CN105617399B

CN105617399B - Application of the miRNA-378 in fatty liver treatment

Info

Publication number: CN105617399B
Application number: CN201410614145.0A
Authority: CN
Inventors: 应浩; 刘威
Original assignee: Shanghai Institutes for Biological Sciences SIBS of CAS
Current assignee: Shanghai Institute of Nutrition and Health of CAS
Priority date: 2014-11-04
Filing date: 2014-11-04
Publication date: 2019-05-10
Anticipated expiration: 2034-11-04
Also published as: CN105617399A

Abstract

The invention discloses application of the miRNA-378 in fatty liver treatment.Specifically, the invention demonstrates that, miR-378 is the core element for regulating and controlling insulin signaling pathway in liver.When mouse liver is overexpressed miR-378, mouse lipid metaboli stable state gets a promotion, and is mainly shown as that liver TG content declines.Wherein, miR-378 can be by inhibiting the key protein p110 α of insulin signaling pathway to exercise its function.Therefore, inhibit the expression of p110 α that can become a kind of strategy of new treatment liver lipids accumulation by being overexpressed miR-378 in liver.

Description

Application of the miRNA-378 in fatty liver treatment

Technical field

The invention belongs to metabolic disease therapy fields.In particular it relates to a kind of miRNA for treating fatty liver and its effect Mechanism.

Background technique

Liver is the important metabolism sexual organ of human body, can perceive from hormone, nerve impulse and Nutrition and Metabolism because The multi-signals such as son simultaneously exercise specific function.Liver has highly important effect in adjusting body glycolipid balance.And rouge Fat liver is to lead to the lesion that triglycerides in liver cell (TG) accumulation is excessive and generates due to body disorders of lipid metabolism.In recent years Come, with the variation of people's living and diet structure, the disease incidence of fatty liver increases year by year.Long-term liver lipids deposition may go out Existing dysfunction of liver, serious person can lead to liver fibrosis, cirrhosis, or even cause liver failure.

Currently, the treatment of fatty liver, which relies primarily on, reduces blood lipid or living-pattern preservation, such as diet control reinforces fortune It is dynamic.But also to reach the deposition for inhibiting intrahepatic fat while due to reducing blood lipid simultaneously, but certain lipid-lowering medicines can even aggravate liver Dysfunction, and the subjectivity of lifestyle change is too strong, patient compliance is not good enough.Therefore so far, there are no one kind Intrahepatic fat accumulation can be quickly reduced while decrease blood lipid, to treat the effective ways of fatty liver.

Therefore, there is an urgent need in the art to develop one kind to adjust intrahepatic fat metabolism, inhibition intrahepatic fat deposition, thus The method for treating fatty liver.

Summary of the invention

It can be expressed by reducing special gene in insulin metabolism access the present invention provides one kind and reduce liver lactones The miRNA-378 of fat content, the miRNA can effectively improve intrahepatic fat accumulation, to treat fatty liver.

First aspect present invention provides a kind of purposes of active constituent, and the active constituent is selected from the group:

(a) Microrna of .miRNA-378 family, the Microrna of the miRNA-378 family include: miRNA-378 or Modified miRNA-378 derivative；Or core sequence is 5 ' CUGGACU 3 ', length 18-26nt, function and miRNA- 378 identical or essentially identical Micrornas or modified miRNA derivative；

(b) precursor miRNA, the precursor miRNA can be processed into miRNA-378 described in (a) in host；

(c) polynucleotides, the polynucleotides can be formed precursor miRNA described in (b) by host transcription, and add Work forms Microrna described in (a)；

(d) expression vector, the expression vector contain miRNA-378 described in (a) or (b) described in precursor MiRNA or (c) described in polynucleotides；

(e) agonist of Microrna described in (a)；

Wherein, the active constituent is used for:

(i) preparation inhibits p110 α gene or its protein expression and/or active pharmaceutical composition；And/or

(i i) preparation treatment fatty liver；And/or inhibit the pharmaceutical composition of triglycerides accumulation in liver.

In another preferred example, the pharmaceutical composition includes the active constituent and pharmaceutically acceptable load Body.

In another preferred example, the miRNA-378 is also used to prepare treatment p110 α related neoplasms.

In another preferred example, the pharmaceutical composition also contains additional p110 alpha inhibitor.

In another preferred example, core sequence described in (a) refers to Microrna 2-8 nucleotide sequences；And/or Described " function and miRNA-378 are identical or essentially identical " refer to remain miRNA-378 >=40%, and≤500% Inhibit p110 α gene or its protein expression and/or active function.

In another preferred example, the sequence of the miRNA-378 is as shown in SEQ ID NO.:1 (ACUGGACUUGGAGUCAGAAGGC)

In another preferred example, the miRNA-378 derive from mammal, it is preferable that from people, rat or Mouse.

In another preferred example, the pharmaceutical composition further includes optional lipid-lowering medicine.

In another preferred example, the lipid-lowering medicine includes but is not limited to): HMG-CoA reductase inhibitor (Statins Drug), niacin and its derivative, probucol and fibrates etc..

In another preferred example, the modified miRNA derivative modifies selected from the group below one or more repair Decorations form: the modification of connection type, cholesterol modification, the modification of lock nucleotide, peptide fragment between the glycosyl modified of nucleotide, nucleotide Modification, lipid modification, halogen modification, alkyl modification and nucleic acid modification.

In another preferred example, glycosyl modified glycosyl modified, the 2-O- methoxy including 2-O- methyl of the nucleotide Glycosyl modified, 2-O- alkyl glycosyl modified, 2- fluoro the glycosyl modified, sugar-ring modification of ethyl ester, lock nucleotide modification；With/ Or

The modification of connection type includes thiophosphoric acid modification, alkyl acid phosphateization modification between the nucleotide；And/or

The nucleic acid modification includes that " TT " is modified.

In another preferred example, modified miRNA derivative described in (a) is the compound with structure shown in Formulas I Monomer or its polymer:

(X)n-(Y)m

Formulas I,

In Formulas I,

Each X is Microrna described in (a)；

Each Y independently is the modifier for promoting Microrna application stability；

Y is connected to the left side, right side or centre of X；

(preferably 1-20) positive integer that n is 1-100 (preferably n is 1,2,3,4 or 5)；

M is (preferably 1-200) positive integer of 1-1000；

Each "-" indicates connector, chemical bond or covalent bond.

In another preferred example, the connector is the nucleic acid sequence that length is 1-10 base.

In another preferred example, the Y includes but is not limited to cholesterol, steroids, sterol, alcohol, organic acid, fat Acid, ester, monosaccharide, polysaccharide, amino acid, polypeptide, mononucleotide, polynucleotides.

In another preferred example, (b) described in precursor miRNA nucleotide sequence (precursor as shown in SEQ ID NO.:2 Sequence).

5’-AGGGCUCCUGACUCCAGGUCCUGUGUGUUACCUAGAAAUAGCACUGGACUUGGAGUCAGAAG GCCU-3’

In another preferred example, (c) described in polynucleotides have Formula II shown in structure:

Seq_{It is positive}-X-Seq_Reversely

Formula II,

In Formula II,

Seq forward direction is that can be processed to the Microrna nucleotide sequence in host；

Seq is reversed to be substantially complementary or the nucleotide sequence of complete complementary with Seq forward direction；

X be positioned at Seq is positive and Seq it is reversed between intervening sequence, and the intervening sequence and Seq is positive and Seq It is reversed not complementary；

And structure shown in Formula II forms secondary structure shown in formula III after being transferred to host cell:

Formula III,

In formula III, Seq is positive, Seq is reversed and X is as defined above and states,

| | indicate the base pair complementarity relationship formed between Seq is positive and Seq is reversed.

In another preferred example, (d) described in expression vector include: viral vectors and non-virus carrier.

In another preferred example, (e) described in the agonist of miRNA-378 be selected from the group: promote miRNA-378 expression Substance improves the active substance of miRNA-378.

In another preferred example, the pharmaceutically acceptable carrier is selected from the group: water, salt water, liposome, lipid, Albumen, Protein-antibody conjugate, peptide matters, cellulose, nanogel, or combinations thereof.

Second aspect of the present invention, provides a kind of pharmaceutical composition, and the pharmaceutical composition contains active constituent and medicine Acceptable carrier on, wherein the active constituent is selected from:

(d) expression vector, the expression vector contain miRNA-378 described in (a) or (b) described in precursor MiRNA or (c) described in polynucleotides.

Third aspect present invention provides a kind of method of screening promotion miRNA-378 candidate compound, comprising steps of

(a) cell culture system of candidate compound will be added as experimental group；The cell of candidate compound will be added without Cultivating system is as a control group；

(b) in test experiments group and control group p110 α albumen expression quantity and/or activity；

Wherein, when in test group the expression quantity of p110 α albumen and/or activity be significantly higher than control group, then show the candidate Compound is the substance for promoting miRNA-378.

In another preferred example, the cell is liver cell.

In another preferred example, in step (b) further include:

Further the obtained compound of test makees the inhibition that triglycerides in liver cell in experimental group or control group is accumulated With；

Wherein, when triglycerides accumulation substantially less than control group in the liver cell in experimental group, then show described candidates Closing object is the substance for treating fatty liver.

Fourth aspect present invention provides the inhibition p110 alpha expression amount and/or activity of a kind of external non-therapeutic；And/or Inhibit the method for triglycerides accumulation in liver cell, comprising steps of

Pharmaceutical composition or miRNA-378 described in second aspect of the present invention are added into cell culture system, to press down P110 alpha expression amount and/or activity processed；And/or inhibit triglycerides accumulation in liver cell.

Fifth aspect present invention provides a kind of inhibition p110 alpha expression amount and/or activity, and/or inhibits sweet in liver cell The method of oily three esters accumulation, and/or treatment fatty liver, comprising steps of

To the object of needs application second aspect of the present invention described in pharmaceutical composition, thus inhibit p110 alpha expression amount and/ Or triglycerides accumulation, and/or treatment fatty liver in activity, and/or inhibition liver cell.

In another preferred example, the object of the needs is mammal, preferably, being people, mouse or rat.

Sixth aspect present invention, provides a kind of p110 α gene or the inhibitor of its albumen, and the inhibitor includes this Pharmaceutical composition described in invention second aspect.

Seventh aspect present invention provides a kind of purposes of p110 α gene inhibitor, is used to prepare the medicine for the treatment of fatty liver Compositions.

In another preferred example, the p110 α gene inhibitor is miRNA-378 or its derived sequence.

It should be understood that above-mentioned each technical characteristic of the invention and having in below (eg embodiment) within the scope of the present invention It can be combined with each other between each technical characteristic of body description, to form a new or preferred technical solution.As space is limited, exist This no longer tires out one by one states.

Detailed description of the invention

Fig. 1 is shown is overexpressed miR-378 by adenovirus in mouse liver, and miR-378 crosses table to qPCR as the result is shown Up to more than 50 times.

Fig. 2A shows the site being combined there are one section with possible miR-378 in the 3 ' UTR sequences of p110 α；Fig. 2 B After showing mouse liver infection sh-p110 α, liver TG content is also declined.

Fig. 3 shows that adenovirus is overexpressed miR-378 in ob/ob mouse liver, can effectively reduce its liver TG content.

Fig. 4 a shows that 3 ' UTR relative intensity of fluorescence of p110 α weakens with the raising of miR-378 concentration；Fig. 4 b is shown After one or two nucleotide for the miR-378 binding site being mutated in 3 ' UTR of p110 α, miR-378 is for mutation 3 ' UTR of p110 α no longer there is inhibiting effect.

Specific embodiment

The present inventor after extensive and in-depth study, for the first time it was unexpectedly observed that miRNA-378 can pass through inhibit p110 α albumen significantly reduces the content of liver tg, mitigates intrahepatic fat deposition, to effectively treat fatty liver.Experiment card Bright, in the mouse liver for being overexpressed miRNA-378, p110 α albumen is significantly inhibited, to keep the content of triglycerides aobvious Writing reduces.On this basis, the present invention is completed.

Fatty liver

Liver is the important metabolism sexual organ of human body, can perceive from hormone, nerve impulse and Nutrition and Metabolism because The multi-signals such as son simultaneously exercise specific function.Liver has highly important effect in adjusting body glycolipid balance.And rouge Fat liver is to lead to the lesion that triglycerides in liver cell (TG) accumulation is excessive and generates due to body disorders of lipid metabolism.In recent years Come, with the variation of people's living and diet structure, the disease incidence of fatty liver increases year by year.

Insulin has highly important effect to the lipid metaboli of liver.When body is converted into feed shape by starvation State, the rising of Blood Glucose concentration can cause the release of insulin, and the release of insulin can inhibit liver gluconeogenesis, promote sugar Former synthesis, and promote Fatty synthesis.The insulin resistance of liver has been considered metabolic disease, such as type-2 diabetes mellitus, fat Liver etc., important component part.

It is now recognized that the morbidity of insulin resistance is a multifactorial disease, heredity, gene mutation, some special diseases Generation will lead to insulin resistance.Therefore, it can not yet find out insulin resistance at present and its cause the morbidity machine of fatty liver Key pathogenetic factor in system also fails to find the good for the treatment of insulin resistance and its caused related disease (such as fatty liver) Method.

The present invention is experimentally confirmed, insulin resistance and its caused by Fatty Liver Disease pathogenesis, miRNA- The inhibiting effect of 378 pairs of p110 α genes or its albumen play the role of it is very important, it is demonstrated experimentally that miRNA-378 can press down The expression of p110 α processed further achievees the effect that treat fatty liver to reduce the savings of the triglycerides in liver.

PI3K/AKT signal path is access necessary to insulin regulating cell is metabolized.When extracellular insulin signaling After being transmitted into the cell by IR and IRS, the SH2 structural domain of the adjusting subunit p85 of the IRS and PI3K of phosphorylation are combined, from And recruit and activate the catalytic subunit p110 of PI3K.PI3K can be divided into 3 according to the homology of sequence and the specificity of substrate Class.IA class PI3K adjusts subunit (p85 α, p85 β, p55 γ) and p110 catalytic subunit (p110 α, p110 β, p110 α δ) by p85 Form heterodimer.The PI3K adjusted in the insulin signaling pathway of hepatic energy metabolism is primarily referred to as p85 α and p110 α.

MiRNA and its precursor

Microrna (microRNA, abbreviation miRNA) is in recent years in nematode, drosophila and plant, and the eukaryons such as mammal are raw A kind of endogenic length found in object is the single-stranded tiny RNA of non-coding of 22 nucleotide or so.It has group in expression The specificity with the time is knitted, the expression of gene is born on post-transcriptional level and the base pair complementarity with said target mrna Regulation, leads to degradation or the Translational repression of mRNA, is the important regulating and controlling molecule for adjusting other function gene expression.More and more Evidence shows that miRNA is although small, but it is complete or not exclusively mutually unpaired to organism by being formed with said target mrna Various life processes have vital effect.The present invention provides one kind to be related to by inhibiting p110 α albumen to control Treat the miRNA of fatty liver.As used herein, " miRNA " refers to a kind of RNA molecule, from turn that can form miRNA precursor Record object processing.Mature miRNA usually has 18-26 nucleotide (nt) (more particularly about 19-22nt), is also not excluded for MiRNA molecule with other number nucleotide.MiRNA can usually be detected by Northern trace.

The miRNA in people source can be separated from people's cell.As used herein, " separation " refers to substance from its original ring (if it is crude, primal environment is natural surroundings) is separated in border.Under the native state in active somatic cell Polynucleotide and polypeptide do not isolate and purify, but same polynucleotide or polypeptide are deposited together such as from native state Other substances in separate, then isolate and purify.

MiRNA can be processed from precursor miRNA (Precursor miRNA, Pre-miRNA), the precursor miRNA It is can be folded into a kind of stable stem ring (hair clip) structure, the loop-stem structure length is generally between 50-100bp.Described Precursor miRNA can be folded into stable loop-stem structure, and the stem two sides of loop-stem structure include the two sequences being substantially complementary.Institute The precursor miRNA stated can be natural or artificial synthesized.

Precursor miRNA, which can be sheared, generates miRNA, and the miRNA can be at least part of the mRNA of encoding gene Sequence is substantially complementary.As used herein, it " is substantially complementary " and refers to that the sequence of nucleotide is enough complementations, it can be with one kind Foreseeable mode interacts, and such as forms secondary structure (such as loop-stem structure).In general, the core of two " being substantially complementary " Nucleotide sequence from each other at least 70% nucleotide be complementary；Preferably, at least 80% nucleotide is complementary； It is furthermore preferred that at least 90% nucleotide is complementary；It is further preferred that at least 95% nucleotide is complementary； Such as 98%, 99% or 100%.Generally, most 40 unmatched nucleosides be can have between two molecules complementary enough Acid；Preferably, there are most 30 unmatched nucleotide；It is furthermore preferred that having most 20 unmatched nucleotide；Into one Step is preferred, has most 10 unmatched nucleotide, such as has 1,2,3,4,5,8,11 unmatched nucleotide.

As used in this application, " stem ring " structure is also referred to as " hair clip " structure, refers to a kind of nucleic acid molecule, can be formed One kind includes the secondary structure of double-stranded region (stem), and the double-stranded region (is located at by two regions of the nucleic acid molecule On same molecule) it is formed, the two sides of column double stranded section are divided in two regions；It further includes at least one " ring " structure, including non-mutual The nucleic acid molecule of benefit, i.e. single-stranded regions.Even if two regions of the nucleic acid molecule are not complete complementary, pair of nucleotide Chain part can also keep double-stranded state.For example, insertion, missing, substitution etc. can lead to not complementary or cell of a zonule Domain itself forms the secondary structure of loop-stem structure or other forms, however, two regions can be still substantially complementary, and can be pre- It interacts in the mode seen, forms the double-stranded region of loop-stem structure.Loop-stem structure is well known to those skilled in the art , usually after the nucleic acid for obtaining a nucleotide sequence with primary structure, those skilled in the art can determine this Whether nucleic acid can form loop-stem structure.

MiRNA of the present invention refers to: Microrna -378 (miRNA-378) family, the miRNA-378 family packet Include: miRNA-378 or modified miRNA-378 derivative, function are identical or essentially identical with miRNA-378-.

In another preferred example, the Microrna derives from people or non-human mammal；The preferably inhuman food in one's mouth Newborn animal is rat, mouse, and miRNA-378 family's family sequence of mouse and people are completely the same." function and the miRNA-378 phase With or it is essentially identical " refer to remain miRNA-23b-3p >=40%, >=50%, >=60%, >=70%, >=80%, >= 90% inhibition p110 α albumen is to treat the function of fatty liver.

The invention also includes miRNA variant and derivatives.In addition, sensu lato miRNA derivative may also comprise miRNA change Body.Those skilled in the art can be used general method and modify miRNA-378, modification mode include (but It is not limited to): methylation modification, alkyl modification, glycosylation modified (such as 2- methoxyl group-is glycosyl modified, alkyl-is glycosyl modified, saccharide ring Modification etc.), nucleination modification, peptide fragment modification, lipid modification, halogen modification, nucleic acid modification (such as " TT " modification).

Polynucleotides construction

Provided miRNA sequence according to the present invention, can be designed can be processed to influence after being imported into accordingly The polynucleotides construction namely the polynucleotides construction of the miRNA of mRNA expression can raise accordingly in vivo The amount of miRNA.Therefore, the present invention provides a kind of isolated polynucleotides (construction), the polynucleotides (construction) Precursor miRNA can be transcribed by people's cell, the precursor miRNA can be sheared by people's cell and be expressed as the miRNA.

As a kind of preferred embodiment of the invention, the polynucleotides construction contains structure shown in Formula II:

Seq_{It is positive}-X-Seq_Reversely

Formula II

In Formula II,

Seq_{It is positive}For the nucleotide sequence that can be expressed as the miRNA-27b in cell, Seq_ReverselyFor with Seq_{It is positive}Substantially The nucleotide sequence of upper complementation；Alternatively, Seq_ReverselyFor the nucleotide sequence that can be expressed as the miRNA in cell, Seq_{It is positive} For with Seq_{It is positive}The nucleotide sequence being substantially complementary；X is positioned at Seq_{It is positive}And Seq_ReverselyBetween intervening sequence, and it is described between Every sequence and Seq_{It is positive}And Seq_ReverselyIt is not complementary；

Structure shown in Formulas I forms secondary structure shown in formula III after being transferred to cell:

Formula III

In formula III, Seq_{It is positive}、Seq_ReverselyIt is as defined above and states with X；

| | it indicates in Seq_{It is positive}And Seq_ReverselyBetween the base pair complementarity relationship that is formed.

In general, the polynucleotides construction is located on expression vector.Therefore, the invention also includes a kind of carrier, it Contain the miRNA or the polynucleotides construction.The expression vector usually also contains promoter, replicates Point and/or marker gene etc..Method well-known to those having ordinary skill in the art can be used to construct the required expression vector of the present invention.This A little methods include recombinant DNA technology in vi, DNA synthetic technology, In vivo recombination technology etc..The expression vector preferably includes One or more selected markers, to provide the phenotypic character for selecting the host cell of conversion, such as kalamycin, celebrating Big mycin, hygromycin, amicillin resistance.

Pharmaceutical composition and method of administration

As used herein, term " active constituent " refers to that miRNA-378, miRNA-378 for use in the present invention are derivative Object or its precursor sequence or the expression vector containing it.Preferably, the active constituent is selected from the group:

As used herein, term " effective quantity " or " effective dose ", which refer to, to generate function or activity to people and/or animal And the amount that can be received by people and/or animal.

As used herein, the ingredient of term " pharmaceutically acceptable " is suitable for people and/or mammal and without excessive Bad side reaction (such as toxicity, stimulation and allergy), i.e., with the substance of reasonable benefit/risk ratio.Term is " pharmaceutically Acceptable carrier " refers to the carrier for Therapeutic Administration, including various excipient and diluent.

Pharmaceutical composition of the invention contains the active constituent of the invention of safe and effective amount and pharmaceutically acceptable Carrier.This kind of carrier include (but being not limited to): salt water, buffer, glucose, water, glycerol, ethyl alcohol, and combinations thereof.Usual medicine Object preparation should match with administration mode, the dosage form of pharmaceutical composition of the invention be injection, oral preparation (tablet, capsule, Oral solution), transdermal agent, sustained release agent.Such as the aqueous solution with physiological saline or containing glucose and other adjuvants passes through routine side It is prepared by method.The pharmaceutical composition preferably aseptically manufactures.

The effective quantity of active constituent of the present invention can be with the mode of administration and the severity of disease to be treated etc. And change.Preferred a effective amount of selection can be determined depending on various factors by those of ordinary skill in the art (such as to be passed through Clinical test).The factor includes but is not limited to: the pharmacokinetic parameter of the active constituent such as biological utilisation Rate, metabolism, half-life period etc.；Patient the severity of disease to be treated, the weight of patient, the immune state of patient, administration Approach etc..In general, when active constituent of the invention is (preferable with about 0.00001mg-50mg/kg the weight of animals daily 0.0001mg-10mg/kg the weight of animals) dosage give, satisfactory effect can be obtained.For example, being compeled by treatment situation It highly necessary asks, dosage separated several times can be given once daily, or dosage is reduced pari passu.

Pharmaceutically acceptable carrier of the present invention includes but is not limited to: water, salt water, liposome, lipid, egg White, Protein-antibody conjugate, peptide matters, cellulose, nanogel, or combinations thereof.The selection of carrier should be with administration mode phase Matching, these are all known to those skilled in the art.

In the present invention, miRNA-378 can be used for the pharmaceutical composition that preparation inhibits p110 α albumen.For example, miRNA- 378 derivative or its agonist can be used for preparing the pharmaceutical composition of triglycerides accumulation in liver, treatment fatty liver.

In addition, can also inhibitor or lipid-lowering medicine containing other p110 α in pharmaceutical composition of the present invention.For example, it is preferable to Lipid-lowering medicine include HMG-CoA reductase inhibitor (statins), niacin and its derivative, probucol and Bei Te Class etc..

The method for inhibiting the method for p110 α and treating fatty liver

The present invention provides the methods of the inhibition p110 α of external non-treatment row a kind of, such as can be to the liver cell body of culture Pharmaceutical composition of the present invention or inventive compound are added in system, to inhibit the expression quantity and/or activity of p110 α, especially It is the expression of p110 α.

And the present invention is demonstrated by experiment in vivo that miRNA-378 can be used to treat fatty liver (such as triglycerides liver Interior accumulation) method.

Further, since it is related to Partial tumors known to p110 α, therefore, based on miRNA-378 to the inhibition relationship of p110 α, The pharmaceutical composition for the treatment of p110 α associated tumors can be used to prepare using miRNA-378 as the inhibitor of p110 α.Another In preference, the p110 α associated tumors include colorectal cancer, gastric cancer, spongioblast cancer, breast cancer and lung cancer Deng.

Beneficial effect of the present invention

Present invention discover that the high expression miRNA-378 in liver, can specifically effectively inhibit p110 α, and can show The content of triglyceride reduced in liver is write, so as to using miRNA-378 as the new tool for the treatment of fatty liver.

Present invention will be further explained below with reference to specific examples.It should be understood that these embodiments are merely to illustrate the present invention Rather than it limits the scope of the invention.In the following examples, the experimental methods for specific conditions are not specified, usually according to conventional strip Part, such as Sambrook et al., molecular cloning: laboratory manual (New York:Cold Spring Harbor Laboratory Press, 1989) condition described in, or according to the normal condition proposed by manufacturer.Unless otherwise stated, no Then percentage and number are weight percent and parts by weight.

Universal method

A. mouse

It tests mouse C57BL/6J used and is purchased from Shanghai Si Laike experimental animal company, db/db, ob/ob and control mice Purchased from model organism research institute, Nanjing University.The raising of 22-23 DEG C of constant temperature of animal is in SPF grades of animal houses, 12 hours day-night cycles, with Chow diet raising.Using and operating for mouse in strict accordance with Chinese Academy of Sciences's nutrition institute's the care of animal and uses the regulation of the committee It carries out.Adenovirus mediated gene functional research is operated by tail vein injection.

B. the building of adenovirus

Adenovirus is overexpressed the AdEasy that system utilizes Statagene company^TMAdenoviral Vector System structure It builds.Expressed sequence is cloned in shuttle plasmid pShuttle-CMV or pAdTrack-CMV.Shuttle plasmid after PmeI is linearized, Into BJ5183 competent cell, this competence has been transferred to pAdEasy-1 plasmid in advance for conversion.By picking, small clone detects weight Group plasmid.Recombinant plasmid transfects 293A cell after PacI digestion, when CPE (cytopathic effect) occurs in 90% cell, receives Take cell and culture solution.3 releasing virus particles of freeze thawing, as P1 generation virus.

C. adenovirus packaging amplification

1) 293A cell is laid on 10-20 15cm culture dish, covers with to cell, and 0.5-1ml P1 generation virus is added in every ware；

2) after cell complete lesion, 1ml 10%NP40 lytic cell is added in every ware, is mixed, and is frozen in -80 DEG C；

3) room temperature is melted, and 4 DEG C, 12,500rcf, it is centrifuged 10min, collects supernatant；

4) PEG8000 (20%PEG8000,2.5M NaCl) of 1/2 supernatant volume is added, places 2 hours precipitating diseases on ice Poison；

5) 4 DEG C, 12,500rcf, it is centrifuged 20min, removes supernatant；

6) precipitating is resuspended in the CsCl solution (solvent 20mM Tris-HCl, pH8.0) that 10ml density is 1.1g/ml；

7) 4 DEG C, 8,000rcf, it is centrifuged 5min, retains supernatant；

8) it prepares CsCl gradient: the CsCl solution (solvent is same as above) of 2ml 1.4g/ml is first added, 3ml is then added The CsCl solution of 1.3g/ml adds 5ml viral suspension, 2ml atoleine；

9) SW41 rotor is used, 20 DEG C, 20,000rpm (60000g), is centrifuged 2 hours；

10) the blue and white virus band between 1.4g/ml and 1.3g/ml is collected into bag filter；

11) 4 DEG C of dialysed overnights.Elution buffer volume is at least 200 times of virus, and two not good liquors are changed in centre；Dialyzate:

A) 5% sucrose

B) 10mM Tris-HCl, pH8.0

c)2mM MgCl2

12) virus is dispensed after dialysing is stored in -80 DEG C of ultra low temperature freezers.

The extraction of d.RNA

1) for tissue sample, before extracting RNA, according to every 50-100mg tissue with 1ml Trizol reagent to tissue It is fully ground and is cracked.For cell sample, 1ml Trizol reagent is added in 3.5cm culture dish, and is blown and beaten repeatedly with rifle Or it acutely vibrates with lytic cell；

2) the Trizol lysate of above-mentioned tissue or cell is transferred in 1.5ml EP pipe, places 5min at room temperature；

3) in above-mentioned EP pipe, chloroform is added according to the amount that 0.2ml chloroform is added in every 1ml Trizol, firmly shakes in the hand 15sec is swung, after being placed at room temperature for 3min, with 10,000rcf, 4 DEG C of centrifugation 15min；

4) it carefully draws upper strata aqueous phase to be placed in new EP pipe, and adds the ratio of 0.5ml isopropanol according to every 1ml Trizol Isopropanol is added, mixes, is stored at room temperature 10min, 10,000rcf, 4 DEG C, is centrifuged 10min；

5) supernatant is abandoned, precipitating is retained, and the dosage of 75% ethyl alcohol of 1ml is added according to every 1ml Trizol, precipitating is carried out Washing, 7500rcf, are centrifuged 5min by 4 DEG C；

6) supernatant is abandoned, RNA is allowed to spontaneously dry at room temperature, RNA finally dry with RNase-free ddH2O dissolution；

7) electrophoresis detection RNA mass and concentration mensuration is carried out to RNA with spectrophotometer.

E. reverse transcription and real-time quantitative PCR

Reverse transcription reaction is transcribed using POLY-A system, and reaction condition is as follows

37 DEG C, 1h (reverse transcription reaction)；

85 DEG C, 5sec (reverse transcriptase inactivation reaction).

CDNA is used for Real Time PCR reaction template after diluting 10 times.

Prepare PCR reaction solution by following component (reaction solution is prepared to carry out on ice)

Carry out Real Time PCR reaction.

Two-step method PCR amplification standardization program:

Stage 1:50 DEG C, 2min, Reps:1；

Stage 2:95 DEG C, 10min, Reps:1.Heat start PCR polymerase；

Stage 3:95 DEG C 15sec；

60 DEG C of 1min, Reps:40.PCR reaction process；

Stage 4:95 DEG C 15sec；

60℃1min；

95 DEG C of 15sec, Reps:1.Melting curve process.

Analysis of experimental results: the amplification curve of Real Time PCR is confirmed after reaction.It is relatively fixed to be carried out using Δ Ct Amount.

F. immunoblotting assay (western blot)

1) extraction of cell and histone: collecting cell or a certain amount of mouse liver group is woven in and inhibits containing protease Agent, which is closed, to be cracked or is homogenized in the RIPA lysate of inhibitors of phosphatases.30min is placed on ice, and 14,000rpm, 4 DEG C are centrifuged 20 points Clock collects the gross protein that supernatant solution is cell or tissue；

RIPA lysate:

A) 50mM Tris-HCl, pH=7.4

b)150mM NaCl

c)1mM EDTA

D) 1%Triton x-100

E) protease inhibitors

F) inhibitors of phosphatases

2) sample preparation: after Bradford protein assay reagents measurement protein concentration, albumen is adjusted to same concentration.It is added Sample-loading buffer, and boiled 5 minutes in 100 DEG C, -80 DEG C or loading electrophoresis can be deposited in；

3) electrophoresis: configuring 10% sds page, with the protein content loading of each 40 μ g-80 μ g of sample. 140V constant pressure electrophoresis, until front end bromophenol blue runs out of glue bottom；

4) it transferring film: after pvdf membrane impregnates 1min with methanol, is then placed in transferring film liquid together with glue and balances 5min, then pressed It is placed according to anode-sponge-two layers of filter paper-pvdf membrane-glue-two layers of filter paper-sponge-cathode sequence, is put into wet film instrument of walking around In, transferring film instrument is embedded in ice, 300mA transferring film 3 hours；

5) it closes: taking out pvdf membrane, be put into Ponceaux dye liquor and dye, excess dyestuff is then washed with deionized water, see Transferring film effect is examined, and cuts film by corresponding position.5% skim milk is closed 1 hour；

6) primary antibody: being added the antibody for using 5%BSA appropriate dilutions, and 4 DEG C of horizontal shakers shake overnight；

7) wash film: recycling antibody washes film 3 times, every time 5 minutes with TBST；

8) secondary antibody: the diluted corresponding secondary antibody (1:3000) of 5% skim milk is added and is incubated at room temperature 1 hour；

9) it washes film: removing secondary antibody, film is washed 3 times, every time 5 minutes with TBST；

10) ECL develops the color, darkroom tabletting；

11) the Chemi-Doc Imaging system for the X- mating plate Bio-Rad company developed scans, while the system Quantitiy One analysis software to carry out gray scale to the band that scans quantitative.

G. the measurement of triglycerides

The measurement of triglycerides is measured using the TG detection kit of Wako company.

Embodiment 1 is overexpressed influence of the miR-378 to mouse liver TG content

Using universal method, miR-378 is overexpressed in mouse liver by adenovirus, qPCR miR-378 as the result is shown It is overexpressed more than 50 times (Fig. 1).

Liver TG content is measured, the results show that liver is after infecting miR-378, TG content is remarkably decreased；To liver Dirty progress H&E dyeing is dyed with oil red, is as a result also shown, after liver is overexpressed miR-378, can be reduced the TG content of liver.

2 miR-378 of embodiment influences liver TG content by targeting p110 α

2.1, by bioinformatic analysis, have screened the target protein of the potential miR-378 of dozens of, these target proteins can Adjusting of the miR-378 for liver TG can be taken part in.Then by western blot, detection hair is carried out to mouse liver albumen Existing, liver is after having infected miR-378, in those potential target proteins through screening, participates in the weight of hepatic insulin signal path Factor p110 α is wanted, protein level has most significant decline.

The sequence of 2.2 couples of p110 α is further studied, discovery in the 3 ' UTR sequences of p110 α exist one section and The site (Fig. 2 a) that possible miR-378 is combined.Then, the potential miR-378 in the 3 ' UTR sequences to p110 α is combined Site is cloned, and then by fluorescence experiments double in cell in vitro, discovery miR-378 can significantly inhibit p110 α -3 ' UTR Activity.Illustrate that miR-378 can be by this site direct regulation and control p110 α.

2.3 construct the adenovirus of the shRNA of p110 α, and as the result is shown after mouse liver infection sh-p110 α, liver TG contains Amount is also declined.Show that p110 α can be effectively reduced the TG content (Fig. 2 b) of liver.

And after the miR-378 binding site to p110 α -3 ' UTR is mutated, miR-378 for p110 α inhibition just It is not present.As a result as shown in Figure 4, wherein Fig. 4 a shows 3 ' UTR relative intensity of fluorescence of p110 α with miR-378 concentration It increases and weakens；Fig. 4 b shows one or two nucleosides when the miR-378 binding site being mutated in 3 ' UTR of p110 α After acid, no longer there is inhibiting effect for the 3 ' UTR of p110 α of mutation in miR-378.This just explains miR-378 well can be with By combining the specific site of p110 α, to inhibit the p110 α in liver and reduce the TG level of liver.

The improvement that 3 miR-378 of embodiment accumulates liver fat

It is overexpressed miR-378 in ob/ob mouse liver by adenovirus, the TG content of its liver can be effectively reduced (Fig. 3).Subsequent H&E and the result of oil red dyeing similarly meet previous result.To sum up show in ob/ob mouse liver It is overexpressed the lipopexia that miR-378 can be effectively improved liver.

It discusses

Insulin signaling pathway refers mainly to insulin and passes through activation insulin receptor, insulin receptor substrate, phosphatidyl-4 The signal transduction process of 3 kinases of alcohol and protein kinase B etc., for adjusting the horizontal important role of liver tg. Caused by the exception of liver tg built up often caused by hepatic insulin signal path.The present invention excavates out can To influence the microRNA of insulin signaling pathway key node, relatively sharp recognize to have to insulin signaling pathway Know, and provides potential target spot to treatment metabolic disease (type-2 diabetes mellitus, fatty liver etc.).

The invention demonstrates that miR-378 is the core element for regulating and controlling insulin signaling pathway in liver.When mouse liver crosses table When up to miR-378, mouse lipid metaboli stable state gets a promotion, and is mainly shown as that liver TG content declines.Wherein, miR-378 can be with By inhibiting the key protein p110 α of insulin signaling pathway to exercise its function.After mouse liver is overexpressed miR-378, hair Existing p110 α protein level is decreased obviously.Then we construct the adenovirus of sh-p110 α, after infecting mouse liver, still So show as the decline of liver TG content.

And previous conclusion is demonstrated in ob/ob mouse.Being overexpressed miR-378 into ob/ob mouse liver can be bright The aobvious content for reducing liver TG significantly improves its liver fat accumulation situation.

The result shows that inhibiting the expression of p110 α that can become a kind of new treatment by being overexpressed miR-378 in liver The strategy of liver lipids accumulation.Currently, having carried out for the clinical treatment of microRNA, it is believed that miR-378 future can be at For a kind of potential target spot for treating fatty liver.

All references mentioned in the present invention is incorporated herein by reference, independent just as each document It is incorporated as with reference to such.In addition, it should also be understood that, after reading the above teachings of the present invention, those skilled in the art can To make various changes or modifications to the present invention, such equivalent forms equally fall within model defined by the application the appended claims It encloses.

Claims

1. a kind of purposes of active constituent, which is characterized in that the active constituent is selected from the group:

(a) sequence of .miRNA-378, the miRNA-378 are as shown in SEQ ID NO.:1；

(c) polynucleotides, the polynucleotides can form precursor miRNA described in (b) by host transcription, and process shape At the miRNA-378 described in (a)；

(d) expression vector, the expression vector contain miRNA-378 described in (a) or (b) described in precursor miRNA, Or (c) described in polynucleotides；

Wherein, the active constituent is used for:

(ii) preparation treatment fatty liver；And/or inhibit the pharmaceutical composition of triglycerides accumulation in liver.

2. purposes as described in claim 1, which is characterized in that the pharmaceutical composition includes the active constituent and medicine Acceptable carrier on.

3. purposes as described in claim 1, which is characterized in that it is related that the miRNA-378 is also used to prepare treatment p110 α Tumour.

4. purposes as described in claim 1, which is characterized in that the pharmaceutical composition also contains additional p110 α and inhibits Agent.

5. purposes as described in claim 1, which is characterized in that the pharmaceutical composition further includes optional lipid-lowering medicine.

6. purposes as claimed in claim 5, which is characterized in that the lipid-lowering medicine include: HMG-CoA reductase inhibitor, Niacin and its derivative, probucol and fibrates.

7. purposes as described in claim 1, which is characterized in that the nucleotide sequence of the precursor miRNA described in (b) such as SEQ ID Shown in NO.:2.

8. purposes as described in claim 1, which is characterized in that the polynucleotides described in (c) have structure shown in Formula II:

Seq_{It is positive}-X-Seq_Reversely

Formula II,

In Formula II,

Seq is reversed the nucleotide sequence with Seq forward direction complete complementary；

X be positioned at Seq is positive and Seq it is reversed between intervening sequence, and the intervening sequence and Seq forward direction and Seq are reversed It is not complementary；

9. purposes as described in claim 1, which is characterized in that the expression vector described in (d) includes: viral vectors and non-disease Poisonous carrier.

10. a kind of method that screening promotes miRNA-378 candidate compound, which is characterized in that comprising steps of

(a) cell culture system of candidate compound will be added as experimental group；The cell culture of candidate compound will be added without System is as a control group；

Wherein, when in test group the expression quantity of p110 α albumen and/or activity be significantly higher than control group, then show the candidate compound Object is the substance for promoting miRNA-378.

11. method as claimed in claim 10, which is characterized in that the cell is liver cell.

12. method as claimed in claim 10, which is characterized in that in step (b) further include:

The further inhibiting effect that the obtained compound of test accumulates triglycerides in liver cell in experimental group or control group；

Wherein, when triglycerides accumulation substantially less than control group in the liver cell in experimental group, then show the candidate compound For the substance for treating fatty liver.

13. the inhibition p110 alpha expression amount and/or activity of a kind of external non-therapeutic；And/or triglycerides in liver cell is inhibited to store Long-pending method, which is characterized in that comprising steps of

MiRNA-378 is added into cell culture system, to inhibit p110 alpha expression amount and/or activity；And/or inhibit liver thin The accumulation of three ester of intracellular glycerol.