular.Correlative study finds that such as epilepsy, intellectual development are slow, leukaemia, microcephaly
Etc. genetic diseases it is related with the entanglement of eucaryote Chromosomal arrangement or chromosome circularization.Related scholar is directed to above-mentioned ring chromosome
Relevant disease proposes treatment model, but due to the complexity of mankind's ring chromosome heredity and the pleiotropism of gene, simplifies
The proposition for the treatment of model will be helpful to the research of ring chromosome phene therapy.
Presence in saccharomyces cerevisiae largely has the gene of homology with human gene, therefore is widely used in human diseases
Among research.Correlative study to the saccharomyces cerevisiae for carrying ring chromosome, it is possible to be mankind's ring chromosome genetic disease
Research and treatment provide important research experience.The conventional method for building yeast ring chromosome is by the telomere to chromosome
Enzyme gene, which is regulated and controled to carry out induced chromosome, to be cyclized, and cyclisation positions do not accurately control；Either utilize chromosome itself
The similitude of sequence comes that induced chromosome is spontaneous to be cyclized, and cyclisation positions are single.Therefore it provides the cyclisation wine brewing accurately manipulated
The method of yeast chromosomal has application value and meaning.
The content of the invention
In view of this, the present invention provides the construction methods of saccharomyces cerevisiae ring chromosome.Saccharomyces cerevisiae ring chromosome
Construction method, provide a kind of new model for the research of ring chromosome disease.
In order to realize foregoing invention purpose, the present invention provides following technical scheme：
The present invention provides the construction methods of saccharomyces cerevisiae ring chromosome, delete the S. cerevisiae chromosomal telomere area
Domain, the characteristic recombinated using saccharomyces cerevisiae autologous build saccharomyces cerevisiae ring chromosome.
In some specific embodiments of the present invention, ferment of making wine described in the construction method of saccharomyces cerevisiae ring chromosome
Female chromosome is V chromosomes.
Being cyclized site in some specific embodiments of the present invention, in the construction method of saccharomyces cerevisiae ring chromosome is
Left end is apart from chromosome left arm endpoint 689bp, and right end is apart from chromosome right arm endpoint 738bp.
Being cyclized site in some specific embodiments of the present invention, in the construction method of saccharomyces cerevisiae ring chromosome is
Left end is apart from chromosome left arm endpoint 25896bp, and right end is apart from chromosome right arm endpoint 25696bp.
The present invention also provides the bacterial strains containing saccharomyces cerevisiae ring chromosome that the construction method obtains.
In addition, the present invention also provides the bacterial strain containing saccharomyces cerevisiae ring chromosome, by deleting the saccharomyces cerevisiae
Chromosome telomere region, the characteristic recombinated using saccharomyces cerevisiae autologous build saccharomyces cerevisiae ring chromosome.
In some specific embodiments of the present invention, the bacterial strain containing saccharomyces cerevisiae ring chromosome that builds
In, the S. cerevisiae chromosomal is V chromosomes.
In some specific embodiments of the present invention, the bacterial strain containing saccharomyces cerevisiae ring chromosome that builds
In, cyclisation site for left end apart from chromosome left arm endpoint 689bp, right end is apart from chromosome right arm endpoint 738bp.
In some specific embodiments of the present invention, the bacterial strain containing saccharomyces cerevisiae ring chromosome that builds
In, cyclisation site for left end apart from chromosome left arm endpoint 25896bp, right end is apart from chromosome right arm endpoint 25696bp.
The present invention also provides the bacterial strain as the application in the research model of ring chromosome disease.
The present invention utilizes the characteristic of saccharomyces cerevisiae homologous recombination, is realized by deleting the telomere area of S. cerevisiae chromosomal
The cyclisation of chromosome, so as to obtain ring chromosome ringV_s and ringV_b.
Present invention comparison, which has been fruitful, to be had the advantages that：
1. the artificial cyclisation to S. cerevisiae chromosomal is realized using the method for homologous recombination.
2. being cyclized site can unrestricted choice.
3. provide a kind of new model for the research of ring chromosome disease.
Description of the drawings
It in order to illustrate more clearly about the embodiment of the present invention or technical scheme of the prior art, below will be to embodiment or existing
There is attached drawing needed in technology description to be briefly described.
Fig. 1 shows the schematic diagram of the structure saccharomyces cerevisiae annular V chromosome of the present invention；According to saccharomyces cerevisiae V chromosomes
Particular sequence information, the Telomere regions that chromosome is deleted using saccharomyces cerevisiae homologous recombination characteristic are carried out cyclisation acquisition annular
V chromosomes obtain two bacterial strains：RingV_s and ringV_b；
Fig. 2 shows the PCR verification agarose gel electrophoresis figures of embodiment a pair of annular V chromosome ringV_b in the present invention；
It is carrying out designing primer progress PCR verifications selected by chromosome circularization on the outside of homology arm, if it is confirmed that if being ring chromosome
PCR product can be obtained, PCR product cannot be then obtained if not ring chromosome；Agarose gel electrophoresis verifies PCR
As a result, there are band, control group BY4741 by ring chromosome ringV_b, it was demonstrated that is really ring chromosome；
Fig. 3 shows the PCR verification agarose gel electrophoresis figures of embodiment a pair of annular V chromosome ringV_s in the present invention；
It is carrying out designing primer progress PCR verifications selected by chromosome circularization on the outside of homology arm, if it is confirmed that if being ring chromosome
PCR product can be obtained, PCR product cannot be then obtained if not ring chromosome；Agarose gel electrophoresis verifies PCR
As a result, there are band, control group BY4741 by ring chromosome ringV_s, it was demonstrated that is really ring chromosome.
Specific embodiment
The invention discloses the construction method of saccharomyces cerevisiae ring chromosome, those skilled in the art can be used for reference in this paper
Hold, be suitably modified technological parameter realization.In particular, it should be pointed out that all similar substitutions and modifications are to those skilled in the art
For be it will be apparent that they are considered as being included in the present invention.The method of the present invention and application are by preferably implementing
Example is described, related personnel substantially can not depart from present invention, in spirit and scope to method described herein and
Using being modified or suitably change with combining, to realize and using the technology of the present invention.
The purpose of the present invention is what is realized by subordinate's technical solution.
1. the constructing technology of saccharomyces cerevisiae ring chromosome,
A) ring chromosome is obtained by deleting S. cerevisiae chromosomal Telomere regions；
B) cyclisation of chromosome is realized using the characteristic of saccharomyces cerevisiae autologous restructuring.
2. based on the constructing technology of the saccharomyces cerevisiae ring chromosome described in right 1, saccharomyces cerevisiae ring chromosome is base
It is built in S. cerevisiae chromosomal.
The present invention utilizes the characteristic of saccharomyces cerevisiae homologous recombination, is realized by deleting the telomere area of S. cerevisiae chromosomal
The cyclisation of chromosome, so as to obtain ring chromosome ringV_s and ringV_b.
Present invention comparison has been fruitful with following innovative point：
1. the artificial cyclisation to S. cerevisiae chromosomal is realized using the method for homologous recombination.
2. being cyclized site can unrestricted choice.
3. provide a kind of new model for the research of ring chromosome disease.
Bacterial strain uses therefor and raw material can be purchased by market in the construction method of saccharomyces cerevisiae ring chromosome provided by the invention
.
With reference to embodiment, the present invention is further explained：
Embodiment 1
The structure of saccharomyces cerevisiae annular V chromosome ringV_b is realized by being cyclized saccharomyces cerevisiae V chromosomes,
Comprise the following steps：
1. selected cyclisation site is V chromosome left arms
" TTGGTGTCTGGTTCTTACTAAGTTACACGGATGTATAGAA " (as shown in SEQ ID No.1), No. V dyeing
Body right arm
" TCCGGATGGAATCCGTAACGAATAGGATTCTGGACATACG " (as shown in SEQ ID No.2).
2. synthetic primer
" TTGGTGTCTGGTTCTTACTAAGTTACACGGATGTATAGAAgtttggccgagc ggtctaag " (such as SEQ
Shown in ID No.3) and
" TCCGGATGGAATCCGTAACGAATAGGATTCTGGACATACGttcttgagggaacttt cacc " (such as SEQ
Shown in ID No.4), using pRS415 plasmids as template, carry out PCR using Phusion high-fidelity DNA polymerases and obtain DNA fragmentation,
And carry out agarose electrophoresis recycling；
3. the DNA purified in step 2 is carried out yeast conversion using LiOAc conversion methods, the cell after conversion is coated on SC-
It is screened on Leu tablets, 30 DEG C are cultivated 2 days.Picking monoclonal transformant is pure in SC-Leu flat lining outs point.
4. picking single bacterium colony is simultaneously inoculated in 5 mL SC-Leu fluid nutrient mediums, 30 DEG C are incubated overnight, and extract genome.
Using the genomic DNA in step 4 as template, detection primer ringV_b-test-F is utilized
" TTTCTACCGAACACCTTCTGGAC " (as shown in SEQ ID No.5) and ringV_b-test-R
It is anti-that " ATCAGATTACCTTGCCTGTCTCG " (as shown in SEQ ID No.6) and GoTaq Green Master Mix carry out PCR
Should, while PCR reactions are carried out as a control group with wild type yeast strain BY4741 genomes under the same terms, agarose electrophoresis
Verify PCR results.Only there is band in ring chromosome, and control group is band occur, preliminary proof chromosome circularization
Success obtains annular saccharomyces cerevisiae V chromosomes ringV_b (Fig. 2).
Embodiment 2
The structure of saccharomyces cerevisiae annular V chromosome ringV_s is realized by being cyclized saccharomyces cerevisiae V chromosomes,
Comprise the following steps：
1. selected cyclisation site is V chromosome left arms
" CTTACCCTTTGCATTTCAAATGAAACCTTTGATGGTCTTT " (as shown in SEQ ID No.7) and No. V dye
Colour solid right arm
" TAGCAGGTGGACAATTGGATCTGATACTGAATCTTCTAGA " (as shown in SEQ ID No.8).
2. synthetic primer
" CTTACCCTTTGCATTTCAAATGAAACCTTTGATGGTCTTTgtttggccgagc ggtctaag " (such as SEQ
Shown in ID No.9) and
" TAGCAGGTGGACAATTGGATCTGATACTGAATCTTCTAGAttcttgagggaa ctttcacc " (such as SEQ
Shown in ID No.10), using pRS415 plasmids as template, carry out PCR using Phusion high-fidelity DNA polymerases and obtain DNA pieces
Section, and carry out agarose electrophoresis recycling；
3. the DNA purified in step 2 is carried out yeast conversion using LiOAc conversion methods, the cell after conversion is coated on SC-
It is screened on Leu tablets, 30 DEG C are cultivated 2 days.Picking monoclonal transformant is pure in SC-Leu flat lining outs point.
4. picking single bacterium colony is simultaneously inoculated in 5mL SC-Leu fluid nutrient mediums, 30 DEG C are incubated overnight, and extract genome.
Using the genomic DNA in step 4 as template, primer ringV_s-test-F is utilized
" GGACAAGTGGAAGAATCGGAGAA " (as shown in SEQ ID No.11) and ringV_s-test-R
" GACCCTGTTGTCGCTGCTAAAGT " (as shown in SEQ ID No.12) and GoTaq Green Master Mix carry out PCR
Reaction, while PCR reactions are carried out as a control group with wild type yeast strain BY4741 genomes under the same terms, agarose electricity
Swimming verification PCR results.Only there is band in ring chromosome, and control group is not band, preliminary proof chromosome occur
It is cyclized successfully, obtains annular saccharomyces cerevisiae V chromosomes ringV_s (Fig. 3).
The above is only the preferred embodiment of the present invention, it is noted that for the ordinary skill people of the art
For member, various improvements and modifications may be made without departing from the principle of the present invention, these improvements and modifications also should
It is considered as protection scope of the present invention.
Claims (7)
1. the construction method of saccharomyces cerevisiae ring chromosome, which is characterized in that the S. cerevisiae chromosomal Telomere regions are deleted,
The characteristic recombinated using saccharomyces cerevisiae autologous builds saccharomyces cerevisiae ring chromosome；
The S. cerevisiae chromosomal is V chromosomes.
2. construction method according to claim 1, which is characterized in that cyclisation site is left end apart from chromosome left arm endpoint
689bp, right end is apart from chromosome right arm endpoint 738bp.
3. construction method according to claim 1, which is characterized in that cyclisation site is left end apart from chromosome left arm endpoint
25896bp, right end is apart from chromosome right arm endpoint 25696bp.
4. the bacterial strain containing saccharomyces cerevisiae ring chromosome, which is characterized in that by deleting the S. cerevisiae chromosomal telomere
Region, the characteristic recombinated using saccharomyces cerevisiae autologous build saccharomyces cerevisiae ring chromosome；
The S. cerevisiae chromosomal is V chromosomes.
5. bacterial strain according to claim 4, which is characterized in that cyclisation site is left end apart from chromosome left arm endpoint
689bp, right end is apart from chromosome right arm endpoint 738bp.
6. bacterial strain according to claim 4, which is characterized in that cyclisation site is left end apart from chromosome left arm endpoint
25896bp, right end is apart from chromosome right arm endpoint 25696bp.
7. according to claim 4 to 6 any one of them bacterial strain as the application in the research model of ring chromosome disease.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610088968.3A CN105624144B (en) | 2016-02-17 | 2016-02-17 | The construction method of saccharomyces cerevisiae ring chromosome |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610088968.3A CN105624144B (en) | 2016-02-17 | 2016-02-17 | The construction method of saccharomyces cerevisiae ring chromosome |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105624144A CN105624144A (en) | 2016-06-01 |
| CN105624144B true CN105624144B (en) | 2018-05-18 |
Family
ID=56039491
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610088968.3A Active CN105624144B (en) | 2016-02-17 | 2016-02-17 | The construction method of saccharomyces cerevisiae ring chromosome |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105624144B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107384968B (en) * | 2017-08-23 | 2021-06-08 | 中国科学院分子植物科学卓越创新中心 | Yeast engineering strain for chromosome fusion modification |
| CN108949600B (en) * | 2018-07-11 | 2022-02-08 | 天津大学 | Deletion of gene and application thereof, strain lacking gene and application thereof in improving yield of microbial secondary metabolite |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2009093630A1 (en) * | 2008-01-24 | 2009-07-30 | National Institute Of Advanced Industrial Science And Technology | Hexose-pentose cofermenting yeast having excellent xylose fermentability and method of highly efficiently producing ethanol using the same |
| CN104419718A (en) * | 2013-08-29 | 2015-03-18 | 天津大学 | Saccharomyces cerevisiae module co-transformation combined screening method |
| CN105087406A (en) * | 2015-07-22 | 2015-11-25 | 天津大学 | Recombinant yeast strain as well as construction method and application thereof |
-
2016
- 2016-02-17 CN CN201610088968.3A patent/CN105624144B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2009093630A1 (en) * | 2008-01-24 | 2009-07-30 | National Institute Of Advanced Industrial Science And Technology | Hexose-pentose cofermenting yeast having excellent xylose fermentability and method of highly efficiently producing ethanol using the same |
| CN104419718A (en) * | 2013-08-29 | 2015-03-18 | 天津大学 | Saccharomyces cerevisiae module co-transformation combined screening method |
| CN105087406A (en) * | 2015-07-22 | 2015-11-25 | 天津大学 | Recombinant yeast strain as well as construction method and application thereof |
Non-Patent Citations (1)
| Title |
|---|
| Synthetic chromosome arms function in yeast and generate phenotypic diversity by design;Jessica S. Dymond等;《Nature》;20110922;第477卷;第471页右栏最后一段至第472页右栏倒数第二段及图1-2 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105624144A (en) | 2016-06-01 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Alexander et al. | Efficient engineering of marker-free synthetic allotetraploids of Saccharomyces | |
| US11913016B2 (en) | Synthetic yeast cells and methods of making and using the same | |
| CN104894077B (en) | nicotinamide adenine dinucleotide-cytochrome P450 reductase and its application | |
| AU2011202192A1 (en) | Generation of recombinant genes in Saccharomyces cerevisiae | |
| CN109735537A (en) | A kind of myrothecium roidium A553 trichothecene synthase gene Tri5 promoter and its application | |
| CN109913488A (en) | A method of improving bacillus iturin yield | |
| CN105624144B (en) | The construction method of saccharomyces cerevisiae ring chromosome | |
| CN106589134B (en) | Chimeric protein pAgoE, construction method and application thereof, chimeric protein pAgoE using guide, construction method and application thereof | |
| CN107858353A (en) | A kind of angstrom moral bacterium FS110 glutathione sulfurtransferase gene GliG promoters and its application | |
| Florea et al. | Elimination of marker genes from transformed filamentous fungi by unselected transient transfection with a Cre-expressing plasmid | |
| CN105602934B (en) | The transfer method of S. cerevisiae chromosomal | |
| CN112481309B (en) | Application of Ago protein, composition and gene editing method | |
| CN106916837B (en) | High osmotic pressure glycerol protein kinase gene RkHog1 and recombinant expression vector thereof | |
| CN104630255B (en) | A kind of carrier and its construction method for Chlamydomonas reinhardtii polygenes coexpression | |
| CN105483034B (en) | A method of conversion yeast mating type | |
| CN104404077B (en) | A method of multiple foreign genes are cloned into microbial genome simultaneously | |
| Naumova et al. | Molecular polymorphism of β-fructosidase SUC genes in the Saccharomyces yeasts | |
| Degreif et al. | Preloading budding yeast with all-in-one CRISPR/Cas9 vectors for easy and high-efficient genome editing | |
| US8912127B2 (en) | Method of generating gene mosaics | |
| Easmin et al. | CRISPR-PCD and CRISPR-PCRep: Two novel technologies for simultaneous multiple segmental chromosomal deletion/replacement in Saccharomyces cerevisiae | |
| Liu et al. | Agrobacterium tumefaciens-mediated transformation: An efficient tool for insertional mutagenesis and targeted gene disruption in Harpophora oryzae | |
| US20140274803A1 (en) | Method of generating gene mosaics in eukaryotic cells | |
| Bernardi et al. | Overexpression of RAD51 enables PCR-based gene targeting in lager yeast | |
| CN104561082B (en) | One plant of yeast Candida jeffriesii that can utilize xylose expression system | |
| CN107815459A (en) | A kind of oyster cap fungus manganese peroxidase enzyme gene and its application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |