CN105602950B - Polyketone biological synthesis gene cluster and its amplimer and kit in a kind of streptomycete - Google Patents
Polyketone biological synthesis gene cluster and its amplimer and kit in a kind of streptomycete Download PDFInfo
- Publication number
- CN105602950B CN105602950B CN201610127506.8A CN201610127506A CN105602950B CN 105602950 B CN105602950 B CN 105602950B CN 201610127506 A CN201610127506 A CN 201610127506A CN 105602950 B CN105602950 B CN 105602950B
- Authority
- CN
- China
- Prior art keywords
- sequence
- primer
- primer shown
- pair
- primer pair
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/102—Mutagenizing nucleic acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Analytical Chemistry (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Biomedical Technology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Crystallography & Structural Chemistry (AREA)
- Plant Pathology (AREA)
- Immunology (AREA)
- Medicinal Chemistry (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses polyketone biological synthesis gene cluster in a kind of streptomycete and its amplimer and kit.The invention provides primer set, be made up of the primer pair 44 of primer pair 1；Additionally provide the PCR reagent for expanding polyketone biological synthesis gene cluster, including above-mentioned primer pair, PCR amplification buffers (KOD plus Buffer), DMSO, dNTP, MgSO4With archaeal dna polymerase (KOD plus enzymes).The experiment proves that, primer involved in the present invention have good high efficiency, specificity and sensitivity, available for detect other streptomycetes whether contain polyketone biological synthesis gene cluster.
Description
Technical field
The present invention relates to microbiological genetic engineering field, and in particular in a kind of streptomycete polyketone biological synthesis gene cluster and
Its amplimer and kit.
Background technology
Streptomycete is the gram-positive bacterium that a class derives from soil, and it can produce abundant secondary metabolite,
It can be widely applied in terms of people, animal and agricultural antibiotic element, antifungal agent, there is important application value to the mankind.It is used as one
The important industrial microorganism of class, is increasingly taken seriously on its research.With the development of streptomyces gene engineering technology, gram
Grand secondary metabolite biosynthesis gene, identify synthetic gene function, and purposefully directional transformation gene, in gene water
The flat production capacity for changing strain is increasingly becoming the focus of research.Due to the weight of secondary metabolism of Streptomyces product biosynthesis gene
Act on, so the clone of biosynthesis gene is carried out from different streptomycete bacterial strains has important practical significance.Strepto-
Bacterium secondary metabolite biosynthesis gene is typically what cluster was arranged, includes many correlation function genes, the confrontation of these genes
Raw element yield tool has a significant impact.
During secondary metabolism of Streptomyces, partly there is polyketides biological synthesis gene cluster, it is condensed with carboxylic acid
What reaction formation was carried out.Such as erythromycin (Streptomyces erytheara) and nystatin (Streptomyces
Noursei polyketides biological synthesis gene cluster) is contained in producing strains.Wuyiencin is by S. ahygroscopicus Wuyi
A kind of biological pesticide that mutation (Streptomyces ahygroscopicus var.wuyiensis) is produced, with efficient, wide
The characteristics of spectrum, low toxicity, it is widely used in the ecological agriculture and pollution-free food production.The production of Wuyiencin is to utilize
Cultivate S. ahygroscopicus Wuyi mutation, the secondary metabolite of the microorganism produced by biological submerged fermentation.Study Wuyi
The synthetic gene of rhzomorph, important theoretical foundation is provided for genetic engineering breeding, exploitation and wound for improving new strains
Level processed has important effect.But, because streptomycete G/C content itself is very high, hairpin structure is easily formed, it is polygenic
Clone difficulty larger.Therefore, it is very necessary for the clone of gene cluster to screen efficient, special, sensitive specific primer.
The content of the invention
It is an object of the present invention to provide a kind of primer set for being used to expand polyketone biological synthesis gene cluster.
The primer set that the present invention is provided, is made up of primer pair 1- primer pairs 44；
The primer pair 1 is made up of the primer shown in the primer shown in sequence 1 and sequence 2；
The primer pair 2 is made up of the primer shown in the primer shown in sequence 3 and sequence 4；
The primer pair 3 is made up of the primer shown in the primer shown in sequence 5 and sequence 6；
The primer pair 4 is made up of the primer shown in the primer shown in sequence 7 and sequence 8；
The primer pair 5 is made up of the primer shown in the primer shown in sequence 9 and sequence 10；
The primer pair 6 is made up of the primer shown in the primer shown in sequence 11 and sequence 12；
The primer pair 7 is made up of the primer shown in the primer shown in sequence 13 and sequence 14；
The primer pair 8 is made up of the primer shown in the primer shown in sequence 15 and sequence 16；
The primer pair 9 is made up of the primer shown in the primer shown in sequence 17 and sequence 18；
The primer pair 10 is made up of the primer shown in the primer shown in sequence 19 and sequence 20；
The primer pair 11 is made up of the primer shown in the primer shown in sequence 21 and sequence 22；
The primer pair 12 is made up of the primer shown in the primer and sequence 24 shown in sequence 23；
The primer pair 13 is made up of the primer shown in the primer shown in sequence 25 and sequence 26；
The primer pair 14 is made up of the primer shown in the primer shown in sequence 27 and sequence 28；
The primer pair 15 is made up of the primer shown in the primer shown in sequence 29 and sequence 30；
The primer pair 16 is made up of the primer shown in the primer shown in sequence 31 and sequence 32；
The primer pair 17 is made up of the primer shown in the primer shown in sequence 33 and sequence 34；
The primer pair 18 is made up of the primer shown in the primer shown in sequence 35 and sequence 36；
The primer pair 19 is made up of the primer shown in the primer shown in sequence 37 and sequence 38；
The primer pair 20 is made up of the primer shown in the primer shown in sequence 39 and sequence 40；
The primer pair 21 is made up of the primer shown in the primer shown in sequence 41 and sequence 42；
The primer pair 22 is made up of the primer shown in the primer shown in sequence 44 and sequence 44；
The primer pair 23 is made up of the primer shown in the primer shown in sequence 45 and sequence 46；
The primer pair 24 is made up of the primer shown in the primer shown in sequence 47 and sequence 48；
The primer pair 25 is made up of the primer shown in the primer shown in sequence 49 and sequence 50；
The primer pair 26 is made up of the primer shown in the primer shown in sequence 51 and sequence 52；
The primer pair 27 is made up of the primer shown in the primer shown in sequence 53 and sequence 54；
The primer pair 28 is made up of the primer shown in the primer shown in sequence 55 and sequence 56；
The primer pair 29 is made up of the primer shown in the primer shown in sequence 57 and sequence 58；
The primer pair 30 is made up of the primer shown in the primer shown in sequence 59 and sequence 60；
The primer pair 31 is made up of the primer shown in the primer shown in sequence 61 and sequence 62；
The primer pair 32 is made up of the primer shown in the primer shown in sequence 63 and sequence 64；
The primer pair 33 is made up of the primer shown in the primer shown in sequence 65 and sequence 66；
The primer pair 34 is made up of the primer shown in the primer shown in sequence 67 and sequence 68；
The primer pair 35 is made up of the primer shown in the primer shown in sequence 69 and sequence 70；
The primer pair 36 is made up of the primer shown in the primer shown in sequence 71 and sequence 72；
The primer that the primer pair 37 is shown by the primer shown in sequence 73 and sequence 74 is constituted；
The primer pair 38 is made up of the primer shown in the primer shown in sequence 75 and sequence 76；
The primer pair 39 is made up of the primer shown in the primer shown in sequence 77 and sequence 78；
The primer pair 40 is made up of the primer shown in the primer shown in sequence 79 and sequence 80；
The primer pair 41 is made up of the primer shown in the primer shown in sequence 81 and sequence 82；
The primer pair 42 is made up of the primer shown in the primer shown in sequence 83 and sequence 84；
The primer pair 43 is made up of the primer shown in the primer shown in sequence 85 and sequence 86；
The primer pair 44 is made up of the primer shown in the primer shown in sequence 87 and sequence 88.
Another object of the present invention is to provide the PCR reagent for expanding polyketone biological synthesis gene cluster.
The PCR reagent that the present invention is provided, including above-mentioned primer pair, PCR amplification buffers (KOD plus Buffer),
DMSO、dNTP、MgSO4With archaeal dna polymerase (KOD plus enzymes).
In above-mentioned PCR reagent, the mol ratio in the primer pair in every primer is 1：1.
Kit containing above-mentioned primer pair or above-mentioned primer pair is also the scope of protection of the invention.
Application of the above-mentioned primer pair or the kit of above-mentioned primer pair in amplification polyketone biological synthesis gene cluster
It is the scope of protection of the invention.
Whether above-mentioned primer pair or the kit of above-mentioned primer pair are biological containing polyketone in streptomycete to be measured is detected
Application in synthetic gene cluster is also the scope of protection of the invention.
In above-mentioned application, detect whether the method containing polyketone biological synthesis gene cluster includes following step in streptomycete to be measured
Suddenly：The genomic DNA of streptomycete to be measured is extracted, entering performing PCR with 44 primer pairs shown in table 2 respectively expands, and obtains 44 pieces
Section；Again with DNAMAN softwares by this 44 fragment assemblies, if splicing obtains the polyketone biological synthesis gene cluster shown in sequence 89,
Contain the polyketone biological synthesis gene cluster shown in sequence 89 in streptomycete to be measured；If the polyketone obtained shown in sequence 89 can not be spliced
Biological synthesis gene cluster, then do not contain the polyketone biological synthesis gene cluster shown in sequence 89 in streptomycete to be measured.
In above-mentioned, the polyketone biological synthesis gene cluster is by following 1) -5) the complete genomic constitution of totally 5 classes：
1) it is responsible for the complete gene of the long chain backbone synthesis of polyketone：WysI, wysJ, wysK, wysA, wysB and wysC；
2) complete gene wysR, wysRII, wysRIII, wysPI, wysPII and wysPIII of encoding regulator；
3) the complete gene of abc transport albumen is encoded：WysG and wysH；
4) the complete gene of the synthesis and attachment of encoding glycosyl：WysDI, wysDII and wysDIII；
5) the complete gene of other rear modified proteins and unknown function albumen is encoded：WysL, wysM, wysN, wysE and
wysF。
Above-mentioned polyketone biological synthesis gene cluster is to be following 1) to any described DNA molecular in 3)：
1) DNA molecular in sequence table shown in sequence 89；
2) hybridize and the DNA molecular with identical function with the DNA molecular of 1) restriction under strict conditions；
3) there is more than 90% homology and the DNA molecular with identical function with the DNA molecular of 1) restriction.
Above-mentioned stringent condition can be in 6 × SSC, 0.5%SDS solution, to hybridize at 65 DEG C, then with 2 × SSC,
0.1%SDS and 1 × SSC, 0.1%SDS respectively wash film once.
Another object of the present invention is to provide a kind of gene cluster.
The gene cluster that the present invention is provided, by following 1) -5) the complete genomic constitution of totally 5 classes：
1) it is responsible for the complete gene of the long chain backbone synthesis of polyketone：WysI, wysJ, wysK, wysA, wysB and wysC；
2) complete gene wysR, wysRII, wysRIII, wysPI, wysPII and wysPIII of encoding regulator；
3) the complete gene of abc transport albumen is encoded：WysG and wysH；
4) the complete gene of the synthesis and attachment of encoding glycosyl：WysDI, wysDII and wysDIII；
5) the complete gene of other rear modified proteins and unknown function albumen is encoded：WysL, wysM, wysN, wysE and
wysF。
Said gene cluster is to be following 1) to any described DNA molecular in 3)：
1) DNA molecular in sequence table shown in sequence 89；
2) hybridize and the DNA molecular with identical function with the DNA molecular of 1) restriction under strict conditions；
3) there is more than 90% homology and the DNA molecular with identical function with the DNA molecular of 1) restriction.
Above-mentioned stringent condition can be in 6 × SSC, 0.5%SDS solution, to hybridize at 65 DEG C, then with 2 × SSC,
0.1%SDS and 1 × SSC, 0.1%SDS respectively wash film once.
The experiment proves that, primer involved in the present invention has good high efficiency, specificity and sensitivity, can
For detecting whether other streptomycetes contain polyketone biological synthesis gene cluster.
Brief description of the drawings
Fig. 1 is wysR transgenic strains and starting strain CK-15 Molecular Identification.
Fig. 2 is the HPLC collection of illustrative plates that wysR transgenic strains and starting strain CK-15 fermentations produce Wuyiencin.
Fig. 3 is wysRII transgenic strains and starting strain CK-15 Molecular Identification.
Fig. 4 is wysRII transgenic strains and starting strain CK-15 phenotypic evaluation.
Fig. 5 is wysRII transgenic strains and starting strain CK-15 mycelium dry weight result.
Fig. 6 detects for primer specificity.
Fig. 7 detects for primer generality.
Fig. 8 is CK44AF/CK44AR amplifications.
Fig. 9 is CK44BF/CK44BR amplifications.
Figure 10 is CK24F/CK24R amplifications.
Figure 11 is primer pair sensitivity analysis.
Embodiment
Experimental method used in following embodiments is conventional method unless otherwise specified.
Material, reagent used etc., unless otherwise specified, are commercially obtained in following embodiments.
Embodiment 1, the excavation of polyketone biological synthesis gene cluster and whole genome sequence are scanned
By to streptomycete (Streptomyces ahygroscopicus var.wuyiensis CK-15) genome
Fosmid is screened in library, obtains positive plasmid 3E11 and 6E11.Sequencing analysis are carried out to positive plasmid, are obtained altogether about
53kb sequence；Discovery, Wuyiencin producing strains CK-15 genomes are scanned to full-length genome with reference to high throughput sequencing technologies
Size about 9410232bp, G+C contents are up to 72.25%.Gene order-checking result is committed to antiSMASH, 47 are predicted altogether
Secondary metabolite biological synthesis gene cluster is planted, wherein including polyketone biological synthesis gene cluster.
Bioinformatic analysis shows that the nucleotides sequence of polyketone biological synthesis gene cluster is classified as sequence 89 in sequence table, its
Be made up of gene cluster 122844bp nucleotides, altogether comprising 22 ORFs, wherein WysI, WysJ, WysK, WysA, WysB,
WysC6 gene is responsible for the synthesis of the long chain backbone of polyketone；WysR, WysRII, WysRIII, WysPI, WysPII, WysPIII6
The gene of encoding regulator；WysG, WysH2 gene code abc transport albumen；WysDI, WysDII, WysDIII totally 3 bases
Because of the synthesis and attachment of encoding glycosyl；WysL, WysM, WysN, WysE, WysF totally 5 other rear modified proteins of gene code with
The albumen of unknown function.
The functional analysis of the polyketone biological synthesis gene cluster of table 1
The preparation of embodiment 2, the primer for expanding polyketone biological synthesis gene cluster and kit
First, synthesized for expanding the optimal design of primers of polyketone biological synthesis gene cluster
The polyketone biological synthesis gene cluster obtained according to embodiment 1, carries out design of primers, and screening obtains the expansion shown in table 2
Increase good 44 pairs of primers, 44, the 44 pairs of primers of specificity for gene it is as shown in table 3.2nd, primer specificity is detected
Using primer pair WyF23/WyR23, WyF24/WyR24, WyF41/WyR41, WyF42/WyR42, WyF44/WyR44 as
Example：
Using Wuyiencin producing strains CK-15 as template, respectively with primer pair WyF23/WyR23, WyF24/ shown in table 2
WyR24, WyF41/WyR41, WyF42/WyR42, WyF44/WyR44 enter performing PCR amplification.
The electrophoresis result of pcr amplification product as shown in fig. 6, wherein, 1-5 be followed successively by WyF23/WyR23 amplified productions,
WyF24/WyR24 amplified productions, WyF41/WyR41 amplified productions, Wy42/WyR42 amplified productions, WyF44/WyR44 amplification productions
Thing, obtains clip size and is followed successively by 1672bp, 1929bp, 1868bp, 1825bp, 1114bp, and is high single of specificity
Band.
Remaining 38 primer pair detects that specificity is high using same method.
3rd, primer generality is detected
Fragment is in the similarity analysis of table 1, and polyketone biological synthesis gene cluster has certain guard in streptomycete
Property, therefore whether the primer of research and design also has generality, with primer pair WyF14/WyR14, WyF44/WyR44, WyF7/
Exemplified by WyR7：
Respectively with Wuyiencin producing strains (Streptomyces ahygroscopicus var.wuyiensis CK-15)
Genomic DNA, nystatin (Streptomyces noursei) producing strains (Brautaset T, Sekurova ON, Sletta
H,et al.,Biosynthesis of the polyene antifungal antibiotic nystatin in
Streptomyces noursei ATCC 11455:analysis of the gene cluster and deduction of
the biosynthetic pathway.Chemistry and Biology,2000,7(6):395-403.) genomic DNA and
Streptomyces albulus NK660 (Streptomyces albus NK660Gu YY, Yang C, Wang XM, et al., Genome
Sequence of-Poly-L-Lysine-Producing Strain Streptomyces albulus NK660,
Isolated from Soil in Gutian,Fujian Province,China.Gennome announcements,
2014,2(3):E00532-14. genomic DNA) is template, respectively with primer pair WyF15/WyR15, WyF30/WyR30 and
WyF8/WyR8 enters performing PCR amplification.
Pcr amplification product is as shown in fig. 7, swimming lane 1,2,3 is respectively Wuyiencin producing strains (Streptomyces
Ahygroscopicus var.wuyiensis CK-15), nystatin (Streptomyces noursei) producing strains and small
Streptomyces albus NK660 (Streptomyces albus NK660) uses WyF14 primer pair amplifies products, amplifies simultaneously
2694bp purpose band, and band is amplified with specificity, work well；Swimming lane 4,5,6 is respectively that Wuyiencin is produced
Bacterium (Streptomyces ahygroscopicus var.wuyiensis CK-15), nystatin (Streptomyces
Noursei) producing strains and streptomyces albulus NK660 (Streptomyces albus NK660) use WyF44 primer pair amplifies
Product, amplifies 1114bp purpose band；Swimming lane 7,8,9 is respectively Wuyiencin producing strains (Streptomyces
Ahygroscopicus var.wuyiensis CK-15), nystatin (Streptomyces noursei) producing strains and small
Streptomyces albus NK660 (Streptomyces albus NK660) uses WyF7 primer pair amplifies products, amplifies simultaneously
2165bp purpose band, and band is amplified with specificity, work well.
Remaining 38 primer pair detects that specificity is high using same method.
In summary, have one using the polyketide biological synthesis gene cluster in 44 primer pair amplifies streptomycetes
Fixed specificity, reliability, conservative and generality, in view of These characteristics can be used for detecting whether contain in other streptomycetes
The polyketide biological synthesis gene cluster of this type.
Table 2 clones the primer sequence table of polyketone biological synthesis gene cluster
Table 3 is the corresponding primer pair of each gene
4th, the selection of primer
For the target fragment of each primer pair in above-mentioned one 44 primer pairs, design synthesis is used to expand same target piece
The control primer of section, but its specificity is poor, the purpose band dimer either amplified is more or primer band is not clear
It is aobvious, or mesh band can not be amplified completely, rejected for the primer of these types.
WyF44/WyR44 and WyF24/WyR24 are illustrated：
2 control primers CK44AF/CK44AR and CK44BF/ of design simultaneously when designing primer pair WyF44/WyR44
CK44BR；CK24F/CK24R is designed during design primer pair WyF24/WyR24 simultaneously.
With Wuyiencin producing strains (Streptomyces ahygroscopicus var.wuyiensis CK-15) gene
Group DNA is template, respectively with WyF44/WyR44, WyF24/WyR24, CK44AF/CK44AR, CK44BF/CK44BR, CK24F/
CK24R enters performing PCR amplification.
CK44AF:5'TGCGTTGGCGCTGTATCGG 3'
CK44AR:5'AAGAGGACCACGCGGTGTC 3'
CK44BF：5'CCTGGTCGAGCTACTGGG 3'
CK44BR：5'ACAGCGGCTGATCGGCAACG 3'
CK24F:5'GCTGGACGCTGCGTGGCATTT 3'
CK24R：5'GCCTCGGAGCTGAGGAAGA 3'
WyF44/WyR44 amplifications such as Fig. 7 swimming lane 4, it can be seen that amplify 1114bp special purpose band；
WyF24/WyR24 amplifications such as Fig. 6 swimming lane 2, it can be seen that amplify 1929bp special purpose band；
CK44AF/CK44AR amplifications are as shown in Figure 8, it can be seen that amplify 1175bp purpose bands, but drag
Tail, primer specificity is poor.
CK44BF/CK44BR amplifications are as shown in Figure 9, it can be seen that the amplification without purpose band.
CK24F/CK24R amplifications are as shown in Figure 10, it can be seen that the amplification without obvious purpose band.
Remaining 41 primer pair detects that these primer pairs that only present invention is selected are expanding effect using same method
Best primer pair.
5th, primer pair sensitivity analysis
The sensitivity of primer is verified by taking primer pair WyF24/WyR24 and WyF26/WyR26 as an example：
Wuyiencin producing strains (Streptomyces ahygroscopicus var.wuyiensisCK-15) genome
DNA concentration is 200mg/ml, is then diluted (10 with 10 times of gradients0-10-5), the DNA after gradient dilution is used for template,
Enter performing PCR with WyF24/WyR24 and WyF26/WyR26 respectively to expand.
As a result as shown in figure 11, left figure expands for primer pair WyF24/WyR24, and swimming lane 1-6 is respectively with various concentrations DNA
Dilution gradient (100-10-5) specific band of WyF26 fragments that goes out for template amplification；Right figure is primer pair WyF26/WyR26
Amplification, swimming lane 1-6 is respectively with various concentrations DNA dilution gradients (100-10-5) it is the special of the WyF26 fragments that template amplification goes out
Property band；As can be seen that WyF24/WyR24 primer pairs are 10 in DNA concentration-4When, still be able to clearly amplify size be
1929bp purpose bands；When DNA concentration is 10-5When, the definition of purpose band can decline, and illustrate the sensitive of WyF24 primer pairs
Performance enough reaches 10-5；
WyF26 primer pairs are 10 in DNA concentration-3When, it still is able to clearly amplify size for 2858bp purpose bands；When
DNA concentration is 10-4When, the definition of purpose band can decline, and illustrate the sensitivity of WyF26 primer pairs and can reach 10-4。
Using same method, the sensitivity to other 42 primer pairs is detected, can reach 10-4Level above.
5th, the kit containing primer
After 44 pairs of independent packagings of primer of table 2, then it is packaged to be kit.
The amplification of embodiment 3, polyketone biological synthesis gene cluster
Wuyiencin producing strains CK-15 genomic DNAs are extracted, enters performing PCR with 44 primer pairs shown in table 2 respectively and expands
Increase, obtain 44 fragments.This 44 fragments are spliced with DNAMAN softwares again, the polyketone biology shown in sequence 89 is obtained and closes
Into gene cluster.
The reaction system of above-mentioned amplification：10 × KOD plus Buffer 2.5uL, dNTP 2.5uL, DMSO (100%)
2uL, MgSO41uL, KOD plus enzymes 0.5uL, forward and reverse primer (10umol/L) each 1uL, DNA profiling 1uL, sterile ultra-pure water
Complement to 25uL.
The program of above-mentioned amplification：94 DEG C of pre-degeneration 5min；94 DEG C of denaturation 30s, 60 DEG C of annealing 30s, 68 DEG C extend 4min, 32
Individual circulation；68 DEG C of extension 10min.
Remaining component that each amplification reaction system removes DNA profiling can be used as 1 PCR reagent, 44 primer pairs pair
44 PCR reagents are answered, 44 PCR reagents are individually packed, then are packaged into kit.
Splicing obtains the Wuyiencin biological synthesis gene cluster shown in sequence 89, and 22 genes that it contains are as follows：
(1) it is responsible for the gene of polyketone chain backbone synthesis, i.e. wysI, wysJ, wysK, wysA, wysB, wysC, totally 6 bases
Cause：
[1] wysI is located at gene cluster nucleotide sequence (sequence 89) the 5463-33974 base, and length is 28512
Base-pair, encodes polyketide synthase, 9503 amino acid；
[2] wysJ is located at the 33983-50275 base of gene cluster nucleotide sequence, and length is 16293 base-pairs,
Encode polyketide synthase, 5440 amino acid；
[3] wysK is located at the 50331-56501 base of gene cluster nucleotide sequence, and length is 6171 base-pairs,
Encode 2056 amino acid of polyketide synthase；
[4] wysA is located at the 62176-66306 base of gene cluster nucleotide sequence, and length is 4131 base-pairs,
Encode polyketide synthase, 1376 amino acid；
[5] wysB is located at the 66352-75930 base of gene cluster nucleotide sequence, and length is 9579 base-pairs,
Encode polyketide synthase, 3192 amino acid；
[6] wysC is located at the 75950-109189 base of gene cluster nucleotide sequence, and length is 33240 bases
It is right, encode polyketide synthase, 11079 amino acid；
(2) controlling gene, i.e. wysPI, wysPII, wysPIII, wysR, wysRII, wysRIII, totally 6 genes：
[1] wysPI is located at the 110695-113550 base of gene cluster nucleotide sequence, and length is 2856 bases
It is right, encoding regulator albumen, 951 amino acid；
[2] wysPII is located at the 113652-116442 base of gene cluster nucleotide sequence, and length is 2781 bases
It is right, encoding regulator albumen, 2781 amino acid；
[3] wysPIII is located at the 116422-119205 base of gene cluster nucleotide sequence, and length is 2784 alkali
Base pair, encoding regulator albumen, 927 amino acid；
[4] wysR is located at the 119732-120313 base of gene cluster nucleotide sequence, and length is 582 base-pairs,
Encode LuxR families transcript regutation protein, 193 amino acid；
[5] wysRII is located at the 121013-121774 base of gene cluster nucleotide sequence, and length is 762 bases
It is right, encoding D eoR families transcript regutation protein, 253 amino acid；
[6] wysRIII is located at the 121779-122801bp base of gene cluster nucleotide sequence, and length is 1023
Base-pair, coding AsnC families transcript regutation protein, 340 amino acid；
(3) coding transports the gene of son, i.e. wysG, wysH, totally 2 genes：
[1] wysG is located at the 396-2216 base of gene cluster nucleotide sequence, and length is 1281 base-pairs, coding
Abc transport albumen, 606 amino acid；
[2] wysH is located at the 2194-3948 base of gene cluster nucleotide sequence, and length is 1755 base-pairs, is compiled
Code abc transport albumen, 584 amino acid；
(4) encoding glycosyl synthesis and the gene of attachment, such as wysDI, wysDII, wysDIII, totally 3 genes：
[1] wysDI is located at the 60428-61819 base of gene cluster nucleotide sequence, and length is 1392 base-pairs,
Encoding glycosyltransferases, 463 amino acid；
[2] wysDII is located at the 59351-60409 base of gene cluster nucleotide sequence, and length is 1059 bases
It is right, encoding aminotransferases, 352 amino acid；
[3] wysDIII is located at the 4196-5284 base of gene cluster nucleotide sequence, and length is 1089 base-pairs,
Encoding glycosyl synzyme, 362 amino acid；
(5) other rear modifiers and Unknown Function gene, i.e. wysL, wysM, wysN, wysE, wysF, totally 5 bases
Cause：
[1] wysL is located at the 56649-57833 base of gene cluster nucleotide sequence, and length is 1185 base-pairs,
Codocyte cytochrome p 450 hydroxylase, 394 amino acid；
[2] wysM is located at the 57918-58109 base of gene cluster nucleotide sequence, and length is 192 base-pairs, is compiled
Code ferredoxin, 63 amino acid；
[3] wysN is located at the 58158-59309 base of gene cluster nucleotide sequence, and length is 1152 base-pairs,
Codocyte cytochrome p 450 hydroxylase, 383 amino acid；
[4] wysE is located at the 109493-110242 base of gene cluster nucleotide sequence, and length is 750 base-pairs,
Encode thioesterase, 249 amino acid；
[5] wysF is located at the 1-228 base of gene cluster nucleotide sequence, and length is 228 base-pairs, is encoded unknown
Functional protein, 75 amino acid.
It therefore, it can whether be detected in streptomycete to be measured containing poly- shown in sequence 89 with 44 primer pairs shown in table 2
Ketone biological synthesis gene cluster, specific method is as follows：The genomic DNA of streptomycete to be measured is extracted, is drawn respectively with 44 shown in table 2
Thing obtains 44 fragments to entering performing PCR amplification；Again with DNAMAN softwares by this 44 fragment assemblies, if splicing obtains sequence 89
Shown polyketone biological synthesis gene cluster, then contain the polyketone biological synthesis gene cluster shown in sequence 89 in streptomycete to be measured；If
It can not splice and obtain polyketone biological synthesis gene cluster shown in sequence 89, then not contained in streptomycete to be measured poly- shown in sequence 89
Ketone biological synthesis gene cluster.
The Function Identification of embodiment 4, polyketone biological synthesis gene cluster
Polyketone biological synthesis gene cluster includes 22 ORFs, chooses wherein wysR and wysRII genes and carries out function
Checking, it is specific as follows：
(1), wysR functional verification
First, recombinant expression carrier psf-wysR structure
Recombinant expression carrier psf-wysR be pSETC carriers (be recorded in " Bierman M, Logan R, O ' Brien K,
Seno ET,Rao RN,Schoner BE(1992)Plasmid cloning vectors for the conjugal
transfer of DNA from Escherichia coli to Streptomyces spp.Gene 116:44-49 ")
The recombinant vector obtained between restriction enzyme site BamH I and Spe I in insetion sequence table after wysR genes shown in sequence 90.
2nd, the structure of wysR transgenic strains
The recombinant expression carrier psf-wysR that step one is built is transferred to E.coli ET12567/ by electric shocking method
PUZ8002 (is recorded in " Kieser TBM, Buttner MJ, Chater KF, Hopwood DA (2000) Practical
In the text of Streptomyces Genetics.The John Innes Foundation, Norwich " one), obtained recombinant bacterium
It is named as ETpKC-wysR.The method by engaging transfer, S. ahygroscopicus Wuyi mutation is imported by ETpKC-wysR again
In (Streptomyces ahygroscopicus var.wuyiensis) CK-15, concrete operations referring to " Yang Zhenjuan, Sun Lei,
The exploration of the S. ahygroscopicus Wuyi mutation CK-15 genetic conversion systems such as Wu Zhe and first biotechnologys of building are circulated a notice of, and 2012,
(10):The texts of 193-198 " one, it is as follows：It is taken as the S. ahygroscopicus Wuyi mutation (Streptomyces for starting strain
Ahygroscopicus var.wuyiensis) CK-15 ripe spore makes spore suspension, by recombinant bacterium ETpKC-wysR
Competence is made, MS flat boards are applied after being mixed in equal volume with CK-15 spore suspensions, after 30 DEG C are cultivated 16 hours, covering contains 25 μ
The 1ml sterilized waters of g/ml nalidixic acid and 50 μ g/ml apramycin (pSETC carriers carry apramycin resistance gene)
In, continue cultivate to grow engagement transfer son, obtain wysR transgenic strains, therefrom choose 2 bacterial strains be respectively designated as ooR7,
And ooR12.
The control that pSETC empty carriers are transferred into starting strain CK-15 is set simultaneously, gained recombinant bacterial strain is named as CK-
15/pSETC。
WysR transgenic strains ooR7 and ooR12 that picking is built single bacterium colony, carry out Liquid Culture, extract bacterial strain
Genomic DNA, using it as template, enters performing PCR amplification, by PCR primer size and sequencing result to wysR using following primer
Transgenic strain carries out Molecular Identification.Simultaneously using the S. ahygroscopicus Wuyi mutation (Streptomyces as starting strain
Ahygroscopicus var.wuyiensis) CK-15 is used as control.
Primer 3：5'-GTGCAATACGAATGGCGAA-3'；
Primer 4：5'-GCATTCTTCGCATCCCGCCT-3'.
In theory, in wysR transgenic strains, due to there is apramycin resistance base in recombinant expression carrier psf-wysR
Cause, using its genomic DNA as template, enters performing PCR amplification using above primer pair, can obtain and apramycin resistance gene sequence
The identical amplified fragments (750bp) of size；And as the starting strain CK-15 of control due to not containing apramycin resistance base
Cause, thus performing PCR amplification is entered using above primer pair, purpose band will not be obtained.
The PCR primer of wysR transgenic strains and starting strain CK-15 is entered into row agarose gel electrophoresis, as a result such as Fig. 1
It is shown.It can be seen that wysR transgenic strains ooR7 (swimming lane 2) and ooR12 (swimming lane 3) PCR primer size are about
750bp, and starting strain CK-15 (swimming lane 1) is without amplified band, it is consistent with expected results.It can be seen that, the wysR obtained by step 2
Transgenic strain ooR7 and ooR12 are the positive.
3rd, the HPLC analyses of wysR transgenic strains tunning
1st, the fermented and cultured of wysR transgenic strains
With wysR transgenic strain ooR7 and ooR12, the control strain CK-15/pSETC of pSETC empty carriers is transferred to, and
It is used as the S. ahygroscopicus Wuyi mutation (Streptomyces ahygroscopicus var.wuyiensis) of starting strain
CK-15 is experiment material.
Take the slant pore of each experiment material fresh mature that spore suspension is made, survey its OD value, allow its OD value same
Level, respectively takes 5ml to be inoculated in respectively in 100mL fermentation mediums, shaken cultivation (28 DEG C, 220r/min) 64h, and hair is collected by filtration
Zymotic fluid.
Wherein, fermentative medium formula is as follows：3g containing corn flour, soybean cake powder 2g, grape in per 100ml fermentation mediums
Sugared 2g, ammonium sulfate 400mg, calcium carbonate 300mg, pH are about 7.0.
2nd, the HPLC of Wuyiencin content is analyzed in zymotic fluid
HPLC is carried out using model Agilend l 100 high performance liquid chromatograph and analyzes Wuyi in each bacterial strain fermentation liquor
The content of rhzomorph.It is specific as follows：
1), standard curve making
Wuyiencin standard items are taken, the solution of series concentration is prepared with pure water.By the Wuyiencin standard items of series concentration
Solution carries out high performance liquid chromatography detection according to following condition.Using the concentration of Wuyiencin standard solution as abscissa, with peak
Area is ordinate, makes standard curve.
Wherein, high-efficient liquid phase chromatogram condition is as follows：
Chromatographic column：ZORBAX SB-AQ (4.6mm × 250mm, 5 μm)；Mobile phase：Concentration is 1.4g/L trichloroacetic acid water
Solution；Flow velocity：1mL/min；Column temperature：25℃；Detection wavelength：254nm；The μ L of sample size 20.
Referring specifically to " the Wuyi in Wang Lidong, Zhang Kecheng, Shi Yiping, Cui Zengjie, Fermentation Liquor by High Performance Liquid Chromatography
The texts of rhzomorph, agricultural chemicals, the o. 11th of volume 47,816-817, in November, 2008 " one.
2), the Wuyiencin assay in zymotic fluid to be measured
Each bacterial strain fermentation liquor obtained by step 1 is also subjected to high performance liquid chromatography detection according to as above condition respectively, will be with
The peak area of the consistent chromatographic peak of Wuyiencin standard items retention time substitutes into step 1) gained standard curve, obtained so as to calculate
The content of Wuyiencin in zymotic fluid to be measured.Test in triplicate, results averaged.
The HPLC collection of illustrative plates of Wuyiencin standard items is as shown in A in Fig. 2, and as can be seen from the figure Wuyiencin standard items go out
Peak time is 21min.Starting strain CK-15 HPLC collection of illustrative plates is as shown in B in Fig. 2, the HPLC of wysR transgenic strains (ooR7)
Collection of illustrative plates is as shown in C in Fig. 2.It can be seen that compared with starting strain CK-15 purpose chromatographic peak, wysR transgenosis bacterium
The purpose chromatographic peak peak area increase of strain.
Further, the testing result of Wuyiencin content is specifically as shown in table 4 in each bacterial strain fermentation liquor.
Testing result (the unit of Wuyiencin content in each bacterial strain fermentation liquor of table 4：μg/ml)
It is transferred to the starting strain CK- of the control strain CK-15/pSETC of pSETC empty carriers experimental result and non-transgenosis
15 is basically identical, no difference of science of statistics.
Show, wysR can improve Wuyiencin yield.
(2) wysRII functional verification
First, recombinant expression carrier pSTEC-wysRII structure
Recombinant expression carrier pSTEC-wysRII is that wysRII genes shown in sequence in sequence table 91 are inserted into pSETC carriers
Restriction enzyme site BamH I and Spe I between obtained carrier.
2nd, the structure of wysRII gene overexpressions bacterial strain
The recombinant expression carrier pSTEC-wysRII that step one is built is transferred to E.coli ET12567/ by electric shocking method
PUZ8002, obtained recombinant bacterium is named as ETpKC-wysRII.The method by engaging transfer, ETpKC-wysRII is led again
Enter in the mutation of S. ahygroscopicus Wuyi (Streptomyces ahygroscopicus var.wuyiensis) CK-15, specifically
Operate referring to " the exploration of the S. ahygroscopicus Wuyi mutation CK-15 genetic conversion systems such as Yang Zhenjuan, Sun Lei, Wu Zhe and just
Build biotechnologys circular, 2012, (10):The texts of 193-198 " one, it is as follows：It is taken as the S. ahygroscopicus Wuyi for starting strain
Mutation (Streptomycesahygroscopicus var.wuyiensis) CK-15 ripe spore makes spore suspension,
Recombinant bacterium ETpKC-wysRII is made into competence, MS flat boards are applied after being mixed in equal volume with CK-15 spore suspensions, in 30 DEG C of trainings
After supporting 16 hours, (pSETC carriers carry apramycin to the apramycin of nalidixic acid and 50 μ g/ml of the covering containing 25 μ g/ml
Resistant gene) 1ml sterilized waters in, continue cultivate to grow engagement transfer son, obtain wysR3 transgenic strains.
The control that pSETC empty carriers are transferred into starting strain CK-15 is set simultaneously, gained recombinant bacterial strain is named as CK-
15/pSETC。
The single bacterium colony for the wysRII transgenic strains that picking is built, carries out Liquid Culture, extracts the genomic DNA of bacterial strain,
Using it as template, performing PCR amplification is entered using following primer, wysRII transgenosis entered by PCR primer size and sequencing result
Row Molecular Identification.Simultaneously using the S. ahygroscopicus Wuyi mutation (Streptomyces as starting strain
Ahygroscopicus var.wuyiensis) CK-15 is used as control.
Primer 3：5'-GTGCAATACGAATGGCGAA-3'；
Primer 4：5'-GCATTCTTCGCATCCCGCCT-3'.
The PCR primer of wysRII transgenic strains and starting strain CK-15 is entered into row agarose gel electrophoresis, as a result shown
Show, the PCR primer size of wysRII transgenic strains (swimming lane 1) is about 750bp (as shown in Figure 3), and starting strain CK-15 without
Amplified band, it is consistent with expected results.It can be seen that, resulting wysRII transgenic strains are the positive.
3rd, the speed of growth identification of wysRII gene overexpressions bacterial strain
1st, phenotypic evaluation
Cultivate the wysRII gene overexpression bacterial strains of above-mentioned acquisition respectively in MS culture mediums, observe Strain phenotypes, including
Colonial morphology, the speed of growth, colony colour etc..S. ahygroscopicus Wuyi mutation (Streptomyces is set simultaneously
Ahygroscopicus var.wuyiensis) CK-15 is used as control.
As a result show, wysRII gene overexpression strain growths speed is considerably slower than original strain CK-15 (A in Fig. 4), production
Spore amount declines, and some bacterial strains do not produce grey gas life spore, only white substrate mycelium (B in Fig. 4) even.Result above is said
Bright wysRII effect genes Wuyiencin producing strains S.wuyiensis CK-15 phenotypic growth.
2nd, dry weight method is determined
Bacterial strain and the S. ahygroscopicus Wuyi mutation as starting strain are overexpressed using the wysRII of above-mentioned acquisition
(Streptomyces ahygroscopicus var.wuyiensis) CK-15 is experiment material.
Each bacterial strain slant pore of fresh mature is taken to be inoculated in 50mL M3G neat liquids culture medium (formula：Every liter of culture medium
In contain (NH4)2SO410g, glucose 50g, dusty yeast 5.0g, KH2PO41.36g, K2PO4·3H2O 0.8g, MgSO4·7H20
0.5g, ZnSO4·7H2O 0.04g, FeSO4.7H2O 0.03g；PH 7.0) in, 28 DEG C, 220r/min culture 48h be used as seed
Liquid.Each bacterial strain seed liquor is inoculated in (identical spore inoculating in 100mL M3G neat liquid culture mediums respectively with 2% ratio
Amount), 28 DEG C, 220r/min shaken cultivations.100ml is sampled every 6h, after the filter paper filtering of advance drying to constant weight, by filter paper
It is placed in 90 DEG C of baking ovens and dries again to constant weight.Weight subtracts each other the mycelial dry weight in sampling zymotic fluid twice.
As a result as shown in figure 5, as seen from the figure, wild-type strain (ck-15) is lag phase in 0-18h, 18-36h is
Exponential phase, growth quantity of mycelium is more, and wysRII is overexpressed strain growth slowly, is lag phase, 24h-48h in 0-24h
Just enter exponential phase, compared with wild-type strain thalline raised growth time retardation about 6h.
Claims (6)
1. a kind of primer set for being used to expand polyketone biological synthesis gene cluster, is made up of primer pair 1- primer pairs 44；
The primer pair 1 is made up of the primer shown in the primer shown in sequence 1 and sequence 2；
The primer pair 2 is made up of the primer shown in the primer shown in sequence 3 and sequence 4；
The primer pair 3 is made up of the primer shown in the primer shown in sequence 5 and sequence 6；
The primer pair 4 is made up of the primer shown in the primer shown in sequence 7 and sequence 8；
The primer pair 5 is made up of the primer shown in the primer shown in sequence 9 and sequence 10；
The primer pair 6 is made up of the primer shown in the primer shown in sequence 11 and sequence 12；
The primer pair 7 is made up of the primer shown in the primer shown in sequence 13 and sequence 14；
The primer pair 8 is made up of the primer shown in the primer shown in sequence 15 and sequence 16；
The primer pair 9 is made up of the primer shown in the primer shown in sequence 17 and sequence 18；
The primer pair 10 is made up of the primer shown in the primer shown in sequence 19 and sequence 20；
The primer pair 11 is made up of the primer shown in the primer shown in sequence 21 and sequence 22；
The primer pair 12 is made up of the primer shown in the primer and sequence 24 shown in sequence 23；
The primer pair 13 is made up of the primer shown in the primer shown in sequence 25 and sequence 26；
The primer pair 14 is made up of the primer shown in the primer shown in sequence 27 and sequence 28；
The primer pair 15 is made up of the primer shown in the primer shown in sequence 29 and sequence 30；
The primer pair 16 is made up of the primer shown in the primer shown in sequence 31 and sequence 32；
The primer pair 17 is made up of the primer shown in the primer shown in sequence 33 and sequence 34；
The primer pair 18 is made up of the primer shown in the primer shown in sequence 35 and sequence 36；
The primer pair 19 is made up of the primer shown in the primer shown in sequence 37 and sequence 38；
The primer pair 20 is made up of the primer shown in the primer shown in sequence 39 and sequence 40；
The primer pair 21 is made up of the primer shown in the primer shown in sequence 41 and sequence 42；
The primer pair 22 is made up of the primer shown in the primer shown in sequence 44 and sequence 44；
The primer pair 23 is made up of the primer shown in the primer shown in sequence 45 and sequence 46；
The primer pair 24 is made up of the primer shown in the primer shown in sequence 47 and sequence 48；
The primer pair 25 is made up of the primer shown in the primer shown in sequence 49 and sequence 50；
The primer pair 26 is made up of the primer shown in the primer shown in sequence 51 and sequence 52；
The primer pair 27 is made up of the primer shown in the primer shown in sequence 53 and sequence 54；
The primer pair 28 is made up of the primer shown in the primer shown in sequence 55 and sequence 56；
The primer pair 29 is made up of the primer shown in the primer shown in sequence 57 and sequence 58；
The primer pair 30 is made up of the primer shown in the primer shown in sequence 59 and sequence 60；
The primer pair 31 is made up of the primer shown in the primer shown in sequence 61 and sequence 62；
The primer pair 32 is made up of the primer shown in the primer shown in sequence 63 and sequence 64；
The primer pair 33 is made up of the primer shown in the primer shown in sequence 65 and sequence 66；
The primer pair 34 is made up of the primer shown in the primer shown in sequence 67 and sequence 68；
The primer pair 35 is made up of the primer shown in the primer shown in sequence 69 and sequence 70；
The primer pair 36 is made up of the primer shown in the primer shown in sequence 71 and sequence 72；
The primer that the primer pair 37 is shown by the primer shown in sequence 73 and sequence 74 is constituted；
The primer pair 38 is made up of the primer shown in the primer shown in sequence 75 and sequence 76；
The primer pair 39 is made up of the primer shown in the primer shown in sequence 77 and sequence 78；
The primer pair 40 is made up of the primer shown in the primer shown in sequence 79 and sequence 80；
The primer pair 41 is made up of the primer shown in the primer shown in sequence 81 and sequence 82；
The primer pair 42 is made up of the primer shown in the primer shown in sequence 83 and sequence 84；
The primer pair 43 is made up of the primer shown in the primer shown in sequence 85 and sequence 86；
The primer pair 44 is made up of the primer shown in the primer shown in sequence 87 and sequence 88；
The polyketone biological synthesis gene cluster is the DNA molecular shown in sequence 89 in sequence table.
2. for expanding the PCR reagent of polyketone biological synthesis gene cluster, including primer pair described in claim 1, PCR amplifications are slow
Fliud flushing, DMSO, dNTP, MgSO4And archaeal dna polymerase；
The polyketone biological synthesis gene cluster is the DNA molecular shown in sequence 89 in sequence table.
3. PCR reagent according to claim 2, it is characterised in that：Mol ratio in the primer pair in every primer is
1：1.
4. the kit containing the PCR reagent described in the primer pair or Claims 2 or 3 described in claim 1.
5. the PCR reagent described in primer pair or Claims 2 or 3 described in claim 1 or the kit described in claim 4
Application in amplification polyketone biological synthesis gene cluster；
The polyketone biological synthesis gene cluster is the DNA molecular shown in sequence 89 in sequence table.
6. the PCR reagent described in primer pair or Claims 2 or 3 described in claim 1 or the kit described in claim 4
Whether contain the application in polyketone biological synthesis gene cluster in streptomycete to be measured is detected；
The polyketone biological synthesis gene cluster is the DNA molecular shown in sequence 89 in sequence table.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610127506.8A CN105602950B (en) | 2016-03-07 | 2016-03-07 | Polyketone biological synthesis gene cluster and its amplimer and kit in a kind of streptomycete |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610127506.8A CN105602950B (en) | 2016-03-07 | 2016-03-07 | Polyketone biological synthesis gene cluster and its amplimer and kit in a kind of streptomycete |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105602950A CN105602950A (en) | 2016-05-25 |
| CN105602950B true CN105602950B (en) | 2017-07-21 |
Family
ID=55983295
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610127506.8A Active CN105602950B (en) | 2016-03-07 | 2016-03-07 | Polyketone biological synthesis gene cluster and its amplimer and kit in a kind of streptomycete |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105602950B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110423790B (en) * | 2019-08-16 | 2021-04-02 | 上海交通大学 | Metabolic engineering method for directionally producing high yield antifungal tetramycin B |
| CN110846440B (en) * | 2019-12-16 | 2022-11-22 | 福建省农业科学院果树研究所 | Complete primer pair for determining complete genome of passion flower virus in east Asia and application thereof |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20100022766A1 (en) * | 2008-07-25 | 2010-01-28 | Wyeth | Biosynthetic gene cluster for the production of a complex polyketide |
| CN103626855B (en) * | 2013-11-14 | 2015-09-16 | 中国农业科学院植物保护研究所 | A kind of albumen relevant to Wuyiencin biosynthesizing and encoding gene thereof and application |
-
2016
- 2016-03-07 CN CN201610127506.8A patent/CN105602950B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN105602950A (en) | 2016-05-25 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Hsieh et al. | Rapid detection and characterization of surfactin-producing Bacillus subtilis and closely related species based on PCR | |
| Gerth et al. | Myxobacteria: proficient producers of novel natural products with various biological activities—past and future biotechnological aspects with the focus on the genus Sorangium | |
| Craig et al. | Unsuspected control of siderophore production by N‐acetylglucosamine in streptomycetes | |
| CN103468625B (en) | Gene disruption mutant of streptomyces bingchenggensis as well as preparation method and application thereof | |
| CN105602950B (en) | Polyketone biological synthesis gene cluster and its amplimer and kit in a kind of streptomycete | |
| CN104357506B (en) | Increase method of the precursor supply to improve salinomycin fermentation level | |
| Wolf et al. | Genome improvement of the acarbose producer Actinoplanes sp. SE50/110 and annotation refinement based on RNA-seq analysis | |
| Donadio et al. | Disruption of a rhodaneselike gene results in cysteine auxotrophy in Saccharopolyspora erythraea | |
| CN101363022B (en) | Biological synthesis gene cluster of tetrokacin A and use thereof | |
| CN102787152A (en) | Enhancing spinosyn production with oxygen binding proteins | |
| CN103224905A (en) | Identification and characterization of the spinactin biosysnthesis gene cluster from spinosyn producing saccharopolyspora spinosa | |
| Alderson et al. | Physiology and genetics of antibiotic production and resistance | |
| Bundale et al. | Culturable rare actinomycetes from Indian forest soils: Molecular and physicochemical screening for biosynthetic genes | |
| CN104962484A (en) | Saccharopolyspora spinosa rhamnose biosynthesis gene duplication engineering strain | |
| CN102911957B (en) | Biosynthesis gene cluster of griseoviridin and viridogrisein and application of biosynthesis gene cluster | |
| Knirschova et al. | Multiple regulatory genes in the salinomycin biosynthetic gene cluster of Streptomyces albus CCM 4719 | |
| Sun et al. | Identification of a gene cluster encoding meilingmycin biosynthesis among multiple polyketide synthase contigs isolated from Streptomyces nanchangensis NS3226 | |
| Muramatsu et al. | Phylogenetic analysis of immunosuppressant FK506-producing streptomycete strains | |
| Savic et al. | Targeting polyketide synthase gene pool within actinomycetes: new degenerate primers | |
| Shimizu et al. | Identification of endophytic Streptomyces sp. R-5 and analysis of its antimicrobial metabolites | |
| CN110092758B (en) | Novel alkaloid compound and wart spore strain for preparing compound by fermentation | |
| CN101962647B (en) | Biosynthesis gene cluster of Nocathiacins and application thereof | |
| Park et al. | Streptomyces BAC Cloning of a Large-Sized Biosynthetic Gene Cluster of NPP B1, a Potential SARS-CoV-2 RdRp Inhibitor | |
| CN106222191B (en) | Knock out method of the central carbon metabolism gene to improve Ge Erdeng element fermentation level | |
| Riyanti et al. | Isolation and screening of antimicrobial producing-actinomycetes symbionts in nudibranch |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant |