CN105603053A - High blood pressure susceptible gene SCN7A single nucleotide polymorphism site rs7565062 detection kit - Google Patents
High blood pressure susceptible gene SCN7A single nucleotide polymorphism site rs7565062 detection kit Download PDFInfo
- Publication number
- CN105603053A CN105603053A CN201410642019.6A CN201410642019A CN105603053A CN 105603053 A CN105603053 A CN 105603053A CN 201410642019 A CN201410642019 A CN 201410642019A CN 105603053 A CN105603053 A CN 105603053A
- Authority
- CN
- China
- Prior art keywords
- scn7a
- gene
- site
- seqidno
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Abstract
The present invention relates to the field of molecular biology and medicine, particularly to human VII type voltage-gated sodium ion channel alpha subunit gene (sodium channel, voltage-gated, type VII, alpha subunit, SCN7A) single nucleotide polymorphism (SNP) rs7565062 site and detection of the correlation between the site and essential hypertension. The present invention further relates to a method and a kit for detecting the SNP site, and uses of the method and the kit in detection of essential hypertension susceptibility. With the detection kit, whether the essential hypertension onset risk of an individual is higher than the essential hypertension onset risk of the general population is easily determined.
Description
Technical field
The present invention relates to molecular biology and medical domain. Relate more specifically to people's VII type Voltage-gated sodium channels α subunit gene (sodiumchannel, voltage-gated, type VII, alphasubunit, SCN7A) SNP (singlenucleotidepolymorphism, SNP) site rs7565062 and with the detection of essential hypertension correlation. The invention still further relates to the method and the kit that detect this SNP site.
Background technology
Prior art discloses essential hypertension (essentialhypertension, EH) be a kind of multifactor, multigenic disease, common and the multiple cardiovascular disorder jointly being caused a disease by environment and heredity factor, causes great impact to human health. Along with the development of molecular medicine, the hypertension relative gene having been found that at present has had more than 150 to plant, but the pathogenesis of EH still imperfectly understands, and hypertensive early diagnosis and proactive problem still fail to solve completely. Studies show that, EH is the coefficient result of gene and environment, the variation 30%-60% of blood pressure is owing to heredity, because environmental factor can be controlled and confirm, changeless and hypertension genetic is learned to factor, therefore, to the control of variable factor, as the prevention to Risk Factors of Hypertension, can delay to a certain extent and prevent hypertensive morbidity, but the understanding deficiency of changeless inherent cause is but being had a strong impact on to a certain extent to hypertension incidence, diagnosis and treatment. Therefore to hypertension genetic learn research very necessary (Wang Zuoguang, Wen Shaojun, Wu Zhaosu. hypertension, tumor susceptibility gene and SNP [J]. hypertension magazine, 2001,9:259-264).
Nearly more than two decades comes, and about the research of hypertension therapeutic concentrates on the control to blood pressure and the protection to target organ more, and has obtained the development of advancing by leaps and bounds. But, researcher thinks in the industry, these means can not fundamentally be controlled blood pressure, at present also little to the research of mankind's endogenous anti-hypertension gene, therefore, Study on Endogenous anti-hypertension mechanism is one of main direction of hypertension prevention and control research from now on, there is important researching value and application prospect, researcher thinks in the industry, by regulating endogenous anti-hypertension mechanism Hypertension, will promote the development of China's bio-medical technology, and be the huge medical expense of the annual saving of China.
Have and studies confirm that the too much picked-up of sodium salt plays an important role in hypertensive development. Research shows to have a kind of valtage-gated sodium-ion channel of thinking in the past, be found to be at present Na ion concentration dependent form sodium-ion channel, it can change sodium-ion channel degree of opening according to the variation of Na ion concentration, in ventricles of the brain pericyte as sodium ion receptor, participation maincenter is taken in the control of behavior to sodium salt, therefore may participate in developing of essential hypertension; And VII type Voltage-gated sodium channels gene (sodiumchannel, voltage-gated, type VII, alphasubunit; SCN7A) encode critical function structure-α subunit of this sodium-ion channel, therefore, have reason to infer that SCN7A gene is as the pith in blood pressure governing loop, the change of its protein function and structure all may participate in developing of essential hypertension, based on above Research foundation, the application in large sample crowd's association study, confirm this gene and essential hypertension closely related, think and on this gene rs7565062 site, carry the allelic crowd of A to suffer from hypertensive risk higher.
In sum, present inventor intends providing new essential hypertension tumor susceptibility gene, and detection method, kit, and relevant medicine.
Summary of the invention
The object of the invention is, for overcoming the deficiencies in the prior art, provides method and the detection kit of a kind of new detection (comprising early diagnosis) hypertension susceptible gene. Be specifically related to the detection kit of hypertension susceptible gene SCN7A mononucleotide polymorphism site rs7565062
The invention provides with the closely-related SCN7A gene mononucleotide polymorphism site rs7565062 of hypertension (being arranged in the 5 ' homing sequence of SCN7A, fragment contig contig:NT_005403.18 position 71981560A/C);
And confirm through experiment, SCN7A gene mononucleotide polymorphism site rs7565062 is positioned at SCN7A, in 5 ' homing sequence, (fragment contig contig:NT_005403.18 position 71981560A/C) genotypic change will cause hypertensive onset risk to raise, wherein association study result shows, there is significant difference (p < 0.05) in the distribution at SCN7A gene rs7565062A → C in case and control group, this SNP polymorphism can change transcription factor binding site point.
Nucleotide sequence that the detailed sequence of the SCN7A gene the present invention relates to can be rs7565062 referring to accession number (can referring to network address http://www.ncbi.nlm.nih.gov/).
The inventor checks order to (fragment contig contig:NT_005403.18 position 71981560A/C) region in 5 ' homing sequence in SCN7A gene.
The polymorphism in the SC7A gene rs7565062 site the present invention relates to can be directly used in hypertensive personalized treatment; In the time using the polymorphism in SCN7A gene rs7565062 of the present invention site, also can use the hypertensive medicament of other treatment simultaneously.
The present invention also provides a kind of pharmaceutical composition, and it contains SCN7A albumen of the present invention and pharmaceutically acceptable carrier or excipient safely and effectively. This class carrier comprises (but being not limited to): salt solution, buffer solution, glucose, water, glycerine, ethanol and combination thereof. Pharmaceutical preparation should match with administering mode.
Pharmaceutical composition of the present invention can be made into injection form, for example, be prepared by conventional method with physiological saline or the aqueous solution that contains glucose and other assistant agents; Pharmaceutical composition such as Tablet and Capsula, can be prepared by conventional method.
Pharmaceutical composition of the present invention is manufactured as injection, solution, Tablet and Capsula under aseptic condition; The dosage of active component be treatment effective dose, for example every day 0.1 microgram/kg body weight-Yue 10 mg/kg body weight; In addition, polypeptide of the present invention also can use together with other treatment agent.
While making pharmaceutical composition, that the SCN7A albumen of safe and effective amount or its antagonist, activator are applied to general mammal, wherein this safe and effective dosage is conventionally at least about 0.1 microgram/kg body weight, and be in most of the cases no more than approximately 10 mg/kg body weight, preferably this dosage is about 0.1 microgram/kg body weight-Yue 100 mg/kg body weight. Certainly, concrete dosage also should be considered the factor such as method of administration, patient health situation, and these are all within skilled practitioners skill.
The genotype that also relates to the rs7565062 that detects SCN7A gene in the present invention can be used for office hypertension. Detection can be for genomic DNA, also can be for the amplified fragments of SCN7A gene. The genotype of the rs7565062 of SCN7A gene can be suddenlyd change as Southern blotting, DNA sequence analysis, PCR and in situ hybridization detect by existing technology.
In the present invention, the genotype that SCN7A gene rs7565062 site is provided is detecting the purposes in hypertension neurological susceptibility preparation or method, as a kind of method of diagnosing for the hypertension neurological susceptibility to individual is provided, and it comprises step:
Detect the genotype in this individual SCN7A gene rs7565062 site, judge that with this whether this individuality suffer from hypertensive onset risk higher than general population.
In another preference, described difference is to be selected from following SNP:
Rs7565062 is positioned at SCN7A, in 5 ' homing sequence (fragment contig contig:NT_005403.18 position 71981560A/C)
Wherein, DNA (DNA) sequence numbering: rs7565062 position is based on SEQIDNO:1/6.
In another aspect of this invention, provide a kind of method that detects sample and whether exist the SNP of SCN7A gene, comprised step:
(a) with the genomic DNA of SCN7A gene 5 ' homing sequence primer amplified sample, obtain amplified production; With
(b) genotype of mononucleotide polymorphism site rs7565062 in detection amplified production:
Rs7565062 is positioned at SCN7A, in 5 ' homing sequence (fragment contig contig:NT_005403.18 position 71981560A/C)
Wherein, DNA (DNA) sequence numbering: primer 1 is based on SEQIDNO:2/6; Primer 2 is based on SEQIDNO:3/6; Probe 1 is based on SEQIDNO:4/6; Probe 2 is based on SEQIDNO:5/6; Amplified production is based on SEQIDNO:6/6.
In another preference, described SNP is that rs7565062 is positioned at SCN7A, in 5 ' homing sequence (fragment contig contig:NT_005403.18 position 71981560A/C)
Wherein, DNA (DNA) sequence numbering: rs7565062 position is based on SEQIDNO:1/6.
In another preference, described kit also contains the probe that is selected from 5 ' the homing sequence Auele Specific Primer of following reagent: SCN7A, is combined with mononucleotide polymorphism site rs7565062.
Wherein, DNA (DNA) sequence numbering: primer 1 is based on SEQIDNO:2/6; Primer 2 is based on SEQIDNO:3/6; Probe 1 is based on SEQIDNO:4/6; Probe 2 is based on SEQIDNO:5/6; Amplified production is based on SEQIDNO:6/6.
In another preference, 5 ' the homing sequence mononucleotide polymorphism site of described SCN7A:
Rs7565062 is positioned at SCN7A, in 5 ' homing sequence (fragment contig contig:NT_005403.18 position 71981560A/C)
Wherein, DNA (DNA) sequence numbering: rs7565062 position is based on SEQIDNO:1/6.
The invention discloses the detection kit of hypertension susceptible gene SCN7A mononucleotide polymorphism site rs7565062 and the purposes in the method for detection of essential hypertension neurological susceptibility thereof, contribute to judge whether certain individual onset risk of suffering from essential hypertension is greater than general population.
All documents of mentioning in the present invention are all quoted and are made reference in this application, are just quoted separately as a reference as each section of document. In addition should be understood that read of the present invention above-mentioned tell about content after, those skilled in the art can make various changes or amendment to the present invention, these forms fall within the application's appended claims limited range equally.
Brief description of the drawings
Fig. 1 has shown that SCN7Ars7565062 is positioned at SCN7A, the genotypic sequencing result of a kind of SNP of (fragment contig contig:NT_005403.18 position 71981560A/C) in 5 ' homing sequence.
Fig. 2 is the testing result of SCN7A gene rs7565062 loci gene type.
Fig. 3 is the sequencing result sectional drawing of embodiment 2.
Detailed description of the invention
Below in conjunction with specific embodiment, further set forth the present invention. Should be understood that these embodiment are only not used in and limit the scope of the invention for the present invention is described. The experimental technique of unreceipted actual conditions in the following example, conventionally according to normal condition as people such as Sambrook, molecular cloning; Condition described in laboratory manual (NewYork:ColdSpringHarborLaboratoryPress, 1989), or the condition of advising according to manufacturer.
Embodiment 1 fluorescent PCR detects
Experiment material:
7900HT quantitative real time PCR Instrument is purchased from American AB I company, and pcr reaction solution (TaqManEXPressMasterMix) is synthetic by Applied biosystems (ABI) customization.
Primer and probe design and synthetic:
Taking the partial sequence of SCN7A gene 5 ' homing sequence as template, use PrimerExpressTM2.0 software analysis TaqMan primer and probe site, and synthetic by Applied biosystems (ABI) customization. Detection primer:
SCN7A gene rs7565062 upstream primer sequence: 5 '-TGGAGAAGTTGAAAGGTAGAT-3 '
SCN7A gene rs7565062 downstream primer sequence: 5 '-ACTGCCTAACCAGGTAAGAT-3 '
Fluorescence probe:
SCN7A gene rs7565062 fluorescence probe 1:5 '-VIC-aaagccaactcctgatttgga-TAMRA-3 ' SCN7A gene rs7565062 fluorescence probe 2:5 '-FAM-aaagccaaatcctgatttgga-TAMRA-3 ' pattern detection:
613 routine hypertension cases and 616 routine normal control crowds are examined in experiment altogether, and every example is collected the about 2ml of blood sample, and with phenol/chloroform drawer genomic DNA, micro-ultraviolet/visible light spectrophotometer for extracting result (INFINIGEN company) detects.
Carry out fluorescent PCR amplification by following system, finally with SDS2.3 scanning cluster analysis
The testing result of genome DNA extraction shows: the genomic DNA of all samples meets testing requirement (260/280 > 1.8, concentration > 10ng/ul, the testing result of No. 54, sample as shown in Figure 2);
Table 1 is SNP somatotype result.
Table 1
Embodiment 2
Detect the rs7565062 site of essential hypertension tumor susceptibility gene SCN7A gene with PCR sequencing PCR. Selecting each 10 examples of above-mentioned hypertension case-control group sample checks order and judges the genotype of rs75650629.
Experimental technique: PCR sequencing primer still adopts above-mentioned fluorescent PCR primer, the purified rear direct Sequencing of product of amplification. The instrument of order-checking is the 3130xl genetic analyzer of ABI company, analyzes with sequenceanalysis5.2 analysis software, and result can be checked with chromas;
Experimental result demonstration, the genotyping result of the sequencing result of 20 examples and 7900 fluorescent PCRs is in full accord.
The association analysis result of SCN7A gene rs7565062 genotype and hypertension susceptible shows, the relatively employing RxC χ that SCN7A gene rs7565062 distributes in hypertensive patient and contrast2Inspection. carry out statistical analysis with SPSS software, testing result and SPSS software analysis result are as shown in Figure 2.
Table 2
SEQUENCELISTING
<110>Beijing Anzhen Hospital, Capital Medical University Beijing Institute of Cardiopulmonary Vascular Disease
<120>detection kit of hypertension susceptible gene SCN7A mononucleotide polymorphism site rs7565062
<160>6
<170>PatentInversion3.3
<210>1
<211>52
<212>DNA
<213>homosapiens
<400>1
ccatgaagaagaagacttaaagccaactcctgatttggaagttggcaaaaag52
<210>2
<211>21
<212>DNA
<213>artificial sequence
<400>2
tggagaagttgaaaggtagat21
<210>3
<211>20
<212>DNA
<213>artificial sequence
<400>3
actgcctaaccaggtaagat20
<210>4
<211>21
<212>DNA
<213>artificial sequence
<400>4
aaagccaactcctgatttgga21
<210>5
<211>21
<212>DNA
<213>artificial sequence
<400>5
aaagccaaatcctgatttgga21
<210>6
<211>720
<212>DNA
<213>artificial sequence
<400>6
atggagaagttgaaaggtagatttcagtaaaagaatgttaaaacgatgaataagtgaagc60
agactgagttactcatgaaattacaaattaagtctgatattaagtacaataaaactcagg120
acaacttagatttctacaaaactaaggaatatgttctttaaatgcatacattcagtttac180
tggtctctatttttcgtatcctaatcttttgtacttttatgttttattagtatacccaac240
tttaatacagaattttttgcaggtacaaaattggaaatgttggcttcaccagaacctaag300
ggccttgttcccttcactaaagagtcttttgaacttataaaacagcatattgctaaaaca360
cataatgaagaccatgaagaagaagacttaaagccaactcctgatttggaagttggcaaa420
aagcttccatttatttatggaaacctttctcaaggaatggtgtcagagcccttggaagat480
gtggacccatattactacaagaaaaaaaatgtgagtattaattgagattattttgatgac540
atttttattattttatttccagacatacagaaaatgtaattgagataggatacaaaaaga600
taatgaaaaacagggaaagatctgattttaaattttacagaacgacataagatatctcat660
tttgggaacacacatattggagatttttgtcaaaactgatatcttacctggttaggcagt720
Claims (6)
1. the detection method in hypertension susceptible gene rs7565062 site, is characterized in that, detects the genotype in SCN7A gene rs7565062 site, and it comprises step:
(a) genomic DNA of extracting sample, amplification obtains the region that SCN7A gene comprises rs7565062 site, and amplified production is based on SEQIDNO:6/6;
(b) genotype of mononucleotide polymorphism site rs7565062 in detecting step (a) product.
2. the method for claim 1, is characterized in that, the genotype in the SCN7A gene rs7565062 site of detection; Its site is arranged in SCN7A gene 5 ' homing sequence (fragment contig contig:NT_005403.18 position 71981560A/C), and the position of rs7565062 is based on SEQIDNO:1/6.
3. detection method as claimed in claim 2, it is characterized in that, the primer sequence in the region that amplification SCN7A gene 5 ' homing sequence (fragment contig contig:NT_005403.18 position 71981560A/C) comprises rs7565062 site is as shown in SEQIDNO:2/6 and SEQIDNO:3/6.
4. method as claimed in claim 3, is characterized in that, detects the probe sequence of rs7565062 loci gene type as shown in SEQIDNO:4/6 and SEQIDNO:5/6.
5. a kit that detects hypertension susceptible gene, is characterized in that, it contains the probe of being combined with site rs7565062, and sequence is as SEQID. NO:4/6; Shown in SEQIDNO:5/6.
6. kit as claimed in claim 5, is characterized in that, it also comprises the primer in the region that comprises rs7565062 site in specific amplification SCN7A gene 5 ' homing sequence, and the sequence of primer is as shown in SEQIDNO:2/6 and SEQIDNO:3/6.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201410642019.6A CN105603053A (en) | 2014-11-06 | 2014-11-06 | High blood pressure susceptible gene SCN7A single nucleotide polymorphism site rs7565062 detection kit |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201410642019.6A CN105603053A (en) | 2014-11-06 | 2014-11-06 | High blood pressure susceptible gene SCN7A single nucleotide polymorphism site rs7565062 detection kit |
Publications (1)
Publication Number | Publication Date |
---|---|
CN105603053A true CN105603053A (en) | 2016-05-25 |
Family
ID=55983390
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201410642019.6A Pending CN105603053A (en) | 2014-11-06 | 2014-11-06 | High blood pressure susceptible gene SCN7A single nucleotide polymorphism site rs7565062 detection kit |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN105603053A (en) |
Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN1597980A (en) * | 2003-09-15 | 2005-03-23 | 上海市高血压研究所 | Electric pressure controlling sodium pass 7 type alpha subunit gene relativity with primary hypertension |
CN101892296A (en) * | 2010-02-01 | 2010-11-24 | 首都医科大学附属北京安贞医院 | Method for detecting hypertension susceptible gene and detection kit |
WO2011032112A2 (en) * | 2009-09-11 | 2011-03-17 | University Of Utah Research Foundation | Mutant sodium channel nav1.7 and methods related thereto |
CN103874486A (en) * | 2011-09-06 | 2014-06-18 | 库尔纳公司 | Treatment of diseases related to alpha subunits of sodium channels, voltage-gated (scnxa) with small molecules |
-
2014
- 2014-11-06 CN CN201410642019.6A patent/CN105603053A/en active Pending
Patent Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN1597980A (en) * | 2003-09-15 | 2005-03-23 | 上海市高血压研究所 | Electric pressure controlling sodium pass 7 type alpha subunit gene relativity with primary hypertension |
WO2011032112A2 (en) * | 2009-09-11 | 2011-03-17 | University Of Utah Research Foundation | Mutant sodium channel nav1.7 and methods related thereto |
CN101892296A (en) * | 2010-02-01 | 2010-11-24 | 首都医科大学附属北京安贞医院 | Method for detecting hypertension susceptible gene and detection kit |
CN103874486A (en) * | 2011-09-06 | 2014-06-18 | 库尔纳公司 | Treatment of diseases related to alpha subunits of sodium channels, voltage-gated (scnxa) with small molecules |
Non-Patent Citations (2)
Title |
---|
ZHANG B ET AL.: "Association of common exon SCN7A polymorphisms with essential hypertension in Northern Han Chinese population", 《第八届北京五洲国际心血管病会议论文集》 * |
张奎星 等: "SCN7A基因单核苷酸多态性与原发性高血压的相关研究", 《中华医学遗传学杂志》 * |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN102586408B (en) | The detection method of hypertension susceptible gene Mfn2 mononucleotide polymorphism site rs3820189 and detection kit | |
CN101892311B (en) | Detection method and kit of single nucleotide polymorphism locus rs7550536 of susceptibility gene of hypertension | |
CN101892305B (en) | Method for detecting rs2295281 locus of hypertension susceptibility gene and detection kit | |
CN101892302B (en) | Use and detection kit of locus rs2336384 of susceptibility gene of hypertension | |
CN103957705A (en) | Single nucleotide polymorphisms useful to predict clinical response for glatiramer acetate | |
Ramírez-Pacheco et al. | Mexican childhood acute lymphoblastic leukemia: a pilot study of the MDR1 and MTHFR gene polymorphisms and their associations with clinical outcomes | |
Wang et al. | Mitochondrial tRNAThr G15927A mutation may modulate the phenotypic manifestation of ototoxic 12S rRNA A1555G mutation in four Chinese families | |
CN106434982B (en) | The relevant molecular marked compound of cerebral arterial thrombosis and its application | |
CN111118149A (en) | Kit for guiding medication of people for epileptic diseases and application thereof | |
Aslibekyan et al. | CPT1A methylation is associated with plasma adiponectin | |
CN101886129B (en) | Method for detecting mononucleotide polymorphism locus rs388915 of hypertension susceptibility genes AGTR 1 and detection kit | |
CN101892297B (en) | Detection method of single nucleotide polymorphism sites of hypertension susceptibility gene and kit thereof | |
CN101886125B (en) | Method for detecting mononucleotide polymorphism locus rs2236058 of hypertension susceptibility genes and detection kit | |
CN103146822A (en) | PCR (Polymerase Chain Reaction) kit for detecting SNP (Single Nucleotide Polymorphism) relative to female depression | |
Liang et al. | A method establishment and comparison of in vivo lung cancer model development platforms for evaluation of tumour metabolism and pharmaceutical efficacy | |
CN101892296B (en) | Method for detecting hypertension susceptible gene and detection kit | |
CN101886121A (en) | Method for detecting locus rs873457 of hypertension susceptibility genes and detection kit | |
CN101892298B (en) | Method for detecting mononucleotide polymorphism rs2236055 locus of hypertension susceptibility gene and kit thereof | |
CN105603053A (en) | High blood pressure susceptible gene SCN7A single nucleotide polymorphism site rs7565062 detection kit | |
CN101979657B (en) | Method and kit for detecting rs2878677 locus of susceptibility gene of hypertension | |
CN113136430A (en) | Application method of circular RNA CircSERPINE2 and detection and treatment preparation | |
CN101892301B (en) | Method for detecting hypertension susceptibility gene and detection kit | |
CN104419759A (en) | Detection method and detection kit for single nucleotide polymorphism site rs7975232 of lung cancer susceptibility gene | |
CN101892303A (en) | Method for detecting rs4846085 locus of hypertension susceptibility gene and detection kit thereof | |
CN101805784B (en) | Single nucleotide polymorphism of human WNK4 genes and application thereof |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
RJ01 | Rejection of invention patent application after publication |
Application publication date: 20160525 |
|
RJ01 | Rejection of invention patent application after publication |