CN105602976A - Method for molecular modification of liver-targeting interferon, and mutant liver-targeting interferon - Google Patents
Method for molecular modification of liver-targeting interferon, and mutant liver-targeting interferon Download PDFInfo
- Publication number
- CN105602976A CN105602976A CN201510923107.8A CN201510923107A CN105602976A CN 105602976 A CN105602976 A CN 105602976A CN 201510923107 A CN201510923107 A CN 201510923107A CN 105602976 A CN105602976 A CN 105602976A
- Authority
- CN
- China
- Prior art keywords
- amino acids
- mutated
- liver
- interferon
- liver targeted
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/52—Cytokines; Lymphokines; Interferons
- C07K14/555—Interferons [IFN]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/62—DNA sequences coding for fusion proteins
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/33—Fusion polypeptide fusions for targeting to specific cell types, e.g. tissue specific targeting, targeting of a bacterial subspecies
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Zoology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Wood Science & Technology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Toxicology (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Peptides Or Proteins (AREA)
Abstract
The invention discloses a method for molecular modification of a liver-targeting interferon, and a mutant liver-targeting interferon. The mutant liver-targeting interferon has an amino acid sequence as shown in SEQ ID No. 2; and a coding gene of the mutant liver-targeting interferon has a nucleotide sequence as shown in SEQ ID No. 3 or 4. The activity of the recombinant mutant liver-targeting interferon is 1 * 10<9> IU/mg, which is substantially higher than the activity (1.2* 10<8> IU/mg) of original liver-targeting interferon. The content of endotoxin in every 40 million IU of the recombinant mutant liver-targeting interferon is less than 0.24 EU, far lower than the standard of less than 10 EU of every 3 million IU prescribed in the Chinese Pharmacopoeia. Moreover, the activity of the recombinant mutant liver-targeting interferon is obviously stronger than the activity of common recombinant mutant liver-targeting interferon.
Description
Technical field
The present invention relates to biological technical field, particularly, relate to a kind of method of molecular modification liver targeted interferon and dash forwardThe liver targeted interferon becoming.
Background technology
Interferon can be brought into play antiviral and antitumaous effect by number of ways, but when application exist dosage large,The shortcomings such as curative effect is not ideal enough, toxic and side effect is large, have limited its extensive use in clinical. This main cause is due to virusThe focus of hepatitis and liver cancer is mainly at liver, and when treatment, interferon easily diffusion degraded in vivo, causes relatively average groupKnit distribution, fail to form effective drug concentration at liver. In order to reach clinical effectiveness, drug dose often will strengthen several times, severalTen times, the increasing of drug dose has also increased the weight of its bad reaction, easily produces again drug resistance, thereby affects the treatment. By liver targetPEPC SPI-plus merges mutually with interferon (IFN), utilizes the liver target characteristic of liver targeting peptides CSPI-plus, and interferon is existedLiver enrichment, reaches the specificity that improves interferon therapy liver diseases, reduces dosage, reduces toxicity, has goodApplication and development prospect.
But IFN-CSP exists with the form of inclusion body, need could obtain through complicated preparation process such as sex change, renaturationActive albumen, not only complex process, final yield are not high, and owing to there being two pairs of disulfide bond in IFN-CSP molecular structure, multipleProperty process in easy false folding, protein renaturation efficiency is not high, the activity of end-product need further raising.
Summary of the invention
The present invention, in order to overcome the deficiencies in the prior art, provides a kind of method of molecular modification liver targeted interferon, therebyObtain the liver targeted interferon of the sudden change that BA is stronger.
Another object of the present invention is to provide a kind of liver targeted interferon of sudden change.
To achieve these goals, the present invention is achieved by the following technical programs:
A method for molecular modification liver targeted interferon, is specially from aminoterminal, and 11 amino acids are dashed forward by serineBecome asparagine, 14 amino acids by threonine be mutated into alanine, 16 amino acids are mutated into different bright ammonia by methionineAcid, 26 amino acids are mutated into proline, 37 by leucine and become glutamic acid, 44 ammonia with 102 amino acids by glycine mutationBase acid is become aspartic acid, between 44 and 45, is inserted aspartic acid by glycine mutation, and 45 amino acids are dashed forward by asparagineBecome lysine, 51 amino acids by glutamic acid be mutated into glutamine, 52 amino acids are mutated into alanine, 54 by threonineAmino acids by proline be mutated into serine, 68 amino acids become threonine, 79 amino acids by the ammonia of reviving by mutant serineAcid mutation become aspartic acid, 85 amino acids by tyrosine be mutated into cysteine, 100 amino acids are become by isoleucine mutationMethionine, 103 amino acids by a word used in person's names propylhomoserin be mutated into glutamic acid, 104 amino acids become arginine, 106 by glycine mutationAmino acids by threonine be mutated into glycine, 112 amino acids by lysine mutation become asparagine, 113 amino acids byGlutamic acid be mutated into alanine, 120 amino acids by arginine be mutated into lysine, 124 amino acids are suddenlyd change by glutamineBecome arginine, 131 amino acids by lysine mutation become threonine, 151 amino acids by phenylalanine be mutated into leucine,160 become arginine with 163 amino acids by mutant serine.
A liver targeted interferon for sudden change, its amino acid sequence as shown in SEQIDNO:2, original liver targeted interferonAmino acid sequence as shown in SEQIDNO:1.
An encoding gene for the liver targeted interferon of sudden change, its nucleotide sequence is as shown in SEQIDNO:3 or 4. SEQIDNO:3 is the sequence before the encoding gene codon of the liver targeted interferon of sudden change is not optimized, and SEQIDNO:4 is what suddenly changeThe sequence of the encoding gene of liver targeted interferon after e. coli codon is optimized.
Preferably, the present invention's recombinant vector that further protection contains encoding gene described in SEQIDNO:3 or 4. More excellentSelection of land, the construction method of described recombinant vector is as the polyclone of pMD19-T carrier or expression vector pET21b at object carrierEncoding gene described in site insertion SEQIDNO:3 or 4.
In addition, the present invention is and the liver targeted interferon suddenling change described in further protection SEQIDNO:2 is antiviral in preparationWith the application in cancer therapy drug.
Compared with prior art, the present invention has following beneficial effect:
The activity of recombination mutation liver targeted interferon of the present invention is 1 × 109IU/mg, is significantly higher than original liver targeted interferonActive (1.2 × 108IU/mg). Endotoxin content in every 4,000 ten thousand IU of recombination mutation liver targeted interferon is less than 0.25EU,Should be less than 10EU far below every 3,000,000 IU that specify in Chinese pharmacopoeia. And the activity of recombination mutation liver targeted interferon is obviousBe better than common recombination mutation interferon.
Brief description of the drawings
Fig. 1 is original liver targeted interferon and sudden change liver targeted interferon amino acid sequence comparison result.
Fig. 2 is the structure alignment of original liver targeted interferon and sudden change liver targeted interferon.
Fig. 3 is the stability analysis of original liver targeted interferon and sudden change liver targeted interferon.
Fig. 4 liver targeted interferon nucleotide sequence Escherichia coli rare codon analysis result that suddenlys change.
Fig. 5 codon optimized result of liver targeted interferon nucleotide sequence of suddenling change.
Fig. 6 liver targeted interferon Fusion gene construction method of suddenling change.
Fig. 7 is the restructuring of sudden change liver targeted interferon fusion, and wherein, M is DNA molecular amount standard, and 1～8 is firstInferior SOE-PCR amplified production, 9～12 is SOE-PCR amplified production for the second time, the 13 sudden change liver targeted interferon total lengths for restructuringGene.
Fig. 8 is bacterium colony PCR and the double digestion qualification of restructuring cloned plasmids, and wherein, M is DNA molecular amount standard, and 1 is restructuringThe PCR qualification of plasmid; 2 is NdeI, XholI double digestion recombinant plasmid.
Fig. 9 is sudden change liver targeted interferon gene prokaryotic plasmid construction schematic diagram.
Figure 10 is bacterium colony PCR and the double digestion qualification of restructuring prokaryotic expression plasmid, and wherein, M is DNA molecular amount standard, and 1 isThe PCR qualification of recombinant plasmid; 2 is NdeI, XholI double digestion recombinant plasmid.
Figure 11 is the comparison of destination protein expression and localization, and A is original liver targeted interferon, and B is for suddenling change liver targeted interferon notOptimal Expression condition, C is sudden change liver targeted interferon Optimal Expression condition, wherein, M is protein molecule quality standard; 0 representativeWhole bacterial protein before recombinant bacterium induction; 1 represents the rear whole bacterial protein of recombinant bacterium induction; On after the rear recombinant bacterium carrying out ultrasonic bacteria breaking of 2 representative inductionClearly; Recombinant bacterium carrying out ultrasonic bacteria breaking postprecipitation after 3 representative inductions.
Figure 12 is that the SDS-PAGE of sudden change liver targeted interferon purification result analyzes, and wherein M is protein molecule quality markAccurate; Supernatant after recombinant bacterium carrying out ultrasonic bacteria breaking after 1 representative induction; 2 represent that purification column penetrates liquid; 3 represent the PBS purifying of 50mM imidazolesEluent; 4 represent the PBS purifying eluent of 100mM imidazoles; 5 represent the PBS purifying eluent of 500mM imidazoles.
Figure 13 is the result that HPLC detects recombination mutation liver targeted interferon purity.
Figure 14 MTT testing result shows that recombination mutation liver targeted interferon has remarkable anti-tumour cell proliferative activity.
In Figure 15 body, hepatic tissue distribution experimental result shows that recombination mutation liver targeted interferon has hepatic targeting.
In Figure 16 body, anti-HBV experimental result shows after the effect of recombination mutation liver targeted interferon, HBV transgenic mice bloodClear HBsAg level significantly reduces.
In Figure 17 body, anti-HBV experimental result shows after the effect of recombination mutation liver targeted interferon, HBV transgenic mice liverDirty HBsAg protein expression level significantly reduces.
Detailed description of the invention
Below in conjunction with Figure of description and specific embodiment, the present invention is made further and being elaborated, described embodimentOnly, for explaining the present invention, be not intended to limit scope of the present invention. The test method using in following embodiment is as special in nothingDifferent explanation, is conventional method; The material, the reagent etc. that use if no special instructions, are the reagent that can obtain from commercial channelsAnd material.
Embodiment 1
Utilize the method for replacing and insert to carry out molecular modification (see figure 1) to original liver targeted interferon amino acid sequence, concreteRemodeling method is: from aminoterminal, become asparagine, 14 amino acids by threonine 11 amino acids by mutant serineBe mutated into alanine, 16 amino acids by methionine be mutated into isoleucine, 26 amino acids are mutated into dried meat ammonia by leucineAcid, 37 with 102 amino acids by glycine mutation become glutamic acid, 44 amino acids by glycine mutation become aspartic acid, 44And insert aspartic acid between 45,45 amino acids become lysine, 51 amino acids to be dashed forward by glutamic acid by asparagine mutationBecome glutamine, 52 amino acids by threonine be mutated into alanine, 54 amino acids are mutated into serine, 68 by prolineAmino acids becomes threonine, 79 amino acids to be mutated into aspartic acid, 85 amino acids by junket by threonine by mutant serinePropylhomoserin is mutated into cysteine, 100 amino acids become methionine, 103 amino acids to be dashed forward by a word used in person's names propylhomoserin by isoleucine mutationBecome glutamic acid, 104 amino acids by glycine mutation become arginine, 106 amino acids by threonine be mutated into glycine,112 amino acids become asparagine, 113 amino acids to be mutated into alanine, 120 amino acids by glutamic acid by lysine mutationBy arginine be mutated into lysine, 124 amino acids by glutamine be mutated into arginine, 131 amino acids are dashed forward by lysineBecoming threonine, 151 amino acids is mutated into leucine, 160 by phenylalanine and becomes essence with 163 amino acids by mutant serinePropylhomoserin.
The Structure and stability of the liver targeted interferon of integrated use bioinformatics instrument to sudden change is analyzed: utilizeBLAST(http://blast.ncbi.nlm.nih.gov/Blast.cgi)、BLAST2(BLOSUM62matrix)(www.ncbi.nlm.nih.gov/blast/bl2seq/wblast2.cgi), clustalX1.8 and SWISS-MODEL(http://swissmodel.expasy.org/SWISS-MODEL) carries out higher structure prediction, and the liver target of sudden change is disturbedProtein sequence in amino acid sequence and the three-dimensional structure database PDB (http://www.rcsb.org/pdb) of element carries outComparison, selects the highest sequence of similitude to carry out homology modeling as model, analyse and compare original liver targeted interferon and sudden changeThe structure of liver targeted interferon, checks pdb document result with Swiss-PdbViewer software, and result shows compares original liverTargeted interferon, the liver targeted interferon of sudden change causes change (see figure 2) three structural points. Utilize AMBER9.0Softwarepackage carries out analysis on Molecular Dynamics, and result shows compares original liver targeted interferon, the liver target of sudden changeThe structural fluctuation of interferon is less, and the liver targeted interferon that suddenlys change is than the more stable (see figure 3) of original liver targeted interferon.
Embodiment 2
For adapting to prokaryotic expression needs, raise the efficiency, we utilize online rare codon analysis software RareCodonCalculator (RaCC) (network address: http://nihserver.mbi.ucla.edu/RACC/) is dry to the liver target of sudden changeThe Bacillus coli expression rare codon of disturbing in the nucleotide sequence that element is corresponding is analyzed, RaCC provide arginine (AGG,CGA, AGA), the analysis result (Fig. 4) of leucine (CTA), isoleucine (ATA) and proline (CCC) 4 seed amino acids. At thisOn basis, select expression in E. coli gene to commonly use password (http://www.kazusa.or.jp/codon/), according toThe amino acid sequence of sudden change liver targeted interferon designs the base sequence (Fig. 5) of its gene, and concrete optimisation strategy is by parentEscherichia coli rare codon arginine (AGG, CGA, AGA) in nucleotide sequence, leucine (CTA), isoleucine (ATA) andProline (CCC) replaces with respectively the conventional codon arginine (CGT) of escherichia coli high-level expression gene, leucine (CTT), differentLeucine (ATT) and proline (CCA).
Embodiment 3
The structure of sudden change liver targeted interferon fusion: the nucleotide sequence (base of the sudden change liver targeted interferon described in embodiment 2Because total length is 555bp) be basis, add restriction enzyme NdeI and XhoI position at 5' end and 3' end respectivelyPoint, and add restriction enzyme site protection base at two ends, sequence total length is 588bp like this. Whole gene is divided into 16 phase mutual respectsFolded oligonucleotides segment, with PrimerPremier5.0 biosoftware design primer, primer sequence is as SEQIDNO:5Shown in～20. When design, two segments of SEQIDNO:5 and SEQIDNO:20 are relatively little, can be used as two of total length segmentEnd primer, all the other oligonucleotides segments are in 58bp left and right.
Adopt SOE-PCR technology three steps amplification recombinant fusion genes, basic procedure as shown in Figure 6:
1, pcr amplified fragment IC1-2, IC3-4, IC5-6, IC7-8, IC9-10, IC11-12, IC13-14, IC15-16, primer I C1, IC2 are for PCR synthetic amplification IC1-2 specific fragment (68bp), and all the other are similar. PCR reaction systemIn table 1:
Pcr amplification condition is: 98 DEG C of 10sec, 68 DEG C of 30sec, circulate 10 times. 4% agarose gel electrophoresis detects specialThe size of amplified fragments.
2, SOE-PCR amplified fragments IC1-4, IC5-8, IC9-12, IC13-16: produce with the PCR in above-mentioned steps 1Thing is template, due to IC1-2 and IC3-4, IC5-6 and IC7-8, IC9-10 and IC11-12, IC13-14 and IC15-Between 16 adjacent segment, all there is the chain of partly overlapping, thereby two fragment genes are spliced in the extension by overlapping chain in amplified reactionGet up, synthetic IC1-4, IC5-8, IC9-12, IC13-16. Expand in a large number taking primer P1, P4 etc. as upstream and downstream primer againIncrease, all the other are similar. PCR reaction system is in table 2:
Amplification condition is: 98 DEG C of 10sec, 68 DEG C of 30sec, circulate 10 times, take out Eppendorf pipe and add drawing of 1 μ lThe primer I C4 (101 μ M) of thing IC1 (10 μ M) and 1 μ l, Eppendorf pipe is inserted in DNA cloning instrument, reaction conditionFor: 98 DEG C of 10sec, 68 DEG C of 30sec, circulate 30 times. 2% agarose gel electrophoresis detects the size of specific amplified fragment,Adopt the TIANgelMidiPurificationKit purified pcr product of Beijing TIANGEN company, specifically see that kit saysBright book.
3, SOE-PCR recombinant full-lenght fusion: it is template that the PCR that obtains taking step 2 reclaims product, due to IC1-4 andBetween IC5-8, IC9-12 and IC13-16 adjacent segment, all there is the chain of partly overlapping, by overlapping chain in amplified reactionThereby extend, four fragment genes are stitched together, the antigen-4 fusion protein gene of synthetic total length. And then taking primer I C1 and IC16 as upper and lowerTrip primer increases in a large number. Be finally that fusion adds PolyA tail with TaKaRaTaq polymerase, be beneficial to next stepTA clone. PCR reaction system sees the following form.
Reaction condition is: 98 DEG C of 10sec, 68 DEG C of 40sec, circulate 10 times. Take out Eppendorf pipe and add 1 μ lPrimer I C1 (10 μ M) and 1 μ l primer I C16 (101 μ M), Eppendorf pipe is inserted in DNA cloning instrument, reaction barPart is: 98 DEG C of 10sec, 68 DEG C of 40sec, circulate 30 times. Take out the TaKaRaTaq that Eppendorf pipe adds 0.25 μ lEnzyme (l), 5units/ μ inserts in DNA cloning instrument, and 72 DEG C are extended 20min by Eppendorf pipe. 1.5% agarose gel electrophoresis inspectionSurvey the size of specific amplified fragment, electrophoresis result shows that amplification obtains the fragment (Fig. 7) of about 600bp.
4,, by the PCR product of a large amount of amplifications of step 3, adopt TIANgelMidiPurificationKit to reclaim pureChange, concrete steps are according to kit description. Then recovery product is connected with pMD19-T carrier, connects product and transform senseBe subject to state cell E.coilDH5 α, obtain positive recombinant, the qualification of positive recombinant adopts bacterium colony PCR qualification (Fig. 8), restructuringThe enzyme of plasmid is cut qualification (Fig. 8) and order-checking qualification, from positive recombinant, extracts and obtains recombinant plasmid MuIFN-CSP/pMD19-T。
The suddenly change structure of liver targeted interferon recombinant expression plasmid of embodiment 4
The recombinant plasmid MuIFN-CSP/pMD19-T that prokaryotic expression carrier pET21b and embodiment 3 are successfully constructed carries out respectivelyDouble digestion also connects (construction of recombinant plasmid flow process is as Fig. 9). According to the TIANpureMidiPlasmid of TIANGEN companyKit description extracts respectively recombinant plasmid MuIFN-CSP/pMD19-T and prokaryotic expression plasmid pET21b, and extracting is obtainedPlasmid carries out double digestion with restriction enzyme XhoI and NdeI respectively, reclaims respectively enzyme and cuts after product, the object that enzyme is cutGene and enzyme are cut pET21b plasmid and are carried out coupled reaction with reference to mol ratio 3:1 by T4 ligase, connect product and transform large intestine barBacterium DH5 α, transforms bacterial classification and is applied to the flat board that contains ampicillin, cultivates after 16～18h, carries out resistance screening. Under normal temperature withMachine is selected transformant to be detected in reformer plate, uses respectively after a small amount of thalline of sterilizing toothpick picking, carries out as stated above bacterium colonyPCR identifies, walks the positive recombinant bacterium colony of Preliminary Identification on picking, is inoculated in 5ml containing 100 μ g/ml ampicillin LBIn nutrient solution, 250rpm/min, 37 DEG C of overnight incubation. Pressing the PlasmidMiniKitI kit of OMEGA company saysBright extracting plasmid carries out enzyme to be cut after qualification, and carrier inserts the order-checking of genes of interest and entrusts Invitrogen company to carry out. PCR mirrorFixed and double digestion qualification result all can obtain fragment in line (Figure 10), sequencing result display sequence, splices and combinesOrder and direction and expection are in full accord, and construction of recombinant expression plasmid success is described.
Embodiment 5 suddenly change abduction delivering and the positioning analysis of liver targeted interferon
By the single colony inoculation of recombination engineering E.coilBL21 (DE3) that contains recombinant plasmid MuIFN-CSP/pET21bIn LB culture medium (containing 100 μ g/ml ampicillins), 180rpm/min, 12～16h is cultivated in 37 DEG C of joltings, thenThis bacterium liquid is inoculated in fresh LB fluid nutrient medium in 1:100 ratio, 180rpm/min, 37 DEG C are cultured to OD600For0.6 o'clock, adding final concentration was that isopropyl-β-thiogalactoside (IPTG) of 0.8mmol/L is induced 6h. RespectivelyBefore and after abduction delivering, respectively get 1ml sample, 4 DEG C of centrifugal 10min of 10000rpm/min collect bacterial cell, are resuspended inIn 150 μ l deionized waters, add 4 × SDS sample-loading buffer of 50 μ l, boiling water boiling 5～10min, cooling afterThe centrifugal 10min of 10000rpm/min, sucts clearly, carries out 15%SDS-PAGE qualification. Be suspended from 0.1 times by heavy the bacterium of collectionIn the bacterial lysate of volume precooling, and add 1 μ lBenzonase Nuclease (25U/ by every milliliter of initial bacterium liquidμ l), (power 450W, passon2sec, passoff2sec) broken 10min under ultrasonic cell disintegration instrument. 10000rpm/min4 DEG C of centrifugal 10min, leaves and takes respectively cleer and peaceful precipitation and carries out SDS-PAGE analysis. SDS-PAGE electrophoresis detectionThere is object band at about 21kDa place, do not occur and do not induce in bacterium liquid. Engineering bacteria is carried out after ultrasonic degradation in centrifuging and takingIn the upper cleer and peaceful precipitation of cleer and peaceful precipitation electrophoresis result demonstration, all there is destination protein (Figure 11 B), and original liver targeted interferon masterTo exist with the form of inclusion body (Figure 11 A).
Embodiment 6 abduction delivering condition optimizings
The optimization of inducing temperature: the incubated overnight bacterium liquid of recombinant bacterium is joined to 6 according to the ratio of volume ratio 1:100 LB is housedIn the blake bottle of fluid nutrient medium, 37 DEG C of shaken cultivation are to OD600Behind 0.6 left and right, add again derivant IPTG to final concentrationFor 0.8mmol/L, then 6 blake bottles are placed in respectively to 22 DEG C, 25 DEG C, 28 DEG C, 31 DEG C, lure at 34 DEG C and 37 DEG CLead and cultivate 6h, SDS-PAGE detects and analyzes soluble M uIFN-CSP expression, selects best inducing temperature. Result shows34 DEG C of optimum temperatures for expressing.
Induction starting time is optimized: the incubated overnight bacterium liquid of recombinant bacterium is joined to 7 according to the ratio of volume ratio 1:100 and be equipped withIn the blake bottle of LB fluid nutrient medium, 37 DEG C of joltings are cultured to cell concentration OD600At 0.1,0.2,0.4,0.6,0.8,1.0 andAdding derivant IPTG at 1.2 o'clock is 0.8mmol/L to final concentration again, and then 6h is cultivated in induction, and SDS-PAGE detects analysis canDissolubility MuIFN-CSP expression, selects best induction starting time. Result is presented in the situation that other condition is identical, with OD600Value is that 0.4 o'clock solubility destination protein expression is the highest.
The optimization of derivant IPTG concentration: the incubated overnight bacterium liquid of recombinant bacterium is added according to the ratio of volume ratio 1:100In 8 blake bottles that LB fluid nutrient medium is housed, 2h are cultivated in 37 DEG C of joltings, then add respectively derivant in 8 blake bottlesIPTG is 0.1,0.2,0.4,0.6,0.8,1.0,1.2 and 1.5mmol/L to final concentration, and 6h, SDS-are cultivated in 34 DEG C of inductionsPAGE detects and analyzes soluble M uIFN-CSP expression, selects best IPTG concentration. Result shows with 0.4mmol/L'sWhen derivant carries out abduction delivering, solubility destination protein expression is the highest.
The optimization of induction time: the incubated overnight bacterium liquid of recombinant bacterium is joined to 8 dresses according to the ratio of volume ratio 1:100Have in the blake bottle of LB fluid nutrient medium, 37 DEG C of joltings are cultured to OD600Being about at 0.6 o'clock and adding derivant IPTG to final concentration is0.4mmol/L, is placed in respectively 34 DEG C of shaking table inductions and cultivates 2,4,6,8 and 10 hours, and SDS-PAGE detects and analyzes soluble M uIFN-CSP expression, selects best induction time. Result shows that, with abduction delivering 6 hours, solubility destination protein is expressedMeasure the highest. According to optimizing postcondition induction engineering bacteria, carry out after ultrasonic degradation cleer and peaceful precipitation electrophoresis result in centrifuging and taking and only showIn supernatant, occurred destination protein, and there is no (Figure 11 C) in precipitation, after prompting Optimal Expression condition, destination protein is all with canDissolubility form is expressed.
The separation and purification of embodiment 7 destination protein MuIFN-CSP
By the abduction delivering condition induced gene engineering bacteria after optimizing, 4 DEG C of centrifugal zymotic fluids (6000rpm, 10min) are collected bacteriumCell, takes thalline weight in wet base grams, with the ratio of 1:10 (w:v), bacterial cell is suspended in bacterial lysate to multigelation 3Inferior, then under condition of ice bath, carry out carrying out ultrasonic bacteria breaking, each 50ml, power 40%, broken 2S, stops 2S, altogether 30min. 4 DEG C8000rpm, centrifugal 30min, collects supernatant. Because the destination protein of abduction delivering is with 6 × His label, can with 6 × HisLigand specificity in conjunction with thereby can utilize the HisTrap HP of GEhealthcare and protein purification system to carry out affine layerAnalyse purifying. Filtering with microporous membrane by above-mentioned supernatant with 0.45um, crosses Ni post, and 50mM imidazoles and 50mMTris-Hcl are flatWeighing apparatus, 50mM imidazoles and 50mMTris-Hcl wash away foreign protein, approximately wash 10 times of column volumes, then use 100mM imidazoles and 50mMTris-Hcl washes away foreign protein, approximately washes 3 times of column volumes, finally uses 500mM imidazoles and 50mMTris-Hcl eluted protein,The volume of collecting is about the twice of applied sample amount. The eluent of collecting, concentrated with U-Tubeconcentrator ultrafiltration desalination ,-80DEG C save backup. Analyze through SDS-PAGE, the purity of purified product sudden change liver targeted interferon is greater than 95%(Figure 12). AdoptAgilent1100 efficient liquid phase chromatographic analysis system is carried out sample analysis, and chromatographic column is C18(250 × 4.6mmol/L, 5 μM, and300, Agilent, USA). With 46.5%acetonitrilein0.1% (v/v)The mobile phase balance pillar of trifluoroacetic, carries out 46.5%acetonitrilecontaining0.1% after sample introduction(v/v) trifluoroaceticacid wash-out, flow velocity is 1ml/min, detection wavelength is 220nm. Result is presented at anti-phaseIn chromatogram, only show a single absworption peak, through peak area analysis, purity is greater than 98%(Figure 13).
The determination of activity of embodiment 8 recombination mutation liver targeted interferon MuIFN-CSP
Make WISH cell adherent growth in culture medium. Go down to posterity by 1:2～1:4,2～3 times weekly, (contain 10% in complete culture solutionThe MEM of hyclone) middle growth. The cell of getting cultivation discards nutrient solution, washes 2 times and digests afterwards and collecting cell, with complete with PBSNutrient solution is mixed with every 1ml containing 2.5 × 105～3.5×105The cell suspension of individual cell, is inoculated in 96 porocyte culture plates,Every hole 100 μ l. Under 37 DEG C, 5% carbon dioxide conditions, cultivate 4～6 hours.
To be diluted to the standard solution of series concentration and the liver target of recombinating with measuring culture medium (containing the MEM of 7% hyclone)Move into interferon solution in the culture plate of inoculation WISH cell, every hole adds 100 μ l. Under 37 DEG C, 5% carbon dioxide conditionsCultivate 18～24 hours.
Discard the supernatant in Tissue Culture Plate. Vesicular stomatitis virus (VSV) is cultivated (containing 3% tire ox blood with attacking poisonClear MEM) liquid is diluted to about 100CCID50, every hole 100 μ l. In 37 DEG C, 5% carbon dioxide cultivate 24 hours.
Discard the supernatant in Tissue Culture Plate, every hole adds dyeing liquor (50% crystal violet, 20% absolute ethyl alcohol) 50 μ l, chamberTemperature was placed after 30 minutes, carefully washed away dyeing liquor with flowing water, and blotted residual moisture, and every hole adds destainer (50% anhydrous secondAlcohol, 0.1% acetic acid) 100 μ l, room temperature is placed 3～5 minutes. After mixing, with ELIASA taking 630nm as reference wavelength, at wavelength570nm place measures absorbance. The activity that calculates recombination mutation liver targeted interferon is 1 × 109IU/mg, is significantly higher than formerBeginning liver targeted interferon IFN-CSP(1.2 × 108IU/mg）。
The endotoxin of embodiment 9 recombination mutation liver targeted interferons detects
According to the operation of endotoxin detection kit description, taking bacterial endotoxin standard items as reference, carry out the test of gel limitation:0.1ml TAL is added in the test tube that has 0.1ml recombination mutation liver targeted interferon, sealed membrane sealing, 37 DEG C are incubated 60 pointsZhong Hou, takes out gently, slowly reverses 180 °, observes solution in test tube and has or not formation gel. Testing result shows the restructuring of preparationEndotoxin content in every 4,000 ten thousand IU of sudden change liver targeted interferon is less than 0.25EU, every far below what specify in Chinese pharmacopoeia3000000 IU should be less than 10EU.
Embodiment 10 anti-tumour cell proliferative researchs
(interferon sudden change is exactly sudden change mode of the present invention, and just interferon does not add to adopt mtt assay to evaluate recombination mutation interferonLiver targeting peptides) and the impact of recombination mutation liver targeted interferon on HepG2.2.15 cell proliferation:
HepG2.2.15 cell is 5%CO in the insulating box of 37 DEG C of saturated humidities2The cultivation of going down to posterity, culture medium is for containing 10% tire ox bloodClearly, the DMEM of 100U/ml ampicillin and 100U/ml streptomysin, in the time that Growth of Cells approaches 80% degrees of fusion, uses0.25% Trypsin Induced is made single cell suspension, accurate counting.
Adjusting cell concentration is 1 × 105Cell/ml, is inoculated in 96 porocyte culture plates (dividing 3 groups, 3 every group multiple holes),Cultivate 24 hours after cell attachment, abandon nutrient solution, add respectively containing common recombination mutation interferon and recombination mutation liver targetThe nutrient solution of interferon, negative control group adds the not nutrient solution containing medicine.
Within the 3rd day, abandon culture medium, wash after plate with PBS, every hole adds the 5mg/mlMTT solution of 10 μ l and 100 μ l to cultivateBase is placed in continuation in constant incubator and cultivates 4h. Take out culture plate, supernatant discarded, every hole adds 100 μ lDMSO, will cultivatePlate jolting 30min. Treat that crystallization that MTT oxidation produces is used ELIASA to measure A value after dissolving completely, mensuration wavelength is 490Nm, experiment repeats 3 times, averages. MTT result shows that common recombination mutation interferon and sudden change liver targeted interferon all haveAnti-tumour cell proliferative activity, but sudden change liver targeted interferon activity is obviously better than common recombination mutation interferon (Figure 14).
Embodiment 11 hepatic targeting researchs
Getting body weight is 126 of 18～22g, SPF level Babc mouse, and male and female half and half, are divided into 3 groups at random, 42 every group, and by 0.1The common recombination mutation interferon (9.01ng/g) of the molar doses such as ml/10g tail vein injection, is called for short MuIFN group; Tail is quietArteries and veins injection sudden change liver targeted interferon group (10.09ng/g), is called for short MuIFN-CSP group; Control group is injected isopyknic physiologySalt solution. Every group 42 are divided into 7 groups (6 every group) more at random, respectively at 15min, 30min, 60min, 120min after injection,When 240min, 360min, 480min, de-cervical vertebra is put to death, and then dissects rapidly and takes out liver, cleans filter paper with physiological salineBlot, accurately take each tissue 0.1～1.0g, shred, add sample diluting liquid (containing the PBS of 1%BSA) by 1:3, transfer toPotter-Elvehjem Tissue Grinders, makes tissue homogenate, and 8000rmp low-temperature centrifugation 10min, gets supernatant, doubly suitable with the dilution of dilution buffer liquidNumber, uses ELISA method to press the each biological sample Chinese traditional medicine of step measurements shown in kit concentration. Result shows that physiological saline control group is littleIn rat liver, all do not detect medicine, show that in Mice Body, endogenous mouse interferon can not disturb ELISA method working sample, testDemonstrate,prove the specificity of ELISA method. The knot of sudden change liver targeted interferon MuIFN-CSP group and common recombination mutation interferon groupAs shown in figure 15, MuIFN-CSP organizes each time point liver interferon concentration and is all significantly higher than common recombination mutation interferon group fruit(P value all < 0.001), wherein 30 minutes phase difference maximums after administration, show that the sudden change liver targeted interferon of preparation has significantlyHepatic targeting.
Anti-HBV effect research in embodiment 12 bodies
30 of SPF level Balb/c-HBV transgenic mices, body weight 18～22g, male and female half and half, are divided into five groups at random, and 6 every group,Five groups are respectively: 1. physiological saline control group, 2. common recombination mutation interferon group (103U/g), 3. low dosage sudden change liver targetTo interferon group (101U/g), 4. in dosage sudden change liver targeted interferon group (102U/g), 5. high dose sudden change liver target is dryDisturb plain group (103U/g), carry out respectively therapeutic intervention and physiological saline control experiment. Separately establish 6 of common normal Balb/C mouseFor background group, SPF level, 6～8 weeks, male, body weight 18～22g. Every mouse awards 50 μ l intramuscular injection, every day 1 time, connectsContinuous 4 weeks. After last administration, collect respectively every mice serum sample, adopt ELISA method to detect HBsAg level, withS/N value representation. Mouse is with after yellow Jackets deep anaesthesias (100mg/kg, IP), and cardiac perfusion, collects liver, makes thickDegree is the frozen section of 10～12 μ m, carries out HBsAg immunohistochemical staining: goat anti-HBsAg polyclonal antibody (1:200) be primary antibodie, the anti-goat IgG of donkey (1:200) of Cy3 mark is two anti-; DAPI dyes Vectashield mounting after core, glimmeringUnder light microscope, observe and take pictures. Testing result shows that common recombination mutation interferon and sudden change liver targeted interferon all have and fallLow HBV serum of transgenic mice HBsAg concentration (Figure 16) and liver HBsAg(Figure 17) effect expressed, and sudden change liver target is dryDisturb plain action effect and be significantly better than common recombination mutation interferon.
SEQUENCELISTING
<110>Guangdong Pharmaceutical University
<120>a kind of method of molecular modification liver targeted interferon and the liver targeted interferon of sudden change
<130>
<160>20
<170>PatentInversion3.3
<210>1
<211>184
<212>PRT
<213>liver targeted interferon
<400>1
CysAspLeuProGlnThrHisSerLeuGlySerArgArgThrLeuMet
151015
LeuLeuAlaGlnMetArgArgIleSerLeuPheSerCysLeuLysAsp
202530
ArgHisAspPheGlyPheProGlnGluGluPheGlyAsnGlnPheGln
354045
LysAlaGluThrIleProValLeuHisGluMetIleGlnGlnIlePhe
505560
AsnLeuPheSerThrLysAspSerSerAlaAlaTrpAspGluThrLeu
65707580
LeuAspLysPheTyrThrGluLeuTyrGlnGlnLeuAsnAspLeuGlu
859095
AlaCysValIleGlnGlyValGlyValThrGluThrProLeuMetLys
100105110
GluAspSerIleLeuAlaValArgLysTyrPheGlnArgIleThrLeu
115120125
TyrLeuLysGluLysLysTyrSerProCysAlaTrpGluValValArg
130135140
AlaGluIleMetArgSerPheSerLeuSerThrAsnLeuGlnGluSer
145150155160
LeuArgSerLysGluAspAsnGluLysLeuArgLysProLysHisLys
165170175
LysLeuLysGlnProAlaAspGly
180
<210>2
<211>185
<212>PRT
<213>sudden change liver targeted interferon
<400>2
CysAspLeuProGlnThrHisSerLeuGlyAsnArgArgAlaLeuIle
151015
LeuLeuAlaGlnMetArgArgIleSerProPheSerCysLeuLysAsp
202530
ArgHisAspPheGluPheProGlnGluGluPheAspAspLysGlnPhe
354045
GlnLysAlaGlnAlaIleSerValLeuHisGluMetIleGlnGlnIle
505560
PheAsnLeuPheThrThrLysAspSerSerAlaAlaTrpAspGluAsp
65707580
LeuLeuAspLysPheCysThrGluLeuTyrGlnGlnLeuAsnAspLeu
859095
GluAlaCysValMetGlnGluGluArgValGlyGluThrProLeuMet
100105110
AsnAlaAspSerIleLeuAlaValLysLysTyrPheArgArgIleThr
115120125
LeuTyrLeuThrGluLysLysTyrSerProCysAlaTrpGluValVal
130135140
ArgAlaGluIleMetArgSerLeuSerLeuSerThrAsnLeuGlnGlu
145150155160
ArgLeuArgArgLysGluAspAsnGluLysLeuArgLysProLysHis
165170175
LysLysLeuLysGlnProAlaAspGly
180185
<210>3
<211>555
<212>DNA
<213>before sudden change liver targeted interferon nucleotide sequence is optimized
<400>3
tgtgatctgcctcagactcacagcctgggtaacaggagggccttgatactcctggcacaa60
atgcgaagaatctctcctttctcctgcctgaaggacagacatgactttgaattcccccag120
gaggagtttgatgataaacagttccagaaggctcaagccatctctgtcctccatgagatg180
atccagcagatcttcaacctctttaccacaaaagattcatctgctgcttgggatgaggac240
ctcctagacaaattctgcaccgaactctaccagcagctgaatgacttggaagcctgtgtg300
atgcaggaggagagggtgggagaaactcccctgatgaatgcggactccatcttggctgtg360
aagaaatacttccgaagaatcactctctatctgacagagaagaaatacagcccttgtgcc420
tgggaggttgtcagagcagaaatcatgagatccctctctttatcaacaaacttgcaagaa480
agattaaggaggaaggaagacaacgagaaattaaggaaaccaaaacataaaaaattaaag540
caaccagcggatggt555
<210>4
<211>555
<212>DNA
<213>after sudden change liver targeted interferon nucleotide sequence is optimized
<400>4
tgtgatctgcctcagactcacagcctgggtaaccgtcgtgccttgattctcctggcacaa60
atgcgtcgtatctctcctttctcctgcctgaaggaccgtcatgactttgaattcccacag120
gaggagtttgatgataaacagttccagaaggctcaagccatctctgtcctccatgagatg180
atccagcagatcttcaacctctttaccacaaaagattcatctgctgcttgggatgaggac240
ctccttgacaaattctgcaccgaactctaccagcagctgaatgacttggaagcctgtgtg300
atgcaggaggagcgtgtgggagaaactccactgatgaatgcggactccatcttggctgtg360
aagaaatacttccgtcgtatcactctctatctgacagagaagaaatacagcccttgtgcc420
tgggaggttgtccgtgcagaaatcatgcgttccctctctttatcaacaaacttgcaagaa480
cgtttacgtcgtaaggaagacaacgagaaattacgtaaaccaaaacataaaaaattaaag540
caaccagcggatggt555
<210>5
<211>29
<212>DNA
<213>primer I C1
<400>5
ggaattccatatgtgtgatctgcctcaga29
<210>6
<211>58
<212>DNA
<213>primer I C2
<400>6
gtgccaggagaatcaaggcacgacggttacccaggctgtgagtctgaggcagatcaca58
<210>7
<211>58
<212>DNA
<213>primer I C3
<400>7
gccttgattctcctggcacaaatgcgtcgtatctctcctttctcctgcctgaaggacc58
<210>8
<211>58
<212>DNA
<213>primer I C4
<400>8
tatcatcaaactcctcctgtgggaattcaaagtcatgacggtccttcaggcaggagaa58
<210>9
<211>58
<212>DNA
<213>primer I C5
<400>9
caggaggagtttgatgataaacagttccagaaggctcaagccatctctgtcctccatg58
<210>10
<211>58
<212>DNA
<213>primer I C6
<400>10
cttttgtggtaaagaggttgaagatctgctggatcatctcatggaggacagagatggc58
<210>11
<211>58
<212>DNA
<213>primer I C7
<400>11
aacctctttaccacaaaagattcatctgctgcttgggatgaggacctccttgacaaat58
<210>12
<211>58
<212>DNA
<213>primer I C8
<400>12
cttccaagtcattcagctgctggtagagttcggtgcagaatttgtcaaggaggtcctc58
<210>13
<211>58
<212>DNA
<213>primer I C9
<400>13
cagctgaatgacttggaagcctgtgtgatgcaggaggagcgtgtgggagaaactccac58
<210>14
<211>58
<212>DNA
<213>primer I C10
<400>14
agtatttcttcacagccaagatggagtccgcattcatcagtggagtttctcccacacg58
<210>15
<211>58
<212>DNA
<213>primer I C11
<400>15
ttggctgtgaagaaatacttccgtcgtatcactctctatctgacagagaagaaataca58
<210>16
<211>58
<212>DNA
<213>primer I C12
<400>16
gcatgatttctgcacggacaacctcccaggcacaagggctgtatttcttctctgtcag58
<210>17
<211>58
<212>DNA
<213>primer I C13
<400>17
gtccgtgcagaaatcatgcgttccctctctttatcaacaaacttgcaagaacgtttac58
<210>18
<211>47
<212>DNA
<213>primer I C14
<400>18
cgtaatttctcgttgtcttccttacgacgtaaacgttcttgcaagtt47
<210>19
<211>53
<212>DNA
<213>primer I C15
<400>19
gacaacgagaaattacgtaaaccaaaacataaaaaattaaagcaaccagcgga53
<210>20
<211>30
<212>DNA
<213>primer I C16
<400>20
ccgctcgagaccatccgctggttgctttaa30
Claims (5)
1. a method for molecular modification liver targeted interferon, is characterized in that, from aminoterminal, by 11 amino acids by silkPropylhomoserin be mutated into asparagine, 14 amino acids by threonine be mutated into alanine, 16 amino acids are mutated into by methionineIsoleucine, 26 amino acids by leucine be mutated into proline, 37 with 102 amino acids by glycine mutation become glutamic acid,44 amino acids are become aspartic acid, between 44 and 45, are inserted aspartic acid by glycine mutation, and 45 amino acids are by asparagus fernAcid amides be mutated into lysine, 51 amino acids by glutamic acid be mutated into glutamine, 52 amino acids are mutated into third by threoninePropylhomoserin, 54 amino acids by proline be mutated into serine, 68 amino acids become threonine, 79 amino acids by mutant serineBy threonine be mutated into aspartic acid, 85 amino acids are mutated into cysteine, 100 amino acids by isoleucine by tyrosineBe mutated into methionine, 103 amino acids by a word used in person's names propylhomoserin be mutated into glutamic acid, 104 amino acids become smart ammonia by glycine mutationAcid, 106 amino acids by threonine be mutated into glycine, 112 amino acids become asparagine, 113 ammonia by lysine mutationBase acid by glutamic acid be mutated into alanine, 120 amino acids are mutated into lysine, 124 amino acids by glutamy by arginineAmine is mutated into arginine, 131 amino acids become threonine, 151 amino acids to be mutated into bright by phenylalanine by lysine mutationPropylhomoserin, 160 becomes arginine with 163 amino acids by mutant serine.
2. a liver targeted interferon for sudden change, is characterized in that, its amino acid sequence is as shown in SEQIDNO:2.
3. an encoding gene for the liver targeted interferon of sudden change, is characterized in that, its nucleotide sequence as SEQIDNO:3 orShown in 4.
4. contain the recombinant vector of encoding gene described in claim 3 or 4.
5. the liver targeted interferon suddenling change described in claim 2 is in the application of preparing in antiviral and cancer therapy drug.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510923107.8A CN105602976A (en) | 2015-12-14 | 2015-12-14 | Method for molecular modification of liver-targeting interferon, and mutant liver-targeting interferon |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510923107.8A CN105602976A (en) | 2015-12-14 | 2015-12-14 | Method for molecular modification of liver-targeting interferon, and mutant liver-targeting interferon |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN105602976A true CN105602976A (en) | 2016-05-25 |
Family
ID=55983319
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510923107.8A Pending CN105602976A (en) | 2015-12-14 | 2015-12-14 | Method for molecular modification of liver-targeting interferon, and mutant liver-targeting interferon |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105602976A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108484749A (en) * | 2018-03-27 | 2018-09-04 | 山东省医药生物技术研究中心（山东省病毒研究所） | A kind of recombinant soluble human source Bone targeting gamma interferon 1-b and preparation method thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102268093A (en) * | 2011-06-27 | 2011-12-07 | 广东药学院 | Fusion protein of hepatic-targeted peptide and human interferon a2b, and preparation method and application thereof |
-
2015
- 2015-12-14 CN CN201510923107.8A patent/CN105602976A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102268093A (en) * | 2011-06-27 | 2011-12-07 | 广东药学院 | Fusion protein of hepatic-targeted peptide and human interferon a2b, and preparation method and application thereof |
Non-Patent Citations (2)
| Title |
|---|
| ANDREAS MEISTER等: "Biological Activities and Receptor Binding of Two Human Recombinant Interferons and their Hybrids", 《J GEN VIROL》 * |
| 田凤文等主编: "《临床常用药物汇编》", 31 May 2008, 济南出版社 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108484749A (en) * | 2018-03-27 | 2018-09-04 | 山东省医药生物技术研究中心（山东省病毒研究所） | A kind of recombinant soluble human source Bone targeting gamma interferon 1-b and preparation method thereof |
| CN108484749B (en) * | 2018-03-27 | 2020-10-02 | 山东省医药生物技术研究中心（山东省病毒研究所） | Recombinant soluble human bone-targeted interferon gamma-1 b and preparation method thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102573917B (en) | Pegylated L-asparaginase | |
| CN106632682A (en) | Fusion protein IFN-ELP and application thereof | |
| CN101143894A (en) | Highly effective polypeptide for inhibiting angiogenesis, physical chemistry modifying method and application thereof | |
| CN104311671B (en) | Long-acting fused interferon of cat and preparation method and application | |
| CN102816246B (en) | Human cytomegalo virus immunogen fusion protein as well as preparation method and usage thereof | |
| CN102397559B (en) | Broad spectrum type influenza vaccine and preparation method thereof | |
| CN101879312B (en) | Broad spectrum type influenza vaccine and preparation method thereof | |
| CN105602975A (en) | Method for heterogenous soluble expression of liver-targeted interferon | |
| CN105602976A (en) | Method for molecular modification of liver-targeting interferon, and mutant liver-targeting interferon | |
| CN106955361A (en) | A kind of pharmaceutical composition containing tuberculosis allergen CE | |
| CN102731658B (en) | Tat PTD-Endostatin recombination protein, preparation method and application thereof | |
| CN106883299A (en) | Adipose tissue target polypeptide and its preparation method and application | |
| CN105037523A (en) | Interferon mutant and polyethylene glycol derivative thereof | |
| CN114539426B (en) | Fusion protein containing interferon alpha, recombinant strain expressing fusion protein and preparation method of recombinant strain | |
| CN105504063A (en) | Defensin-albumin anti-tumor fusion protein and preparation and application thereof | |
| CN102121013A (en) | Mature chicken interferon-alpha gene capable of high-efficiency expression and preparation method of polypeptide thereof | |
| CN101781369A (en) | Recombinant human arginase fusion protein and application thereof | |
| CN105112391B (en) | A kind of people source arginase mutant and its preparation method and application | |
| WO2017101089A1 (en) | Fusion protein for á melanocyte stimulating hormone and preparation method and use thereof | |
| CN101857871B (en) | Method for purifying recombinant VP1 antigen of enterovirus type 71 viruses | |
| CN107226858A (en) | Interferon macromolecule combination IFN-PMPC preparation and its application | |
| CN106674325A (en) | Method of preparing interferon macromolecular combination IFN-POEGMA | |
| CN103288968B (en) | An anti-tumor targeting complex and a preparation method and applications thereof | |
| CN102925519B (en) | Preparation process of recombinant hepatic targeting interferon | |
| CN102559725A (en) | Human stem cell growth factor as well as production method and application of polyethylene glycol (PEG) modified human stem cell growth factor |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB02 | Change of applicant information | ||
| CB02 | Change of applicant information |
Address after: No. 280, outer ring road, Guangzhou, Guangdong Province, Guangdong Applicant after: Guangdong Pharmaceutical University Address before: No. 280, outer ring road, Guangzhou, Guangdong Province, Guangdong Applicant before: Guangdong Pharmaceutical University |
|
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20160525 |