CN105617402A - Application of neuraminidase Neu1 in medicine preparation - Google Patents

Abstract

The invention discloses application of neuraminidase Neu1 in medicine preparation, and belongs to the technical field of medicine preparation. The application of Neu1 in effective treatment of bladder cancer is reported for the first time. The Neu1 can be used for hydrolyzing substrates in connecting modes of alpha-2, 3 and alpha-2,6, and converting cell appeared fibronectin (FN). The function of the Neu1 for removing sialic acid of cancerous cell surface factor FN to lead FN degradation so as to inhibit reproduction of bladder cancerous cells is discovered for the first time, and experiment data indicates that the Neu1 has a certain treatment effect on bladder cancer.

Description

A kind of sialidase Neu1 purposes in preparing medicine

Technical field

The present invention relates to a kind of sialidase Neu1 purposes in preparing medicine, belong to field of medicine preparing technology.

Background technology

Bladder cancer is the modal malignant tumor of urinary system, is also one of big kinds of tumor of whole body ten. The whole world nearly 430,000 people every year are diagnosed as bladder cancer, and wherein about 170,000 people die from bladder cancer, and its fatality rate is about 38%. Bladder cancer ranks first in China's Genitourinary system sickness rate, the sickness rate of bladder cancer with the age increase and increase, age bracket occurred frequently be 50-70 year. Male bladder cancer morbidity is higher than women. Bladder cancer patients transurethral prostate resection is postoperative, and its relapse rate is about 70%, and general postoperative irrigation bladder bacillus calmette-guerin vaccine or chemotherapeutics can reduce its relapse rate. Conventional perfusion chemotherapy medicine has mitomycin, amycin, thiotepa, hydroxy camptothecin etc.

Being found that 4 kinds of sialidases (Neuraminidases, NA) in mammal body altogether at present, wherein Neu1 is the most conservative, is primarily targeted for lysosome, and its function is the glycosidic bond in specific recognition oligosaccharide and glycoprotein, and it is sheared. Sialidase inhibitor can suppress the assembling of human skin fibroblast, aortic smooth muscle cell amount of money Ear cartilage cell Elastic fiber, and causes the synthesis of elastic fiber impaired. In 40 years of past, the sialic modification situation of cell surface glycoprotein is frequently as the mark distinguishing different tumor, and therefore sialic acid is also considered as potential target for cancer therapy, and Neu1 is also affected by showing great attention to as the sialic enzyme of hydrolyzable. There is researcher to many strains mouse colon adenocarcinoma cells analysis, find that in the cell strain that grade malignancy is higher, Neu1 expresses significantly lower than benign cell strain, but this research is only limitted to express quantitative analysis, the not relation between itself and adenocarcinoma of colon of further data surface, owing to the performance of living organism is subject to interaction and the impact of lots of genes, so Neu1 is on the knees of the gods with the relation of adenocarcinoma of colon.

Owing to the sickness rate of bladder cancer remains high, and relapse rate is significantly high, and it is the problem needing solution at present badly that the medicine of bladder cancer is effectively treated in exploitation.

Summary of the invention

In order to overcome the problems referred to above, the invention provides the new application of a kind of sialidase Neu1, be reported first Neu1 application in effectively treatment bladder cancer. The effective albumen Neu1 of the present invention, by plasmid construction, transfection, to transitional cell bladder carcinoma cell line, causes activation or the suppression of related pathways, and shows that the treatment of bladder cancer is had certain therapeutic effect by this albumen by experimental data.

The sialidase Neu1 of the present invention, its aminoacid sequence is as shown in (a) or (b):

A () aminoacid sequence is such as shown in SEQIDNO.1;

B there is the aminoacid sequence that aminoacid insertion, disappearance or replacement obtain in (), and encode activated sialidase on the basis of (a).

The nucleotide sequence of described sialidase Neu1 is such as shown in SEQIDNO:2.

The invention provides described sialidase Neu1 application in preparing medicine; It is used to the medicine that preparation suppresses transitional cell bladder carcinoma cell line to migrate or breed.

In one embodiment of the invention, described medicine is antibody.

In one embodiment of the invention, described application, it is first by the sialidase Neu1 gene of encoding amino acid sequence such as SEQIDNO.1, adopts the expression vector being suitable for and/host to carry out expression and obtain sialidase Neu1, be then used further to prepare medicine.

In one embodiment of the invention, described expression vector is carrier for expression of eukaryon.

In one embodiment of the invention, described medicine, it is possible to can be used by the method for irrigation of bladder in the treatment of bladder cancer, to reach to suppress the effect of bladder cancer.

The present invention also provides for the application expressing the transgenic cell line of sialidase or genetic engineering bacterium in the medicine that preparation suppresses transitional cell bladder carcinoma cell line migration and/or propagation.

In one embodiment of the invention, the aminoacid sequence of described sialidase Neu1 is such as shown in SEQIDNO.1.

Beneficial effects of the present invention: be found that the new application of a kind of sialidase Neu1, is reported first Neu1 application in effectively treatment bladder cancer. The sialidase of the present invention is to �� 2,3 and �� 2, the substrate of 6 types of attachment all can be hydrolyzed, the FN that cell is shown converts, find that this enzyme by the sialic acid of cancer cell surfaces factor fibronectin FN is removed the degraded causing FN, and can suppress the multiplication capacity of transitional cell bladder carcinoma cell line first simultaneously. The effective albumen Neu1 of the present invention transfects to transitional cell bladder carcinoma cell line, can cause activation or the suppression of related pathways, and experimental data shows that the treatment of bladder cancer is had certain therapeutic effect by this albumen.

Accompanying drawing explanation

Fig. 1 is the expression of Neu1 in YTS-1/Neu1 and YTS-1;

Fig. 2 is the difference of Sialic Acid Level in YTS-1/Neu1 and YTS-1 cell;

Fig. 3 is the difference of sialidase activity in YTS-1/Neu1 and YTS-1 cell;

Fig. 4 is the change of FN protein expression after process LAN Neu1 albumen in transitional cell bladder carcinoma cell line YTS-1;

Fig. 5 is the change of ability of cell proliferation after process LAN Neu1 albumen in transitional cell bladder carcinoma cell line YTS-1;

The tumor tissue weight that Fig. 6 is YTS-1/Neu1 and YTS-1 compares;

Fig. 7 is tumor tissue growth's trend comparison of YTS-1/Neu1 and YTS-1;

Fig. 8 is tumor tissues photo.

Detailed description of the invention

The experimental technique used in following embodiment if no special instructions, is conventional method.

Material used in following embodiment, reagent etc., if no special instructions, all commercially obtain.

Embodiment 1: the structure of process LAN YTS-1 cell strain

1, the clone of sialidase Neu1 gene

The sequence information of Neu1 gene is obtained by website http://avermitilis.ls.kitasato-u.ac.jp/, and by SignalP4.1Server website, the signal peptide situation of this enzyme is predicted, result shows that this enzyme is the endocellular enzyme not containing signal peptide, and size is about the sialidase of 45kDa. Carry out design of primers in the coding region of neu1 gene, company synthesize following primer Neu1-F/Neu1-R (sequence is respectively as shown in SEQIDNO:3, SEQIDNO:4). Primer sequence is as follows:

Neu1-F:CCCAAGCTTATGACTGGGGAGCGACC;

Neu1-R:GGAATTCCAGTGGCACAGCTCAGAGTG

Carrying out pcr amplification with people's cellular genome for template, amplification condition is as follows: 95 DEG C of 10min, 96 DEG C of 1min, 65 DEG C of 45s, and 72 DEG C of 1min30s repeat 34 circulations, 72 DEG C of 10min. Pcr amplification product is easily separated by agarose gel electrophoresis, and adopts agarose gel to reclaim test kit recovery, it is thus achieved that neu1 genetic fragment (nucleotide sequence is such as shown in SEQIDNO:2).

Neu1 genetic fragment is connected overnight with vector plasmid pcDNA3.1 respectively through after EcoRI and HindIII enzyme action 16 DEG C, connect product Transformed E .coliJM109, the transformant of picking ammonia benzyl chloramphenicol resistance is extracted plasmid and is carried out digestion verification and sequence verification, it is thus achieved that build correct neu1 expression plasmid.

2, the structure of sialidase Neu1 process LAN YTS-1 cell strain (YTS-1/Neu1)

By cell fishplate bar in 12 orifice plates, 37 DEG C, 5%CO₂Incubator is adherent overnight, the pcDNA3.1/Neu1 recombiant plasmid built utilize transfection reagent transfect to YTS-1 cell, after cell covers with, add the medium treatment cell containing antibiotic G418, select monoclonal, the culture medium containing G418 is utilized to continue to expand select monoclonal (if the purity that first time is selected is not high, second time monoclonal screening can be carried out), after q.s to be grown to, collect a part of cytolytic proteins sample and carry out the expression (Fig. 1) of WesternBlotting qualification Neu1. As shown in Figure 1, the YTS-1 cell strain of Neu1 protein overexpression successfully constructs.

Embodiment 2: the difference that in the transitional cell bladder carcinoma cell line YTS-1/Neu1 of process LAN Neu1 and YTS-1 cell, Sialic Acid Level and sialidase are lived

(1) difference of Sialic Acid Level in the transitional cell bladder carcinoma cell line YTS-1/Neu1 of process LAN Neu1 and YTS-1 cell

24 orifice plates are put into circular lid slide, adds overexpressing cell YTS-1/Neu1 and YTS-1 cell carries out cultivating 24h; Sucking-off culture medium, washes 2 times with 1 �� PBS, and 4% paraformaldehyde is fixed; Add the permeabilized cell 10min of 0.1%TritonX-100 solution; Washing 3 times with 1 �� PBS, 1%BSA solution 4 DEG C is closed overnight again; Adding the agglutinin of Cy3 labelling being dissolved in PBS, under room temperature, lucifuge hatches 3h, and 1 �� PBS washes 3 times, and DAPI dye 10min, and finally being tipped upside down on by cell climbing sheet droplet has on the microscope slide of Glycergel sealing agent, keeps in Dark Place after drying under 4 DEG C of conditions. Under 10 �� 60 times, (Fig. 2) is taken pictures with Nikon inverted fluorescence microscope ECLIPSETi-U. As shown in Figure 2, after Neu1 process LAN, in YTS-1/Neu1 cell, sialic level substantially reduces compared with matched group.

(2) difference of sialidase activity in process LAN transitional cell bladder carcinoma cell line YTS-1/Neu1 and YTS-1 cell

Using 2-(4-methyl umbelliferone)-D-N n acetylneuraminic acid n sodium salt (4-MU-NANA) as substrate, YTS-1/Neu1 and YTS-1 cell suspension is at the sodium acetate containing 500mM, and 0.1%TritonX-100 is supplemented with 200 �� L buffer of protease inhibitor. Then, hatching 1h for 37 DEG C under having 4-MU-NANA to exist, every 15min stirs once therebetween; Add glycine-NaOH buffer (pH=10.3) and terminate sialic acid reaction; Microplate reader fluorescence intensity (excitation wavelength 355nm launches 460nm) (Fig. 3). From the figure 3, it may be seen that after Neu1 process LAN, in YTS-1/Neu1 cell, the activity of ptyalin substantially increases compared with matched group.

Embodiment 3: sialidase Neu1 suppresses transitional cell bladder carcinoma cell line YTS-1 multiplication capacity and the research becoming tumor ability

Bladder cancer is modal a kind of malignant tumor in urinary system, and in world wide, bladder cancer ranks the 4th of the most common solid tumors of male, ranks the 7th in women, and the bladder cancer patients of annual new diagnosis is more than 350,000; In China, bladder cancer is modal urologic neoplasms, and the bladder cancer of about 90% is Urothelial Carcinoma of Bladder. Higher at the transfer ability compared with normal Urothelial Cell of pernicious transitional cell bladder carcinoma cell line YTS-1.

The research of on cell proliferation ability adopts mtt assay to measure, and result shows that the YTS-1 transfer ability of Neu1 protein overexpression substantially reduces, and illustrates that this enzyme can effectively suppress the propagation (Fig. 4) of pernicious transitional cell bladder carcinoma cell line, the method that the detection of the changes of contents situation of FN is adopted westernblotting, cell is inoculated in 6 orifice plates, treat that cell length is to 90%, RIPA lysate is by after lysis, with BCA kit measurement protein concentration, add SDSloadingbuffer in 100 DEG C of water-baths, boil sample 5min, after 10%SDSPAGE glue carries out electrophoresis, westernblotting identifies the change (Fig. 5) of FN protein expression in YTS-1/Neu1 and YTS-1, experiment finds, the content of the YTS-1FN albumen after Neu1 protein overexpression substantially increases, illustrate that Neu1 can effectively convert the FN fibronectin on pernicious transitional cell bladder carcinoma cell line surface, this conversion is likely to be one of reason of causing ability of cell proliferation to change.

Cell becomes tumor experimental implementation as follows: 18 mice stochastic averagina are divided into 3 groups, and wherein two groups are used for testing, and the 3rd group is used for preliminary experiment; Cell strain YTS-1 and YTS-1/Neu1 good for growth conditions is resuspended with serum-free medium respectively, mix with equal-volume Matrigel, be expelled to BalbC/ nude mice dorsal sc (2*10 respectively⁶Cells/200 �� L/ is only); Diet is drunk water, and continuous 3-4 week observes the growing state of tumor every other day, and measures diameter of tumor, record with slide gauge; Terminating experiment, after anesthesia, mice is put to death in dislocation, analyze obtain the weight (Fig. 6) of tumor tissues, tumor tissue growth trend (Fig. 7), take tumor tissues and take pictures (Fig. 8). The one-tenth tumor ability of result display YTS-1/Neu1 cell is markedly less than YTS-1 cell, it was shown that tumor is formed with inhibitory action by Neu1. Illustrate that Neul has the potentiality for preparing treatment bladder cancer medicine, can method by patient is carried out irrigation of bladder, thus suppressing propagation and the growth of transitional cell bladder carcinoma cell line.

Although the present invention is with preferred embodiment openly as above; but it is not limited to the present invention, any person skilled in the art, without departing from the spirit and scope of the present invention; all can doing various changes and modification, therefore protection scope of the present invention should with being as the criterion that claims define.

Claims (8)

1. sialidase Neu1 application in preparing medicine; Described medicine is the medicine suppressing transitional cell bladder carcinoma cell line to migrate or breed.

2. application according to claim 1, it is characterised in that the aminoacid sequence of described sialidase Neu1 is as shown in (a) or (b):

A () aminoacid sequence is such as shown in SEQIDNO.1;

B there is the aminoacid sequence that aminoacid insertion, disappearance or replacement obtain in (), and encode activated sialidase on the basis of (a).

3. application according to claim 1, it is characterised in that described medicine is antibody.

4. application according to claim 1, it is characterised in that the nucleotide sequence of sialidase Neu1 is SEQIDNO.2.

5. application according to claim 1, it is characterized in that, described application is first by the sialidase Neu1 gene of encoding amino acid sequence such as SEQIDNO.1, adopts the expression vector being suitable for and/host to carry out expression and obtain sialidase Neu1, is then used further to prepare medicine.

6. application according to claim 5, it is characterised in that described expression vector is carrier for expression of eukaryon.

7. express transgenic cell line or the genetic engineering bacterium application in the medicine that preparation suppresses transitional cell bladder carcinoma cell line migration and/or propagation of sialidase.

8. application according to claim 7, it is characterised in that the aminoacid sequence of described sialidase Neu1 is such as shown in SEQIDNO.1.