CN105603105A - Molecular method for determining virulence of phytophthora sojae on disease-resistant gene Rps3a(Chapman) - Google Patents
Molecular method for determining virulence of phytophthora sojae on disease-resistant gene Rps3a(Chapman) Download PDFInfo
- Publication number
- CN105603105A CN105603105A CN201610151245.3A CN201610151245A CN105603105A CN 105603105 A CN105603105 A CN 105603105A CN 201610151245 A CN201610151245 A CN 201610151245A CN 105603105 A CN105603105 A CN 105603105A
- Authority
- CN
- China
- Prior art keywords
- enzyme
- dna
- gene
- chapman
- phytophthora
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Genetics & Genomics (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Botany (AREA)
- Mycology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a molecular method for determining virulence of phytophthora sojae on a disease-resistant gene (i)Rps3a(/i)(Chapman), comprising the steps: extracting genome DNA of phytophthora sojae to be detected, carrying out PCR amplification to obtain a DNA fragment containing avirulence gene(i)Avr3a(/i), carrying out enzyme digestion with restriction enzyme (i)Bpu(/i)10I, carrying out agarose gel electrophoresis on the enzyme digestion product to obtain an agarose gel electrophoretogram of the enzyme digestion product; and observing the agarose gel electrophoretogram of the enzyme digestion product, if 2 DNA bands exist in a 250bp-500bp range, the corresponding phytophthora sojae strain to be detected is an avirulent strain, and if 1 DNA band exists under 750bp in the electrophoretogram after enzyme digestion, the corresponding phytophthora sojae strain to be detected is a virulent strain. The method has the advantages of short determination cycle, no intermediate type, accuracy and reliability, and can determine with a high flux reactor the virulence of phytophthora sojae on the disease-resistant gene (i)Rps3a(/i)(Chapman).
Description
Technical field
The present invention relates to a kind of molecular assay method, relate in particular to a kind of soyabean phytophthora enantiopathy gene Rps3a that measures(Chapman) molecular method of toxicity.
Background technology
Soyabean phytophthora infect root rot that soybean causes be in world wide, threaten Soybean production Major Diseases itOne. Root rot was found in the Indiana State of the U.S. first in 1948, then in all phases of major country of production of soybeanSecondary has showed this disease. China 1989 by Shen Chong Yao and Su Yanchun first northeastward soybean main producing region be separated to soybean phytophthoraBacterium, afterwards in Heilongjiang Province, Jilin Province and Beijing also find that there is soyabean phytophthora, in recent years Shandong, Anhui, river in successionThe also phases of 15 provinces (urban district) such as south, Jiangsu, Zhejiang, the Inner Mongol, Hubei, Fujian, Xinjiang, Sichuan, Tianjin and GuizhouContinuing is in the news separates and identifies soyabean phytophthora. Wherein comparatively serious in Heilungkiang and the generation of Fujian two provinces, be still at present China heavyThe external quarantine object of wanting.
The evolutionary rate of soyabean phytophthora is very fast, and Physiological Race Differentiation is very complicated, and the U.S. has identified 55 lifes at presentReason microspecies and Geng Duo formally do not name the pathological form of biological strain; China found No. 1, No. 3, No. 8, No. 9, No. 11,10 biological strains such as No. 15, No. 17, No. 21, No. 24, the dominant races that wherein No. 1 biological strain is Heilongjiang Province,Also identify a large amount of pathological forms of not naming biological strain simultaneously.
At present the effective method of control soybean phytophthora root rot is plantation disease-resistant variety, and wants accurately to use soybean disease-resistantIt (is biological strain that kind just needs the toxicity composition of soyabean phytophthora clearly to be detected (soyabean phytophthora that designated area separates)Composition); And at present the mensuration of biological strain mainly adopt with 14 disease-resistant genes (Rps1a, Rps1b, Rps1c, Rps1d,Rps1k, Rps2, Rps3a, Rps3b, Rps3c, Rps4, Rps5, Rps6, Rps7 and Rps8) a set of NIL differentiate and postMain carry out the inoculation of hypocotyl wound and measure, although the method is simple, determination period is long, working strength greatly, easily occurIntermediate form, is not suitable for high-throughout Race Identification; Therefore seeking one can be fast, accurately, high throughput assay soybeanThe method of phytophthora toxicity composition is this area technical problem urgently to be resolved hurrily.
Common practise related to the present invention: common practise (1): pathogen carries nontoxic gene or virulent gene,Differential host carries disease-resistant gene or susceptible gene, and wherein nontoxic gene and virulent gene are pair of alleles, disease-resistant geneWith susceptible gene be pair of alleles; When the discriminating that carries the pathogen infection of nontoxic gene and carry corresponding disease-resistant gene is postedWhen main, it is disease-resistant that disease-resistant gene and nontoxic gene show as differential host mutually; When the pathogen infection that carries nontoxic gene is takenDuring with the differential host of susceptible gene, differential host shows as susceptible; When the pathogen infection discriminating that carries virulent gene is postedWhen main, no matter whether differential host carries disease-resistant gene, all show as susceptible. Common practise (2): for nontoxic gene withThe name of disease-resistant gene, normally first names in the world nontoxic gene, and can mutually differential host be shown as with nontoxic geneDisease-resistant unnamed gene is corresponding disease-resistant gene; May exist in theory multiple disease-resistant genes and same nontoxic gene mutualSituation about doing, and in fact also really so, for example, think nontoxic gene Avr4 and Avr6 in soybean phytophthora in the world at firstRespectively with soybean in disease-resistant gene Rps4 and Rps6 do mutually, but further research find Avr4 and Avr6 be actually withA gene, is renamed as Avr4/6, and disease-resistant gene Rps4 and Rps6 all can do mutually with nontoxic gene Avr4/6, identify respectively nothingThe different parts of virus gene Avr4/6 causes disease resistance response, is analyzed by common practise (2), may exist in theory multipleDisease-resistant gene and nontoxic gene Avr3a do mutually, and the disease-resistant gene Rps3a that derives from different disease-resistant materials may be complete differenceDisease-resistant gene.
Summary of the invention
The object of the present invention is to provide a kind of soyabean phytophthora enantiopathy gene Rps3a (Chapman) of mensuration toxicityMolecular method; The present invention measure soyabean phytophthora enantiopathy gene Rps3a toxicity for disease-resistant gene Rps3a be differentiate postDisease-resistant gene Rps3a in main Chapman, the method determination period is short, without intermediate form, accurately and reliably, can high pass measureDetermine the toxicity of soyabean phytophthora enantiopathy gene Rps3a (Chapman); For quick, accurate, high throughput assay soybean phytophthoraMushroom toxin composition is laid a good foundation.
For solving the problems of the technologies described above, the technical solution adopted in the present invention is: a kind of soyabean phytophthora enantiopathy of measuringThe molecular method of gene Rps3a (Chapman) toxicity, comprises the following steps:
Step 1, extract the genomic DNA of soyabean phytophthora to be detected;
Step 2, design Auele Specific Primer AVR3A1F/AVR3A1R, taking the genomic DNA that extracts as masterplate, carry out PCRAmplification, amplifies the DNA fragmentation that contains complete nontoxic gene Avr3a; Described Auele Specific Primer AVR3A1F/AVR3A1RBase sequence be:
AVR3A1F:5 ˊ-ATCGAAGCCATATATCTACAGG-3 ˊ (as the sequence 1 in sequence table);
AVR3A1R:5 ˊ-CCTACTGTATGCAAAGTGATCG-3 ˊ (as the sequence 2 in sequence table);
Step 3, cut with restriction enzyme Bpu10I enzyme the DNA fragmentation amplifying, obtain enzyme and cut product;
Step 4, enzyme is cut to product carry out agarose gel electrophoresis, obtain enzyme and cut the agarose gel electrophoresis figure of product; Observe enzyme and cut productThing agarose gel electrophoresis figure, if there are 2 DNA bands within the scope of 250bp-500bp, corresponding soybean to be detectedPhytophthora bacterial strain is avirulent strains; Below 750bp, have 1 DNA band if enzyme is cut rear electrophoresis figure, correspondence is to be checkedSurveying soybean phytophthora bacteria strain is toxic strain.
Further, the method for extracting soyabean phytophthora genomic DNA to be detected described in step 1 is CTAB method.
Further, described CTAB method is extracted the concrete steps of soyabean phytophthora genomic DNA to be detected and is:
(1) cut 10-20 piece diameter 2 × 2mm mycelia piece from the soyabean phytophthora colony edge to be detected of cultivating 5-7 days, move intoBe equipped with in the triangular flask of 10%V8 fluid nutrient medium of 100ml clarification, be placed under 25 DEG C of dark conditions, 120r/min concussionCultivate 5-7 days, cultured mycelium filters and collects with sterilizing double gauze, and distilled water flushing 1 time fills after freeze dryingDivide and smash into hypha powder to pieces;
(2) hypha powder of getting 50mg, in 1.5mlEP pipe, adds the CTAB extract and 90 that 900 μ l mass concentrations are 2%After the SDS aqueous solution that μ l mass concentration is 10%, on eddy mixer, fully mix;
(3) 55-60 DEG C of water-bath 1h, every 15min vibration mixes once;
(4) the centrifugal 10min of 12000r/min, gets supernatant A, adds phenol, chloroform and isoamyl alcohol three's mixture extracting 1Inferior, in phenol, chloroform and the isoamyl alcohol three's who adds mixture, the weight ratio of phenol, chloroform and isoamyl alcohol is25:24:1, the volume of phenol, chloroform and isoamyl alcohol three mixture equates with the volume of supernatant A;
(5) the centrifugal 10min of 12000r/min, draws supernatant B, adds chloroform extracting 1 time, add the volume of chloroform and upperThe volume of clear liquid B equates;
(6) the centrifugal 10min of 12000r/min, draws supernatant C, adds the NaAc aqueous solution and the ice absolute ethyl alcohol mistake of 3mol/LPrecipitate genomic DNA night, to add the volume ratio of the NaAc aqueous solution and ice absolute ethyl alcohol and supernatant C be 0.1:2:1;
(7) ethanol water that is 70% by the volume ratio of precooling washing twice, is then placed under 37 DEG C of conditions dry;
(8) dried DNA contains the ddH of 50 μ g/ml ribalgilases with 100 μ l2O dissolves, and after 37 DEG C of standing 1h, putsFor subsequent use in-20 DEG C of refrigerators.
Further, the amplification system of described pcr amplification and amplification condition are respectively:
Amplification system: dilute the PCR reaction buffer of 10 times, 2.5 μ l; The MgCl of 2.5mmol/L2，1.5μl；2.5mmol/LDNTPs, 0.5 μ l; The TaqDNA polymerase of 5U/ μ l, 0.2 μ l; The Auele Specific Primer AVR3A1F of 10 μ mol/LWith the each 0.5 μ l of AVR3A1R; Template DNA, 0.5 μ l; Add aseptic ultra-pure water to 25 μ l;
Amplification condition: 95 DEG C of sex change 30S, 60 DEG C of annealing 30S, 72 DEG C are extended 30S, 30 circulations, 72 DEG C are extended 5min.
Further, the DNA fragmentation that described in step 2, pcr amplification goes out is used AxyPrepDNA gel before enzyme is cutRecovery kit reclaims; The enzyme that described in step 3, enzyme is cut cuts system and enzyme tangent condition is respectively:
Enzyme is cut system: dilute the enzyme cutting buffering liquid of 10 times, 2 μ l; The Bpu10I enzyme of 5U/ μ l, 0.5 μ l; Use AxyPrepDNAGel reclaims the DNA fragmentation that kit reclaims, 6 μ l; Add ddH2O to 20 μ l;
Enzyme tangent condition: 37 DEG C of incubation 1.5h, then 80 DEG C of incubation 20min inactivations.
Further, the condition of described agarose gel electrophoresis is: 1% Ago-Gel, electrophoresis under 120V voltage30min, with 0.5 μ g/ml ethidium bromide solution dyeing, takes a picture with Bio-rad gel imaging system under uviol lamp.
Beneficial effect: the invention provides a kind of for measuring soyabean phytophthora enantiopathy gene Rps3a (Chapman)The molecular method of toxicity, the Auele Specific Primer AVR3A1F/AVR3A1R of the present invention's design can specific and masterplate DNAThe upstream and downstream of nontoxic gene Avr3a combines, thereby amplifies the DNA fragmentation that contains complete nontoxic gene Avr3a,And in the DNA fragmentation amplifying, the unnecessary base quantity in nontoxic gene Avr3a two ends is comparatively reasonable, has both saved PCRThe required base that increases, can make again follow-up electrophoretic effects more obvious; The present invention cuts by restriction enzyme Bpu10I enzymeThe nontoxic gene Avr3a of soyabean phytophthora to be detected carrys out indirect determination soyabean phytophthora enantiopathy to be detected gene Rps3a(Chapman) toxicity, its determination period is short, without intermediate form, accurately and reliably, can high throughput assay soyabean phytophthora pairThe toxicity of disease-resistant gene Rps3a (Chapman), for biological strain a large amount of, quick and precise Identification soyabean phytophthora providesProvide powerful support for; The present invention carries out agarose gel electrophoresis and judges whether being limited property of nontoxic gene Avr3a by enzyme being cut to productRestriction endonuclease Bpu10I cuts, electrophoretogram be 2 DNA bands be obviously two sections of digested one-tenth, be avirulent strains.
Figure of description
The DNA fragmentation that the soyabean phytophthora genomic DNA to be detected of 5 strain shown in Fig. 1, embodiment amplifies is limitedProperty the restriction endonuclease Bpu10I enzyme agarose gel electrophoresis figure before and after cutting, before a figure represents that enzyme is cut, after b figure represents that enzyme is cut;
Nontoxic gene Avr3a in the DNA fragmentation that the soyabean phytophthora genomic DNA to be detected of 5 strain shown in Fig. 2, embodiment amplifiesGene order to restriction enzyme site figure when; In figure: point represents that base is identical with I row base, and short-term represents and I row phaseThan base deletion has occurred;
Being limited property of the DNA fragmentation restriction endonuclease Bpu10I enzyme that in Fig. 3, test, 16 strain soyabean phytophthora genomic DNAs amplify is cutAfter agarose gel electrophoresis figure;
In Fig. 1-Fig. 3: A represents avirulent strains, V represents toxic strain; I represents bacterial strain Ps0702, and II represents bacterial strainPs0301, III represents bacterial strain Ps0705, and IV represents bacterial strain Ps0903, and V represents bacterial strain Ps0302.
Detailed description of the invention
Below in conjunction with specific embodiment, the present invention is further detailed explanation.
Embodiment
5 strain soyabean phytophthora to be detected: bacterial strain Ps0702 (separating for 2007), bacterial strain Ps0301 (separating for 2003), bacterial strainPs0705 (separating for 2007), bacterial strain Ps0903 (separating for 2009), bacterial strain Ps0302 (separating for 2003), these bacteriumStrain is and adopts Soybean Leaves dish mass trapping to separate from Chinese soyabean field, then separates and carries out purifying through monospore, transfer inOn 10%V8 slant medium, at 12 DEG C, preserve, described 10%V8 slant medium refers to, at 100mL with after filtered through gauzeV8 vegetable juice in, add 0.2g calcium carbonate and 15g agar powder, adding distil water complements to 1000mL, heating make agar completeFull thawing, is then divided in triangular flask 121 DEG C of sterilizing 20min;
A kind of molecular method of measuring soyabean phytophthora enantiopathy gene Rps3a (Chapman) toxicity is to be detected large to 5 strains respectivelyBeans phytophthora bacterial strain is measured, and concrete assay method comprises the following steps:
Step 1, adopt CTAB method to extract the genomic DNA of soyabean phytophthora, the concrete operations of extracting genomic DNA asUnder:
(1) cut 10-20 piece diameter 2 × 2mm mycelia piece from the soyabean phytophthora colony edge to be detected of cultivating 5-7 days, move intoThe 10%V8 fluid nutrient medium of 100ml clarification is housed, and (10%V8 fluid nutrient medium refers to the V8 vegetables with 10 times of distilled water dilutingsDish juice, V8 vegetable juice is the tinned drink that Campbell company of the U.S. produces, by tomato juice, carrot juice, Celery Juice, Europe8 kinds of vegetable juice compositions of celery juice, beet juice, lettuce juice, green water cress juice and spinach juice) triangular flask in, be placed in 25 DEG C of darkUnder condition, 120r/min concussion cultivates 5-7 days, cultured mycelium filters and collects with sterilizing double gauze, distilled water flushing1 time, after freeze drying, fully smash into hypha powder to pieces;
(2) hypha powder of getting 50mg, in 1.5mlEP pipe, adds the CTAB extract that 900 μ l mass concentrations are 2%(CTAB is softex kw, and the CTAB extract that mass concentration is 2% is that the CTAB of 100ml extractsIn liquid, contain the CTAB of 2g, surplus is water) and the 90 μ l mass concentrations SDS aqueous solution that is 10% (SDS is dodecaneBase benzene sulfonic acid sodium salt; 10% the SDS aqueous solution is that the SDS of 10g is soluble in water, is settled to 100ml) after on eddy mixerFully mix;
(3) 55-60 DEG C of water-bath 1h, every 15min vibration mixes once;
(4) the centrifugal 10min of 12000r/min, gets supernatant A, adds phenol, chloroform and isoamyl alcohol three's mixture extracting 1Inferior, in phenol, chloroform and the isoamyl alcohol three's who adds mixture, the weight ratio of phenol, chloroform and isoamyl alcohol is25:24:1, the volume of phenol, chloroform and isoamyl alcohol three mixture equates with the volume of supernatant A;
(5) the centrifugal 10min of 12000r/min, draws supernatant B, adds chloroform extracting 1 time, add the volume of chloroform and upperThe volume of clear liquid B equates;
(6) the centrifugal 10min of 12000r/min, draws supernatant C, adds the NaAc aqueous solution and the ice absolute ethyl alcohol mistake of 3mol/LPrecipitate genomic DNA night, to add the volume ratio of the NaAc aqueous solution and ice absolute ethyl alcohol and supernatant C be 0.1:2:1;
(7) ethanol water that is 70% by the volume ratio of precooling washing twice, is then placed under 37 DEG C of conditions dry;
(8) dried DNA contains the ddH of 50 μ g/ml ribalgilases with 100 μ l2O dissolves, and after 37 DEG C of standing 1h, putsFor subsequent use in-20 DEG C of refrigerators;
Step 2, design Auele Specific Primer AVR3A1F/AVR3A1R, taking the genomic DNA that extracts as masterplate, carry out PCRAmplification, reclaims kit with AxyPrepDNA gel and reclaims, and obtains the DNA fragmentation that contains complete nontoxic gene Avr3a(DNA fragmentation amplifying comprises nontoxic gene Avr3a and upstream and downstream base thereof, and the length of described DNA fragmentation approximately700bp, wherein, the gene order of nontoxic gene Avr3a in bacterial strain Ps0702, Ps0301, Ps0705, Ps0903 and Ps0302Sequence 3, sequence 4, sequence 5, sequence 6 and sequence 7 in leu time corresponding sequence table);
The sequence of described Auele Specific Primer AVR3A1F/AVR3A1R is:
AVR3A1F：5ˊ-ATCGAAGCCATATATCTACAGG-3ˊ；
AVR3A1R：5ˊ-CCTACTGTATGCAAAGTGATCG-3ˊ；
System and the condition of described pcr amplification are respectively:
Amplification system: dilute the PCR reaction buffer of 10 times, 2.5 μ l; The MgCl2 of 2.5mmol/L, 1.5 μ l;The dNTPs of 2.5mmol/L, 0.5 μ l; The TaqDNA polymerase of 5U/ μ l, 0.2 μ l; The specificity of 10 μ mol/L is drawnThe each 0.5 μ l of thing AVR3A1F and AVR3A1R; Template DNA, 0.5 μ l; Add aseptic ultra-pure water to 25 μ l;
Amplification condition: 95 DEG C of sex change 30S, 60 DEG C of annealing 30S, 72 DEG C are extended 30S, 30 circulations, 72 DEG C are extended 5min;
Step 3, with restriction enzyme Bpu10I enzyme cut with AxyPrepDNA gel reclaim kit reclaim the DNA sheet obtainingSection, obtains enzyme and cuts product; Enzyme cuts system and enzyme tangent condition is:
Enzyme is cut system: dilute NEB buffer solution 3, the 2 μ l of 10 times; The Bpu10I enzyme of 5U/ μ l, 0.5 μ l; Use AxyPrepDNA gel reclaims kit and reclaims the DNA fragmentation obtaining, 6 μ l; Add ddH2O to 20 μ l;
Enzyme tangent condition: 37 DEG C of incubation 1.5h, then 80 DEG C of incubation 20min inactivations;
Step 4, enzyme is cut to product carry out agarose gel electrophoresis, deposition condition: 1% Ago-Gel (is the TAE of every 100mlOr in tbe buffer liquid, add 1g agar Icing Sugar), electrophoresis 30min under 120V voltage, with 0.5 μ g/ml ethidium bromide solutionDyeing, takes a picture with Bio-rad gel imaging system under uviol lamp;
Agarose gel electrophoresis figure after above step obtains nontoxic gene Avr3a enzyme that 5 strain soyabean phytophthoras are corresponding and cuts; As Fig. 1Shown in, the nontoxic gene Avr3a enzyme that bacterial strain Ps0702 and Ps0301 are corresponding has 2 after cutting within the scope of 250bp-500bpDNA band, therefore bacterial strain Ps0702 and Ps0301 are that avirulent strains (can make to carry the differential host of disease-resistant gene Rps3aChapman produce disease resistance response and show disease-resistant); The nontoxic gene Avr3a that bacterial strain Ps0705, Ps0903 and Ps0302 are correspondingEnzyme has 1 DNA band below 750bp after cutting, therefore bacterial strain Ps0705, Ps0903 and Ps0302 are toxic strain(the differential host Chapman that can not make to carry disease-resistant gene Rps3a produce disease resistance response and show as susceptible).
Test
Adopt hypocotyl wound inocalation method measure 16 strain soybean phytophthora bacterial strains to differential host Chapman (only with disease-resistant geneRps3a) pathogenic (being the toxicity of enantiopathy gene Rps3a), 16 strain soybean phytophthora bacterial strains are and adopt Soybean Leaves dish to lureLaws on arrests separates from Chinese soyabean field, then separates and carries out purifying through monospore, transfers on 10%V8 slant mediumAt 12 DEG C, preserve described 16 strain soybean phytophthora bacterial strains and separate the time in table 1:
This test of table 1 16 strain soybean phytophthora bacterial strains used
The fritter that the soybean phytophthora bacterial strain of cultivating on V8 culture medium flat plate 7 days is cut into 2mm × 3mm is as inoculum; By solutionCut open cutter 1cm place under the plantation soybean seedling cotyledon of 7 days and draw the long wound of about 0.5cm downwards, then inoculum mycelia is facedInside be attached to wound. Moisturizing 12h after inoculation, then puts into 24-28 DEG C, the greenhouse of 14h illumination/10h dark, within 5 days, adjusts afterwardsFruit comes to an end. Taking Williams (not being with any disease-resistant gene) as susceptible contrast, each differential host inoculates 10 strains, with plantThe death rate is as the criteria for classification of anti-sense, and the plant death rate≤30%, is designated as disease-resistant; The plant death rate >=70%, is designated as senseSick; The plant death rate, between 30%-70%, is designated as intermediate form, and test repeats 2 times, and the disease resistance response of each bacterial strain is in Table1；
Respectively above-mentioned 16 strain soybean phytophthora bacterial strains are carried out as the step in embodiment, extract genomic DNA, pcr amplification, restrictionProperty endonuclease digestion, agarose gel electrophoresis, obtain agarose gel electrophoresis figure, as shown in Figure 3.
The knot that the method for more above-mentioned two kinds of mensuration soyabean phytophthora enantiopathy gene Rps3a (Chapman) toxicity is measuredReally, result shows that the result of above-mentioned two kinds of assay methods mensuration is identical, illustrates that molecular assay method provided by the invention is trueReliably real.
SEQUENCELISTING
<110>University Of Science and Technology Of He'nan
<120>a kind of soyabean phytophthora enantiopathy gene Rps3a(Chapman that measures) molecular method of toxicity
<130>1
<160>7
<170>PatentInversion3.3
<210>1
<211>22
<212>DNA
<213>artificial sequence
<400>1
atcgaagccatatatctacagg22
<210>2
<211>22
<212>DNA
<213>artificial sequence
<400>2
cctactgtatgcaaagtgatcg22
<210>3
<211>336
<212>DNA
<213>soyabean phytophthora
<400>3
atgcgcctcgctcaagttgtggtcgtcatcgctgcttccttcctggttgccactgacgct60
ctttcgaccacgaacgcaaaccaggccaagatcatcaaaggaacgtcgcccggtggccac120
agcccacgacttctgagggcctaccaacctgatgatgaaggcgattcccccgaagatagg180
acgctgtcgaaagctcaggtgacaaaaatccttaacaaactaggcaaagatgtcacctgg240
gaccacgtcatgcggaacccggctttgttccaaagataccagaagaaggctaacaagatc300
attgagaagcaaaaggcagcagcgaaaaacgcgtag336
<210>4
<211>330
<212>DNA
<213>soyabean phytophthora
<400>4
atgcgcctcgctcaagttgtggtcgtcatcgctgcttccttcctggttgccactgacgct60
ctttcgaccacgaacgcaaaccaggccaagatcatcaaaggaacgtcgcccggtggccac120
agcccacgacttctgagggcctaccaacctgatgatgaaggcgattcccccgaagatagg180
acgctgtcgaaagctcaggtgacaaaaatccttaacaaactaggcgtcacctggggcgac240
gtcatgcggaacccggctttgttccaacgttaccagaagaaggctaacaagatcattgag300
aagcaaaaggcagcagcgaaaaacgcgtag330
<210>5
<211>336
<212>DNA
<213>soyabean phytophthora
<400>5
atgcgcctcgctcaagttgtggtcgtcatcgctgcttccttcctggttgccactgacgct60
ctttcgaccacgaacgcaaaccaggccaagatcatcaaaggaacgtcgcccggtggccac120
agcccacgacttctgagggcctaccaacctgatgatgaaggcgattcccccgaagatagg180
acgctgtcgccttctcaggtgacaaaaatccttaacaaactaggcaaagatgtcacctgg240
gaccacgtcatgcggaacccggctttgttccaaagataccagaagaaggctaacaagatc300
attgagaagcaaaaggcagcagcgaaaaacgcgtag336
<210>6
<211>336
<212>DNA
<213>soyabean phytophthora
<400>6
atgcgcctcgctcaagttgtggtcgtcatcgctgcttccttcctggttgccactgacgct60
ctttcgaccacgaacgcaaaccaggccaagatcatcaaaggaacgtcgcccggtggccac120
agcccacgacttctgagggcctaccaacctgatgatgaaggcgattcccccgaagatagg180
acgctgtcgccttctcaggtgacaaaaatccttaagaaactaggcaaaggcgtcacctgg240
gacgacgtcatgcgggacccggctttgttccaaagttaccagaagaaggctaacaagatc300
attgagaagcaaaaggcagcagcgaaaaacgcgtag336
<210>7
<211>330
<212>DNA
<213>soyabean phytophthora
<400>7
atgcgcctcgttcaagttgtggtcgtcaccgctgcttccttcctggttgccactgacgct60
ctttcgaccacgaacgcaaaccaggccaagatcatcaaaggaacgtcgcccggtggccac120
agcccacgacttctgagggcctaccaacctgatgatgaaggcgattcccccgaagaaagg180
acgctgccgaattctcaggtggcaaaaatccttaacaaactaggcgtcacctgggacgac240
gtcctgcgggactcggctttgttcgaaaggtaccaggagaaggctaacaagatcattgag300
aagcaaaaggcagcagcgaacaacgcgaag330
Claims (6)
1. measure soyabean phytophthora enantiopathy gene for one kindRps3a(Chapman) molecular method of toxicity, is characterized in that: comprise the following steps:
Step 1, extract the genomic DNA of soyabean phytophthora to be detected;
Step 2, design Auele Specific Primer AVR3A1F/AVR3A1R, taking the genomic DNA that extracts as masterplate, carry out pcr amplification, amplifies and contain complete nontoxic geneAvr3aDNA fragmentation; The base sequence of described Auele Specific Primer AVR3A1F/AVR3A1R is:
AVR3A1F：5ˊ-ATCGAAGCCATATATCTACAGG-3ˊ；
AVR3A1R：5ˊ-CCTACTGTATGCAAAGTGATCG-3ˊ；
Step 3, use restriction enzymeBpu10I enzyme is cut the DNA fragmentation amplifying, and obtains enzyme and cuts product;
Step 4, enzyme is cut to product carry out agarose gel electrophoresis, obtain enzyme and cut the agarose gel electrophoresis figure of product; Observe enzyme and cut product agarose gel electrophoresis figure, if there are 2 DNA bands within the scope of 250bp-500bp, corresponding soybean phytophthora bacteria strain to be detected is avirulent strains; If enzyme has 1 DNA band below 750bp after cutting, corresponding soybean phytophthora bacteria strain to be detected is toxic strain.
2. a kind of soyabean phytophthora enantiopathy gene of measuring according to claim 1Rps3a(Chapman) molecular method of toxicity, is characterized in that: the method for extracting soyabean phytophthora genomic DNA to be detected described in step 1 is CTAB method.
3. a kind of soyabean phytophthora enantiopathy gene of measuring according to claim 2Rps3a(Chapman) molecular method of toxicity, is characterized in that: the concrete steps that described CTAB method is extracted soyabean phytophthora genomic DNA to be detected are:
(1) cut 10-20 piece diameter 2 × 2mm mycelia piece from the soyabean phytophthora colony edge to be detected of cultivating 5-7 days, immigration is equipped with in the triangular flask of 10%V8 fluid nutrient medium of 100ml clarification, be placed under 25 DEG C of dark conditions, 120r/min concussion cultivates 5-7 days, cultured mycelium filters and collects with sterilizing double gauze, distilled water flushing 1 time is fully smashed into hypha powder to pieces after freeze drying;
(2) hypha powder of getting 50mg, in 1.5mlEP pipe, adds after the SDS aqueous solution that CTAB extract that 900 μ l mass concentrations are 2% and 90 μ l mass concentrations are 10% and fully mixes on eddy mixer;
(3) 55-60 DEG C of water-bath 1h, every 15min vibration mixes once;
(4) the centrifugal 10min of 12000r/min, get supernatant A, add phenol, chloroform and isoamyl alcohol three's mixture extracting 1 time, in phenol, chloroform and the isoamyl alcohol three's who adds mixture, the weight ratio of phenol, chloroform and isoamyl alcohol is 25:24:1, and the volume of phenol, chloroform and isoamyl alcohol three mixture equates with the volume of supernatant A;
(5) the centrifugal 10min of 12000r/min, draws supernatant B, adds chloroform extracting 1 time, add the volume of chloroform to equate with the volume of supernatant B;
(6) the centrifugal 10min of 12000r/min, draws supernatant C, adds the NaAc aqueous solution of 3mol/L and the ice absolute ethyl alcohol precipitation genomic DNA that spends the night, to add the volume ratio of the NaAc aqueous solution and ice absolute ethyl alcohol and supernatant C be 0.1:2:1;
(7) ethanol water that is 70% by the volume ratio of precooling washing twice, is then placed under 37 DEG C of conditions dry;
(8) dried DNA contains the ddH of 50 μ g/ml ribalgilases with 100 μ l2O dissolves, and after 37 DEG C of standing 1h, is placed in-20 DEG C of refrigerators for subsequent use.
4. a kind of soyabean phytophthora enantiopathy gene of measuring according to claim 1Rps3a(Chapman) molecular method of toxicity, is characterized in that: amplification system and the amplification condition of described pcr amplification are respectively:
Amplification system: dilute the PCR reaction buffer of 10 times, 2.5 μ l; The MgCl of 2.5mmol/L2, 1.5 μ l; The dNTPs of 2.5mmol/L, 0.5 μ l; The TaqDNA polymerase of 5U/ μ l, 0.2 μ l; The each 0.5 μ l of the Auele Specific Primer AVR3A1F of 10 μ mol/L and AVR3A1R; Template DNA, 0.5 μ l; Add aseptic ultra-pure water to 25 μ l;
Amplification condition: 95 DEG C of sex change 30S, 60 DEG C of annealing 30S, 72 DEG C are extended 30S, 30 circulations, 72 DEG C are extended 5min.
5. a kind of soyabean phytophthora enantiopathy gene of measuring according to claim 1Rps3a(Chapman) molecular method of toxicity, is characterized in that: the DNA fragmentation that described in step 2, pcr amplification goes out reclaims kit with AxyPrepDNA gel and reclaims before enzyme is cut; The enzyme that described in step 3, enzyme is cut cuts system and enzyme tangent condition is respectively:
Enzyme is cut system: dilute the enzyme cutting buffering liquid of 10 times, 2 μ l; 5U/ μ l'sBpu10I enzyme, 0.5 μ l; Reclaim the DNA fragmentation of kit recovery with AxyPrepDNA gel, 6 μ l; Add ddH2O to 20 μ l;
Enzyme tangent condition: 37 DEG C of incubation 1.5h, then 80 DEG C of incubation 20min inactivations.
6. a kind of soyabean phytophthora enantiopathy gene of measuring according to claim 1Rps3a(Chapman) molecular method of toxicity, it is characterized in that: the condition of described agarose gel electrophoresis is: 1% Ago-Gel, electrophoresis 30min under 120V voltage, with 0.5 μ g/ml ethidium bromide solution dyeing, takes a picture with Bio-rad gel imaging system under uviol lamp.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610151245.3A CN105603105B (en) | 2016-03-14 | 2016-03-14 | A kind of measurement soyabean phytophthora is to the molecular method of the toxicity of soybean line Chapman(Rps3a) |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610151245.3A CN105603105B (en) | 2016-03-14 | 2016-03-14 | A kind of measurement soyabean phytophthora is to the molecular method of the toxicity of soybean line Chapman(Rps3a) |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105603105A true CN105603105A (en) | 2016-05-25 |
| CN105603105B CN105603105B (en) | 2018-12-04 |
Family
ID=55983440
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610151245.3A Expired - Fee Related CN105603105B (en) | 2016-03-14 | 2016-03-14 | A kind of measurement soyabean phytophthora is to the molecular method of the toxicity of soybean line Chapman(Rps3a) |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105603105B (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102220415A (en) * | 2011-04-15 | 2011-10-19 | 南京农业大学 | Markers of phytophthora sojae avirulence gene Avr5 |
| WO2013009935A2 (en) * | 2011-07-12 | 2013-01-17 | Two Blades Foundation | Late blight resistance genes |
-
2016
- 2016-03-14 CN CN201610151245.3A patent/CN105603105B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102220415A (en) * | 2011-04-15 | 2011-10-19 | 南京农业大学 | Markers of phytophthora sojae avirulence gene Avr5 |
| WO2013009935A2 (en) * | 2011-07-12 | 2013-01-17 | Two Blades Foundation | Late blight resistance genes |
Non-Patent Citations (4)
| Title |
|---|
| DINAH QUTOB等: "Copy Number Variation and Transcriptional Polymorphisms of Phytophthora sojae RXLR Effector Genes Avr1a and Avr3a", 《PLOS ONE》 * |
| SUOMENG DONG等: "Sequence Variants of the Phytophthora sojae RXLR Effector Avr3a/5 Are Differentially Recognized by Rps3a and Rps5 in Soybean", 《PLOS ONE》 * |
| 孙龙 等: "大豆疫霉菌(Phytophthora sojae)无毒基因 Avr1a、Avr1k 及 Avr3a 的分子鉴定", 《微生物学通报》 * |
| 翟路翀: "大豆疫霉无毒基因Avr3a识别位点及亚细胞定位分析", 《中国优秀硕士学位论文全文数据库农业科技辑》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105603105B (en) | 2018-12-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104131086B (en) | A kind of SSR marker finger printing of needle mushroom F3 bacterial classification and application | |
| US20210198756A1 (en) | Dna barcode for variety identification of wolfberry and identification method therefor | |
| CN101942520B (en) | Marker of avirulence gene PsAvr3b of phytophthora sojae | |
| CN103184286B (en) | Identification method of rice bacterial leaf blight resistance | |
| CN104232782A (en) | PCR (polymerase chain reaction) primer for detecting tobacco soil-borne fungal pathogens as well as application and method of PCR primer | |
| CN103866038B (en) | For detecting tobacco to the N gene-specific primer of TMV resistance to, detection method and test kit | |
| CN108949916A (en) | Rape black shank bacterium specific sequence and LAMP detection primer and application | |
| CN103045747A (en) | Molecular detection primer for sweet potato black rot germs and application of molecular detection primer | |
| CN102586478B (en) | One-step multiplex reverse transcription-polymerase chain reaction (RT-PCR) method for detecting turnip mosaic virus and special primers for method | |
| CN101392293A (en) | Molecular marker method of turnip mosaic virus resistance gene in non-heading Chinese cabbage | |
| CN105671173B (en) | For measuring the soyabean phytophthora nontoxic gene Avr3a molecular method pathogenic to differential host L83-570 | |
| CN105603105A (en) | Molecular method for determining virulence of phytophthora sojae on disease-resistant gene Rps3a(Chapman) | |
| CN104673787A (en) | Molecular marker, detection method and application of hypsizigus marmoreus strain SIEF2632 | |
| CN103981265B (en) | Millet rest fungus nest-type PRC efficient detection method | |
| CN103290000B (en) | SCAR marker of biocontrol Hypocrea virens, its application and quantitative detection method | |
| CN104975015A (en) | Method for assisting in screening stripe-rust-resistant wheat and special primers thereof | |
| CN102994498B (en) | Molecular marker for co-separating soybean anti-phytophthora megasperma candidate gene RpsWD15-1 and application of molecular marker for co-separating soybean anti-phytophthora megasperma candidate gene RpsWD15-1 | |
| CN101487048A (en) | Molecular marking method for identifying pepper epidemic disease resistance character | |
| CN103805598A (en) | Molecular detection method for rapid detection of new puccnia striiformis West f.sp.tritici strain | |
| CN105112570A (en) | Real-time RT-PCR (reverse transcription-polymerase chain reaction) specific primers, probe and method for detecting PSTVd (potato spindle tuber viroid) | |
| CN105219848A (en) | For differentiating primer and the application thereof of tapiscia sinensis sex | |
| CN103160593B (en) | Specific detection method of phytophthora sojae avirulence gene (Avrlc ) | |
| CN104651490A (en) | Method for rapidly detecting tomato canker pathogen and special primer thereof | |
| CN102965369B (en) | Molecule mark coseparated from candidate gene RpsWD15-2 for phytophthora root rot of soybean and application thereof | |
| CN103184285B (en) | Identification method of rice bacterial leaf blight resistance |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20181204 Termination date: 20200314 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |