CN105622732A - Application of simian virus 40 capsid protein VP1 serving as cell transmembrane protein - Google Patents

Abstract

The invention discloses an application of a simian virus 40 capsid protein VP1 serving as a cell transmembrane protein. Firstly, the VP1 is revealed to be a cell-penetrating protein, and then the VP1 protein is subjected to fusion expression with other proteins and can carry an exogenous protein to penetrate through a cell membrane so as to enter cells and be localized in cytoplasm. An experiment of the invention proves that the VP1 protein can carry a mCherry fluorescent protein and a cancer suppressor protein to penetrate through a cell membrane so as to enter cells and be localized in cytoplasm. The invention provides a simple and efficient cell transduction system, and realizes subcellular localization in cytoplasm, and a constructed VP1-P53 protein is expected to have potential applications in the aspects of tumor treatment and the like.

Description

Simian virus 40 capsid protein VP1 is as the application in cell-penetrating albumen

Technical field

The present invention relates to cell transduction technical field, be more particularly to simian virus 40 capsid protein VP1 as the application in cell-penetrating albumen. Simian virus 40 major capsid protein VP1 can penetrate mammalian cell membrane, enters in cell and is positioned in Cytoplasm. SV40VP1 albumen and other albumen being blended, VP1 can enter the foreign protein transduction merged with it cell and be positioned Cytoplasm.

Background technology

Along with the development of Molecular Biology Yu technology, arise at the historic moment based on the new molecular therapy measure of gene therapy, targeting proteins matter medicine or polypeptide drugs, but these treatment meanss often to carry premised on macromolecular substances in cell. Owing to the selective penetrated property effect of cell membrane, protein, polypeptide and the material that DNA isopolarity is strong and molecular weight is big can not pass freely through, it is necessary to could enter in cell by special transporting mechanism or certain biological means. Traditional mediation allogenic material enters the technology of cell and includes electroporation, microinjection, virus transport system, multigelation technology, liposome etc., but is very limited in application because of these regulations for technical operations are strong, toxicity is big, efficiency is low. It addition, because lysosomal degraded after medicine entrance cell, actual availability is often non-normally low. Therefore, finding significantly more efficient transport agent is current medical treatments problem in the urgent need to address.

Recent two decades comes, and has the protein of cell-penetrating ability and brings hope with the discovery of cell-penetrating peptides to Intracellular drug transport. Cell-penetrating protein or cell-penetrating peptides have powerful cell-penetrating ability, and self can permeates cell membranes enter in cell. Up to the present, many cell-penetrating protein or cell-penetrating peptides have been found to. Cell-penetrating protein or cell-penetrating peptides can be divided into two big classes: first kind needs and the covalently bound rear cell of medicine carry medicine internalization and enter cell, and Equations of The Second Kind and medicine form stable non-covalent complex, carry medicine and enter cell. Cell-penetrating protein or cell-penetrating peptides can carry many kinds of substance, cell is entered including hydrophilic protein, polypeptide, DNA even particulate matter, even can carry it and carry out iuntercellular or intracellular transport, and not by the restriction of cell type, in fields such as cytobiology, gene therapeutics and pharmacy, there is great potential. After turning transfered cell, can discharge from endosome rapidly, arrive target, there is high efficiency, it does not have cytotoxicity, the advantages such as immunogenicity is low, it is widely used in matter transportation field.

Some protein with permeates cell membranes function have been used for the transport of allogenic material at present, such as HIV-1Tat albumen, Drosophila Antennapedia foot homologous protein (pANTP) and HSV-1VP22 etc. The sequence that first historically display protein is likely to comprise responsible permeates cell membranes be 1988 to the fragment (Tat-86) of 86 amino acid lengths of HIV-1Tat albumen by the observation of living cells internalization. Frankel and Pabo finds that the activating transcription factor Tat albumen of HIV-1 can enter cell and transduce in nucleus. Prochiantz research group in 1991 prove 60 amino acid whose Drosophila Antennapedia foot albumen (DrosophilaAntennapediahomeoprotein, pANTP) can permeates cell membranes, by neurocyte internalization. This research work is to find first PTD later in 1994 or be the origin of CPP. In order to understand the internalization driving force of Drosophila Antennapedia albumen, its homeodomain is carried out point mutation, finding that its 3rd helical structure is the NSC of film transposition, result is called penetrating peptide penetratin (RQIKIYFQNRRMKWKK) the CPP of these 16 amino acid longs and renamed as pAntp later. The quickly basic sequence of other CPPs such as HIV-1Tat albumen, the amphiphatic molecule model polypeptide transporting sub-chimeric polyeptides and synthetic is found successively.

Lebleu research group in 1998 defines Tat by the minimum peptide section sequence (47YGRKKRRQRRR57) required for cellular uptake. 1997, Heitz and Divita research group was designed first non-covalent CPP and is transported nucleic acid MPG entrance cell, and then utilized again Pep-1 transport protein matter and polypeptide to enter cell. Two research groups of Wender and Futaki prove that poly arginine sequence (Arg8) can be carried molecule and be entered cell, and then the picked-up mechanism proposing them includes two interaction of hydrogen bond of the phosphate group on arginine guanidine salt groups and cell membrane. The most important breakthrough of CPP research field from they or internal first application. Dowdy research group utilizes CPP to transport little peptide and larger protein enters body, and Lange utilizes and transports sub-chimeric polyeptides transport PNAs. Since then, other CPPs many are devised and carry allogenic material and stride across cell membrane and enter Cytoplasm.

Simian virus 40 (SV40) belongs to polyoma virus section, it is one of simplest dsDNA virus, also being one of the candidate vectors of gene therapy, other carrier relatively, SV40 virus has the advantages such as immunogenicity production low, easy, higher specificity, high titre, high transfection efficiency. SV40 virion is the regular dodecahedron structure that diameter is about 45nm. Viral capsid is made up of VP2 and the VP3 of VP1 and the about 30-60 copy of 360 copies. Wherein major capsid protein VP1 can be self-assembly of 24nm regular dodecahedron virus-like particle, and can with approach " infect " cell similar with wild-type virus. After the present invention utilizes escherichia coli expression, purification obtains VP1 albumen, hatches with various kinds of cell when being formed without regular dodecahedron grain structure, it has been found that VP1 can penetrate mammalian cell membrane, enters in cell and is positioned in Cytoplasm. When VP1 albumen and other foreign protein amalgamation and expression, VP1 can enter cell the protein transduction merged with it and be positioned Cytoplasm, it is achieved the cell transduction of destination protein.

Due to cell-penetrating protein huge advantage in albumen and medicament transport and potentiality, applicant's research is found that SV40VP1 permeates cell membranes can enter Cytoplasm, it is a kind of new cell-penetrating albumen, further with VP1 cell membrane penetration capacity, make it carry foreign protein such as fluorescin mCherry and Tumor suppressor p53 and enter cell, illustrate that VP1 can enter cell by delivering foreign albumen, be a kind of excellent cell transduction system.

Summary of the invention

It is an object of the invention to there are provided simian virus 40 capsid protein VP1 as the application in cell-penetrating peptide, enter the application of cell including its transduction foreign protein. The simian virus 40 major capsid protein VP1 of escherichia coli expression can penetrate mammalian cell membrane, enters in cell and is positioned in Cytoplasm, is a kind of cell-penetrating albumen. Meanwhile, it can carry foreign protein permeates cell membranes, enters cell and is positioned Cytoplasm. It it is a kind of simple efficient cell transduction system.

In order to realize above-mentioned purpose, the present invention adopts techniques below measure:

Simian virus 40 capsid protein VP1 (in the present invention or claim SV40VP1 or VP1) gene, its preparation process is as follows:

With pSV21SphI-N1 plasmid for template, pcr amplification obtains simian virus 40 capsid protein VP1 genetic fragment, is SV40VP1, and its sequence is shown in SEQIDNO.1, and the protein of coding is shown in SEQIDNO.2.

The forward primer that PCR uses: VP1-S (NcoI): 5 ' CAGACCATGGATGAGAGGATCGCATCACCATCACCATCACGGATCTATGAAGATG3 ', downstream primer: VP1-A (SacI): 5 ' GCTTGAGCTCGCACTGCATTCTAGTTGTGG3 '. SV40VP1 gene NcoI and SacI double digestion are inserted into pET28a expression vector, it is thus achieved that pET28a-hisVP1 plasmid.

Simian virus 40 capsid protein VP1 is as the application in cell-penetrating peptide, the VP1 albumen of purification is added in mammalian cell (Vero cell, Hela cell, 293T cell) three kinds different, hatch, Immunofluorescence test finds, VP1 albumen permeates cell membranes enters cell, and is positioned Cytoplasm.

Cell-penetrating albumen VP1 transduction foreign protein enters the application of cell, after SV40VP1 gene is connected with foreign protein genes expression, carries foreign protein and enters cell.

SV40VP1 carries mCherry albumen and wears film entrance Cytoplasm:

(1) fluorescin mCherry gene is inserted on pET28a-hisVP1 carrier by SacI and XhoI double enzyme site, constructs plasmid pET28a-VP1mCherry.

(2) plasmid pET28a-VP1mCherry is transformed into E.coliRosetta (DE3) competent cell, IPTG abduction delivering, it is thus achieved that VP1-mCherry albumen.

(3) the VP1-mCherry albumen of purification adds in the Vero cell being incubated at 35 millimeters of capsules of diameter, hatches on ice, observes the fluorescence signal of mCherry, it has been found that the fluorescence signal of VP1-mCherry fusion protein is arranged in Cytoplasm.

SV40VP1 carries P53 albumen and wears film entrance Cytoplasm:

(1) gene of P53 albumen is inserted on pET28a-hisVP1 carrier by SacI and XhoI double enzyme site, constructs plasmid pET28a-VP1P53, double digestion checking plasmid construction success.

(2) plasmid pET28a-VP1P53 is transformed into E.coliRosetta (DE3) competent cell, IPTG abduction delivering, it is thus achieved that fusion protein VP1-P53, and its sequence is shown in SEQIDNO.3.

(3) the VP1-P53 albumen of purification adds in the Vero cell being incubated at 35 millimeters of capsules of diameter, hatches on ice, and immunofluorescence assay finds that VP1-P53 enters in cell and is positioned Cytoplasm.

The present invention compared with prior art, concrete advantages below and effect:

This research finds that simian virus 40 major capsid protein VP1 can penetrate mammalian cell membrane first, enters in cell and is positioned in Cytoplasm, being a kind of new cell-penetrating albumen. Permeates cell membranes can entering the function of cell based on VP1 albumen, if VP1 albumen and other albumen blend, VP1 can enter the foreign protein transduction merged with it cell and be positioned Cytoplasm. With fluorescin mCherry and Tumor suppressor p53 for model, describe VP1 and can carry fluorescin mCherry or P53 albumen permeates cell membranes, enter cell and be positioned Cytoplasm, so the invention provides a kind of simple efficient cell transduction system, and achieve the Subcellular Localization in Cytoplasm. Apply to some extent it addition, constructed VP1-P53 albumen is also expected in neoplasm targeted therapy etc.

Accompanying drawing explanation

Fig. 1-apET28a-hisVP1 enzyme action identifies electrophoresis pattern.

Swimming lane 1:DNAMarker; Swimming lane 2:pET28a-hisVP1 plasmid NcoI and SacI double digestion. .

Fig. 1-bpET28a-VP1mCherry enzyme action identifies electrophoresis pattern.

Swimming lane 1:DNAMarker; Swimming lane 2:pET28a-VP1mCherry plasmid SacI and XhoI double digestion.

Fig. 1-cpET28a-VP1P53 enzyme action identifies electrophoresis pattern.

Swimming lane 1:DNAMarker; Swimming lane 2:pET28a-VP1P53 plasmid SacI and XhoI double digestion.

Protein after Fig. 2 polyacrylamide gel electrophoresis purification Identification.

Swimming lane a:VP1 albumen, swimming lane b: fusion protein VP1-mCherry, swimming lane c: fusion protein VP1-p53.

Fig. 3 is that VP1 albumen enters different cell and is positioned cytoplasmic fluorescence schematic diagram.

Wherein Fig. 3-a is that identified by immunofluorescence VP1 albumen enters Vero cell, and is positioned Cytoplasm; Fig. 3-b is that identified by immunofluorescence VP1 albumen enters Hela cell, and is positioned Cytoplasm; Fig. 3-c is that identified by immunofluorescence VP1 albumen enters 293T cell, and is positioned Cytoplasm.

Fig. 4 is the VP1 fluorescence schematic diagram carrying mCherry fluorescin entrance Vero cell.

Wherein Fig. 4-a fusion protein VP1-mcherry enters Vero cell, and shows fluorescence signal in Cytoplasm; Fig. 4-bmCherry fluorescin can not enter Vero cell.

Fig. 5 is the VP1 immunofluorescence schematic diagram carrying P53 albumen entrance Vero cell.

Wherein Fig. 5-a identified by immunofluorescence fusion protein VP1-P53 enters Vero cell, and is positioned Cytoplasm; Fig. 5-b identified by immunofluorescence P53 self can not enter Vero cell.

Detailed description of the invention

Technical scheme described in the embodiment of the present invention, if not otherwise specified, is the ordinary skill in the art, described reagent or material, if not otherwise specified, all by bibliographical information or from commercial channel.

Embodiment 1:

Simian virus 40 capsid protein VP1 gene, its preparation process is as follows:

With pSV21SphI-N1 plasmid (Lietal, Small, 2009,5:718-726) for template, pcr amplification obtain simian virus 40 capsid protein VP1 genetic fragment, it is thus achieved that VP1 gene order be shown in SEQIDNO.1, the aminoacid sequence of its coding is shown in SEQIDNO.2. The forward primer that PCR uses: VP1-S (NcoI): 5 ' CAGACCATGGATGAGAGGATCGCATCACCATCACCATCACGGATCTATGAAGATG3 ', downstream primer: VP1-A (SacI): 5 ' GCTTGAGCTCGCACTGCATTCTAGTTGTGG3 '. PCR cycle condition: 94 DEG C of degeneration 5min; 90 �� of C degeneration 1min, 53 DEG C of annealing 40s, 72 DEG C extend 1min30s, carry out 30 circular response; Last 72 DEG C extend 10min. The product of amplification cuts purpose band under 1% agarose gel electrophoresis, uviol lamp, adopts the glue of Omega company to reclaim purification kit and reclaims. Reclaiming product NcoI and SacI double digestion is inserted into pET28a expression vector, it is thus achieved that pET28a-hisVP1 plasmid, double digestion checking plasmid construction success (Fig. 1-a), for following example.

Embodiment 2:

Simian virus 40 capsid protein VP1 is as the checking of the application in cell-penetrating peptide/wear film:

(1) pET28a-hisVP1 plasmid CaCl₂Method is transformed into E.coliRosetta (DE3) competent cell, and from flat board, picking monoclonal accesses in 5mLLB Tube propagation base, 200r/min overnight incubation at 37 DEG C. next day, transfer in 5mLLB Tube propagation base by 1% inoculum concentration, at 37 DEG C, 200r/min shaken cultivation is overnight, transfer next day in 500mLLB triangular flask, in 37 DEG C of constant temperature, 200r/min shaken cultivation to OD600 between 0.4��0.6, add IPTG to final concentration 1mM, after 25 DEG C of continuation inducing culture 8h, collect thalline, by bacterial sediment sample-loading buffer (25mMTris-HClpH7.8, 500mM sodium chloride, 5mM imidazoles, 5% glycerol) clean and be once resuspended in afterwards in 40mL binding buffer liquid and carry out ultrasonication, with the centrifugal 30min of 10000r/min, supernatant is splined on the Ni2+-NTA affinity column that combined buffer is equilibrated, then successively with lavation buffer solution A (25mMTris-HClpH7.8, 500mM sodium chloride, 40mM imidazoles, 5% glycerol) and B (5mMTris-HClpH7.8, 500mM sodium chloride, 80mM imidazoles, 5% glycerol) wash post, finally with elution buffer (25mMTris-HClpH7.8, 500mM sodium chloride, 500mM imidazoles, 5% glycerol) eluting acquisition purification destination protein VP1, its sequence is shown in SEQIDNO.2.

(2) the VP1 albumen obtained being carried out polyacrylamide gel electrophoresis, being about in 42kDa, Fig. 2 swimming lane a of the molecular weight of VP1 albumen shows that the molecular weight of VP1 is consistent with predictive value.

(3) the VP1 albumen of purification adds in mammalian cell (Vero cell, Hela cell, 293T cell) three kinds different, the cell PBS completed by proxima luce (prox. luc) washes 3 times, it is separately added into the VP1 albumen (the final concentration of 30 �� g/mL of protein) of 800 �� L OPTI-MEMI culture medium dilutions, hatch 2h on ice, then above added culture fluid is discarded, by OPTI-MEMI culture medium, cell is washed one time, add the fresh OPTI-MEMI culture medium of 1.5mL, be placed in 37 DEG C of CO2 gas incubator and continue to cultivate 18h.

Immunofluorescence test checking VP1 is in intracellular location. Method particularly includes: with PBS, cell is washed 3 times, add the paraformaldehyde of 1mL4%, be placed in room temperature 20min; Discard paraformaldehyde solution, wash 3 three times with PBS, add permeabilized liquid (PBS containing 0.1%TritonX-100), be placed in room temperature 5-10min; Discard permeabilized liquid, wash three times with PBS, add confining liquid (PBS containing 2%BSA), be placed in 37 DEG C and hatch 1h; Discard confining liquid, add the primary antibodie (the anti-VP1 antiserum of rabbit dilutes by 1:200) of 200 �� L confining liquid dilutions, be placed in 37 DEG C and hatch 1h; Discard primary antibodie, wash 3 times with PBS, add the Cy3 fluorescent labeling two anti-(goat anti-rabbit igg antibody) of 200 �� L confining liquid dilutions; Discard two to resist, wash 3-5 time with PBS, under Laser Scanning Confocal Microscope, observe Cy3 signal, it is determined that VP1 permeates cell membranes enters cell, and is positioned Cytoplasm, illustrate that VP1 is a kind of cell-penetrating albumen.

Embodiment 3:

Simian virus 40 capsid protein VP1 enters the application in cell at transduction fluorescin mCherry, the steps include:

(1) fluorescin mCherry gene is inserted on pET28a-hisVP1 carrier by SacI and XhoI double enzyme site, constructs plasmid pET28a-VP1mCherry, double digestion checking plasmid construction success (Fig. 1-b).

(2) plasmid pET28a-VP1mCherry is transformed into E.coliRosetta (DE3) competent cell, from flat board after picking monoclonal amplification culture, IPTG abduction delivering, utilizes Ni2+-NTA post affinitive layer purification to obtain fusion protein VP1-mCherry.

(3) fusion protein VP1-mCherry polyacrylamide gel electrophoresis, the molecular weight of VP1 albumen be about 70kDa, polyacrylamide gel electrophoresis detection VP1-mCherry molecular weight consistent with predictive value (in Fig. 2 swimming lane b).

(4) the VP1-mCherry albumen of purification adds in the Vero cell being incubated at 35 millimeters of capsules of diameter, changes the fresh OPTI-MEMI culture medium of 1.5mL after hatching 2h on ice, is placed in 37 DEG C of CO2 gas incubator and continues to cultivate 18h. The fluorescence signal of mCherry is observed, it has been found that the fluorescence signal of VP1-mCherry fusion protein is arranged in Cytoplasm (Fig. 4-a) under Laser Scanning Confocal Microscope. Fluorescin mCherry gene is directly inserted into after carrier pET28a the fluorescin mCherry of abduction delivering as comparison, find that the fluorescin mCherry not merging VP1 then can not enter cell (Fig. 4-a), illustrate that VP1 carries fluorescin mCherry permeates cell membranes and enters cell, and be positioned Cytoplasm.

Embodiment 4:

Simian virus 40 capsid protein VP1 enters the application in cell at transduction Tumor suppressor p53, the steps include:

(1) gene of P53 albumen is inserted on pET28a-hisVP1 carrier by SacI and XhoI double enzyme site, constructs plasmid pET28a-VP1P53, double digestion checking plasmid construction success (Fig. 1-b).

(2) plasmid pET28a-VP1P53 is transformed into E.coliRosetta (DE3) competent cell, from flat board after picking monoclonal amplification culture, IPTG abduction delivering, utilizing Ni2+-NTA post affinitive layer purification to obtain fusion protein VP1-P53, its sequence is shown in SEQIDNO.3.

(3) fusion protein VP1-P53 polyacrylamide gel electrophoresis, the molecular weight of VP1-P53 fusion protein is about 70kDa, the molecular weight consistent with predictive value (in Fig. 2 swimming lane c) of polyacrylamide gel electrophoresis detection display VP1-P53.

(4) the VP1-P53 albumen of purification adds in the Vero cell being incubated at 35 millimeters of capsules of diameter, changes the fresh OPTI-MEMI culture medium of 1.5mL after hatching 2h on ice, is placed in 37 DEG C of CO2 gas incubator and continues to cultivate 18h. Immunofluorescence assay finds that VP1-P53 enters in cell and is positioned Cytoplasm (Fig. 5-a). P53 gene is directly inserted into after carrier pET28a the P53 albumen of abduction delivering as comparison, find that the P53 albumen not merging VP1 then can not enter cell (Fig. 5-b), illustrate that VP1 carries external source P53 albumen permeates cell membranes and enters cell, and be positioned Cytoplasm.

SEQUENCELISTING

<110>Wuhan Virology Institute,Chinan academy of Sciences

<120>simian virus 40 capsid protein VP1 is as the application in cell-penetrating albumen

<130>simian virus 40 capsid protein VP1 is as the application in cell-penetrating albumen

<160>3

<170>PatentInversion3.1

<210>1

<211>1131

<212>DNA

<213>artificial sequence

<400>1

atgagaggatcgcatcaccatcaccatcacggatctatgaagatggccccaacaaaaaga60

aaaggaagttgtccaggggcagctcccaaaaaaccaaaggaaccagtgcaagtgccaaag120

ctcgtcataaaaggaggaatagaagttctaggagttaaaactggagtagacagcttcact180

gaggtggagtgctttttaaatcctcaaatgggcaatcctgatgaacatcaaaaaggctta240

agtaaaagcttagcagctgaaaaacagtttacagatgactctccagacaaagaacaactg300

ccttgctacagtgtggctagaattcctttgcctaatttaaatgaggacttaacctgtgga360

aatattttgatgtgggaagctgttactgttaaaactgaggttattggggtaactgctatg420

ttaaacttgcattcagggacacaaaaaactcatgaaaatggtgctggaaaacccattcaa480

gggtcaaattttcatttttttgctgttggtggggaacctttggagctgcagggtgtgtta540

gcaaactacaggaccaaatatcctgctcaaactgtaaccccaaaaaatgctacagttgac600

agtcagcagatgaacactgaccacaaggctgttttggataaggataatgcttatccagtg660

gagtgctgggttcctgatccaagtaaaaatgaaaacactagatattttggaacctacaca720

ggtggggaaaatgtgcctcctgttttgcacattactaacacagcaaccacagtgcttctt780

gatgagcagggtgttgggcccttgtgcaaagctgacagcttgtatgtttctgctgttgac840

atttgtgggctgtttaccaacacttctggaacacagcagtggaagggacttcccagatat900

tttaaaattacccttagaaagcggtctgtgaaaaacccctacccaatttcctttttgtta960

agtgacctaattaacaggaggacacagagggtggatgggcagcctatgattggaatgtcc1020

tctcaagtagaggaggttagggtttatgaggacacagaggagcttcctggggatccagac1080

atgataagatacattgatgagtttggacaaaccacaactagaatgcagtga1131

<210>2

<211>376

<212>PRT

<213>artificial sequence

<400>2

MetArgGlySerHisHisHisHisHisHisGlySerMetLysMetAla

151015

ProThrLysArgLysGlySerCysProGlyAlaAlaProLysLysPro

202530

LysGluProValGlnValProLysLeuValIleLysGlyGlyIleGlu

354045

ValLeuGlyValLysThrGlyValAspSerPheThrGluValGluCys

505560

PheLeuAsnProGlnMetGlyAsnProAspGluHisGlnLysGlyLeu

65707580

SerLysSerLeuAlaAlaGluLysGlnPheThrAspAspSerProAsp

859095

LysGluGlnLeuProCysTyrSerValAlaArgIleProLeuProAsn

100105110

LeuAsnGluAspLeuThrCysGlyAsnIleLeuMetTrpGluAlaVal

115120125

ThrValLysThrGluValIleGlyValThrAlaMetLeuAsnLeuHis

130135140

SerGlyThrGlnLysThrHisGluAsnGlyAlaGlyLysProIleGln

145150155160

GlySerAsnPheHisPhePheAlaValGlyGlyGluProLeuGluLeu

165170175

GlnGlyValLeuAlaAsnTyrArgThrLysTyrProAlaGlnThrVal

180185190

ThrProLysAsnAlaThrValAspSerGlnGlnMetAsnThrAspHis

195200205

LysAlaValLeuAspLysAspAsnAlaTyrProValGluCysTrpVal

210215220

ProAspProSerLysAsnGluAsnThrArgTyrPheGlyThrTyrThr

225230235240

GlyGlyGluAsnValProProValLeuHisIleThrAsnThrAlaThr

245250255

ThrValLeuLeuAspGluGlnGlyValGlyProLeuCysLysAlaAsp

260265270

SerLeuTyrValSerAlaValAspIleCysGlyLeuPheThrAsnThr

275280285

SerGlyThrGlnGlnTrpLysGlyLeuProArgTyrPheLysIleThr

290295300

LeuArgLysArgSerValLysAsnProTyrProIleSerPheLeuLeu

305310315320

SerAspLeuIleAsnArgArgThrGlnArgValAspGlyGlnProMet

325330335

IleGlyMetSerSerGlnValGluGluValArgValTyrGluAspThr

340345350

GluGluLeuProGlyAspProAspMetIleArgTyrIleAspGluPhe

355360365

GlyGlnThrThrThrArgMetGln

370375

<210>3

<211>787

<212>PRT

<213>artificial sequence

<400>3

MetArgGlySerHisHisHisHisHisHisGlySerMetLysMetAla

151015

ProThrLysArgLysGlySerCysProGlyAlaAlaProLysLysPro

202530

LysGluProValGlnValProLysLeuValIleLysGlyGlyIleGlu

354045

ValLeuGlyValLysThrGlyValAspSerPheThrGluValGluCys

505560

PheLeuAsnProGlnMetGlyAsnProAspGluHisGlnLysGlyLeu

65707580

SerLysSerLeuAlaAlaGluLysGlnPheThrAspAspSerProAsp

859095

LysGluGlnLeuProCysTyrSerValAlaArgIleProLeuProAsn

100105110

LeuAsnGluAspLeuThrCysGlyAsnIleLeuMetTrpGluAlaVal

115120125

ThrValLysThrGluValIleGlyValThrAlaMetLeuAsnLeuHis

130135140

SerGlyThrGlnLysThrHisGluAsnGlyAlaGlyLysProIleGln

145150155160

GlySerAsnPheHisPhePheAlaValGlyGlyGluProLeuGluLeu

165170175

GlnGlyValLeuAlaAsnTyrArgThrLysTyrProAlaGlnThrVal

180185190

ThrProLysAsnAlaThrValAspSerGlnGlnMetAsnThrAspHis

195200205

LysAlaValLeuAspLysAspAsnAlaTyrProValGluCysTrpVal

210215220

ProAspProSerLysAsnGluAsnThrArgTyrPheGlyThrTyrThr

225230235240

GlyGlyGluAsnValProProValLeuHisIleThrAsnThrAlaThr

245250255

ThrValLeuLeuAspGluGlnGlyValGlyProLeuCysLysAlaAsp

260265270

SerLeuTyrValSerAlaValAspIleCysGlyLeuPheThrAsnThr

275280285

SerGlyThrGlnGlnTrpLysGlyLeuProArgTyrPheLysIleThr

290295300

LeuArgLysArgSerValLysAsnProTyrProIleSerPheLeuLeu

305310315320

SerAspLeuIleAsnArgArgThrGlnArgValAspGlyGlnProMet

325330335

IleGlyMetSerSerGlnValGluGluValArgValTyrGluAspThr

340345350

GluGluLeuProGlyAspProAspMetIleArgTyrIleAspGluPhe

355360365

GlyGlnThrThrThrArgMetGlnTrpMetGluGluProGlnSerAsp

370375380

ProSerValGluProProLeuSerGlnGluThrPheSerAspLeuTrp

385390395400

LysLeuLeuProGluAsnAsnValLeuSerProLeuProSerGlnAla

405410415

MetAspAspLeuMetLeuSerProAspAspIleGluGlnTrpPheThr

420425430

GluAspProGlyProAspGluAlaProArgMetProGluAlaAlaPro

435440445

ProValAlaProAlaProAlaAlaProThrProAlaAlaProAlaPro

450455460

AlaProSerTrpProLeuSerSerSerValProSerGlnLysThrTyr

465470475480

GlnGlySerTyrGlyPheArgLeuGlyPheLeuHisSerGlyThrAla

485490495

LysSerValThrCysThrTyrSerProAlaLeuAsnLysMetPheCys

500505510

GlnLeuAlaLysThrCysProValGlnLeuTrpValAspSerThrPro

515520525

ProProGlyThrArgValArgAlaMetAlaIleTyrLysGlnSerGln

530535540

HisMetThrGluValValArgArgCysProHisHisGluArgCysSer

545550555560

AspSerAspGlyLeuAlaProProGlnHisLeuIleArgValGluGly

565570575

AsnLeuArgValGluTyrLeuAspAspArgAsnThrPheArgHisSer

580585590

ValValValProTyrGluProProGluValGlySerAspCysThrThr

595600605

IleHisTyrAsnTyrMetCysAsnSerSerCysMetGlyGlyMetAsn

610615620

ArgArgProIleLeuThrIleIleThrLeuGluAspSerSerGlyAsn

625630635640

LeuLeuGlyArgAsnSerPheGluValHisValCysAlaCysProGly

645650655

ArgAspArgArgThrGluGluGluAsnLeuArgLysLysGlyGluPro

660665670

HisHisGluLeuProProGlySerThrLysArgAlaLeuProAsnAsn

675680685

ThrSerSerSerProGlnProLysLysLysProLeuAspGlyGluTyr

690695700

PheThrLeuGlnIleArgGlyArgGluArgPheGluMetPheArgGlu

705710715720

LeuAsnGluAlaLeuGluLeuLysAspAlaGlnAlaGlyLysGluPro

725730735

GlyGlySerArgAlaHisSerSerHisLeuLysSerLysLysGlyGln

740745750

SerThrSerArgHisLysLysLeuMetPheLysThrGluGlyProAsp

755760765

SerAspSerGlySerGlySerGlySerGlySerGlySerGlySerGly

770775780

GluAlaSer

785

Claims (8)

1. simian virus 40 capsid protein VP1 is as the application in cell-penetrating albumen.

2. application according to claim 1, the aminoacid sequence of described simian virus 40 capsid protein VP1 is shown in SEQIDNO.2.

3. the nucleotide sequence that aminoacid sequence described in claim 2 is corresponding.

4. application according to claim 1, enters the application in cell including simian virus 40 capsid protein VP1 at transduction foreign protein.

5. application according to claim 4, it is characterised in that: described foreign protein is fluorescin mCherry.

6. application according to claim 4, it is characterised in that: described foreign protein is p53 albumen.

7. application according to claim 6, it is characterised in that: the aminoacid sequence of simian virus 40 capsid protein VP1 and the fusion protein VP1-p53 that p53 albumen is constituted is shown in SEQIDNO.3.

8. the application described in claim 7, the nucleotide sequence that described aminoacid sequence is corresponding.