CN105602908B - Mink gamma-interferon monoclonal antibody and application thereof in detection of mink gamma-interferon - Google Patents

Abstract

The invention discloses a mink gamma-interferon monoclonal antibody and application thereof in detection of mink gamma-interferon. In the invention, the mink gamma-interferon monoclonal antibody is secreted and generated by a hybridoma cell strain with the preservation number of CGMCC No.10953, and research shows that the monoclonal antibody secreted and generated by the hybridoma cell strain can simultaneously identify a prokaryotic expression product and a eukaryotic expression product, and has high binding potency with natural IFN-gamma and good specificity. In addition, the invention also discloses a sandwich ELISA detection method established by taking the screened specific monoclonal antibody as a coating antibody and the polyclonal antibody as a detection antibody. Therefore, the method provided by the invention has important significance for evaluating the cellular immunity level of organisms after mink virus infection and vaccine immunization and preventing and controlling epidemic diseases of special animals.

Description

Mink gamma-interferon monoclonal antibody and application thereof in detection of mink gamma-interferon

Technical Field

The invention relates to preparation of a monoclonal antibody of mink gamma-interferon, and also relates to an ELISA detection method for detecting the mink gamma-interferon. The invention belongs to the field of biotechnology.

Background

Most cytokines are products of immune responses that can exert immunological effects in animals and humans, and ultimately eliminate antigenic material by up-regulating immune cell responses to the antigenic material, mediating inflammatory responses. Antigen stimulation and pathogenic microorganism infection can induce the in vivo production of cytokines, so the cytokines have close relationship with the occurrence and development of diseases, and can participate in the occurrence and development of the diseases. Therefore, cytokines have been widely used in the diagnosis, treatment, prevention, etc. of diseases.

Cytokines can cause and/or promote the occurrence of certain diseases, pathogenic microorganism infection can induce the excessive production of certain cytokines, high concentration of the cytokines can aggravate infection symptoms, and therefore, diseases can be clinically diagnosed by detecting certain cytokines. In recent years, the research on animal cytokines has been paid more and more attention, and some recombinant cytokine products (such as interferon) are developed by using genetic engineering technology. The main application of the method is as follows: the immune function state of the animal body is evaluated by detecting the level of the cell factor, and the role and the position of the cell factor in pathogenic microorganism infection, particularly certain persistent infectious diseases and immunosuppressive diseases can be researched.

Interferons (IFNs) were the earliest cytokines discovered in 1957, and are known to interfere with viral infections. Cytokines such as Interferon (IFN) can induce APC expression of MHC class II molecules, thereby promoting antigen presentation. IFN-. gamma.was first discovered 30 years ago and cloned in 1982. It is produced only by NK cells, CD8+ T cells and the Th1 subset of CD4+ T cells, acting through a broadly expressed specific receptor (except that it is not expressed on erythrocytes) and also expressing the IFN-gamma receptor on platelets, increasing the possibility of IFN-gamma transport in the blood circulation.

Th1 cells secrete IL-2, IFN-gamma and lymphotoxin, and Th1 cell function is associated with cell-mediated immune response (inflammatory response, delayed hypersensitivity and cytotoxicity). The Th1 cell can promote cell-mediated immune response related to proliferation, differentiation and maturation of TDTH cell and TC cell, wherein IFN-gamma is an important index for monitoring cellular immune state. Therefore, the detection of the IFN-gamma transcription factor level can indirectly reflect the IFN-gamma gene expression level, thereby having important clinical and scientific research significance for researching Th1 cell differentiation and the function thereof in autoimmune diseases and virus infection.

The quantitative analysis of IFN-gamma in the sample has extremely important theoretical value and application value in the aspects of immune mechanism research, immune function analysis, vaccine immune effect evaluation, organ transplantation, anaphylactic reaction, diagnosis of various intracellular pathogen infections and the like. The dynamic change level index of IFN-gamma in the organism is evaluated, which provides great help for understanding the occurrence, development and prognosis of infectious diseases and the dynamic law of protective immune response of the organism. Therefore, it is important to establish a detection method for evaluating the level change of IFN-. gamma.in a body.

In recent years, the mixed infection trend of minks, foxes and raccoon dogs to canine distemper, parvoviruses and Aleutian viruses in China is increased, and the protection rate of traditional vaccines after immunization is reduced, which are caused by the reasons, besides the continuous variation of the viruses, the immune state of animal organisms is known, and a basis is provided for the optimization of immune programs and the selection of immune time. Therefore, the invention provides a novel detection method with independent intellectual property rights, which has profound practical significance and wide application prospect for the prevention and control of the special animal epidemic disease in China.

Disclosure of Invention

The technical problem to be solved by the invention is to obtain a hybridoma cell strain which stably secretes an anti-mink gamma-interferon monoclonal antibody by applying a hybridoma technology, and establish a method for detecting the mink gamma-interferon, so that a new technical means is provided for detecting the mink gamma-interferon, and a technical platform is provided for researching the immune state and the immune mechanism of an organism.

In order to achieve the purpose, the invention adopts the following technical means:

the IFN-gamma reaction based on antigen specificity can be used for evaluating the principle of specific cellular immune state of an organism, and the peripheral blood lymphocyte IFN-gamma in-vitro release test stimulated by specific antigen is widely used for anti-infection diagnosis and cellular immune state evaluation. The diagnostic method is a sandwich ELISA established based on IFN-gamma monoclonal antibodies. Peripheral blood lymphocytes were incubated overnight with the specific antigen and the IFN-. gamma.concentration in the culture supernatant was measured by sandwich ELISA to diagnose specific infection. In order to further apply IFN-gamma to the diagnosis of mink virus infection and the evaluation of cellular immunity, the invention carries out the development of monoclonal antibodies: the recombinant IFN-gamma marked by histidine is used as antigen to immunize mice, 5 hybridoma cell lines which can stably secrete high-titer monoclonal antibodies are obtained by a classical hybridoma technology, and ascites is induced by the cells respectively. ELISA, Western blot and immunofluorescence prove that the monoclonal antibody produced by one hybridoma cell can identify natural IFN-gamma, has high IFN-gamma binding titer and good specificity, and has important application prospect in mink disease diagnosis.

The hybridoma cell strain is named as MiIFN-gamma-H44, is classified and named as a hybridoma cell strain secreting a mink gamma-interferon monoclonal antibody, is preserved in the common microorganism center of China Committee for culture Collection of microorganisms, and is addressed to the institute of microbiology, Zhongkou institute of academy of China, West Lu No.1, North West Chen, the rising area, Beijing, and has the strain preservation numbers of: CGMCC No.10953, preservation date of 2015, 7 months and 2 days.

Furthermore, the invention also provides a monoclonal antibody of the mink gamma-interferon resistance secreted by the hybridoma cell strain and application of the monoclonal antibody in preparation of a reagent for detecting the mink gamma-interferon, and experiments prove that the monoclonal antibody can simultaneously identify natural mink gamma-interferon.

Furthermore, the invention also provides an ELISA detection kit for detecting mink gamma-interferon, which is characterized by comprising the monoclonal antibody, an anti-gamma-interferon polyclonal antibody and an HRP-labeled goat anti-rabbit IgG enzyme-labeled secondary antibody.

In the invention, preferably, the monoclonal antibody is a coating antibody, the polyclonal antibody is a detection antibody, when the concentration of the coating antibody is 0.0118 mu g/ml, and the concentration of the detection antibody is 0.126 mu g/ml, 0.1ug of mink IFN-gamma can be detected, and when the concentration is 100 times of re-dilution, the OD still can reach 0.8.

According to the invention, the screened specific monoclonal antibody is used as a coating antibody, the polyclonal antibody is used as a sandwich antibody, the built sandwich ELISA detection method detects the IFN-gamma protein level secreted by peripheral blood lymphocytes of minks infected by canine distemper, three times of coincidence experiments verify that the method is sensitive and high in accuracy, and meanwhile, the built sandwich ELISA is negative to the detection of a plurality of non-relevant antigens, which shows that the specificity of the method is good. Because natural mink IFN-gamma is difficult to buy in the current market, the standard substance applied in the research and the antigen for producing the antibody are recombinant proteins. However, preliminary studies prove that the developed mink IFN-gamma monoclonal antibody, the polyclonal antibody and the established sandwich ELISA are also suitable for IFN-gamma naturally secreted by immune cells. The sandwich ELISA method is used for measuring the culture supernatant of peripheral blood lymphocytes of minks infected with canine distemper vaccine strains and virulent strains respectively, IFN-gamma levels change along with the change of infection time at 6 different time points, IFN-gamma is expressed and inhibited before 24 hours in the initial infection stage, the expression level reaches the highest peak in 48 hours, and the IFN-gamma is sharply reduced in 72 hours. The invention has important significance for the prevention and control of the special animal epidemic diseases.

Drawings

FIG. 1 shows the gene sequence of mink IFN-. gamma. (signal peptide region in underlined);

FIG. 2 shows the soluble expression of mink IFN-. gamma.in E.coli;

MK: protein molecular weight standards; A. no induction control; B. expressing the whole strain; C. a lysate supernatant; D. precipitating a lysate;

FIG. 3 is a schematic diagram of detection of E.coli expression from hybridoma supernatants;

1.2, 3, 31G hybridoma supernatant detection pET32 a-IFN-gamma and pCold-IFN-gamma expression, 4, 31G hybridoma supernatant detection pET32a-IFN- α, 5, 6, 31A hybridoma supernatant detection pET32 a-IFN-gamma and pCold-IFN-gamma expression, 7, 31A hybridoma supernatant detection pET32a-IFN- α, 8, 9, 31B hybridoma supernatant detection pET32 a-IFN-gamma and pCold-IFN-gamma expression, 10, 31B hybridoma supernatant detection pET32a-IFN- α, 11, 12, H44 hybridoma supernatant detection pET32 a-IFN-gamma and pCold-IFN-gamma expression, 13, 31H 44 hybridoma supernatant detection pET 32-IFN-a-IFN-gamma and pCold-IFN-gamma expression, 68614, 14, 24, 14-IFN-14-F22-46 3-14-IFN-gamma detection pET 2F-46 3, 59632-59614-IFN-14 and pCold-14F-a hybridoma supernatant detection pET 2;

FIG. 4 shows the hybridoma supernatant immunofluorescence assay pcDNA3.1/MiIFN-. gamma.expression on Vero cells;

A. performing immunofluorescence detection after 10-fold dilution on hybridoma supernatant with the number of H44; B. performing immunofluorescence detection after 10-fold dilution on hybridoma supernatant with the number of F46; C. a reporter gene control; D. a normal cell control;

FIG. 5 shows SDS-PAGE detection of purified IFN-. gamma.monoclonal antibodies;

1. protein molecular weight standards; 2, 3, purified antibody No. H44; 4, 5, purified antibody numbered F46;

FIG. 6 is a graph of the interferon-gamma levels expressed by lymphocytes after 0h, 3h, 8h, 24h, 48h, 72h and 96h of infection.

Detailed Description

The invention will be further described with reference to specific embodiments, and the advantages and features of the invention will become apparent as the description proceeds. These examples are illustrative only and do not limit the scope of the present invention in any way. It will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention, and that such changes and modifications may be made without departing from the spirit and scope of the invention.

The main materials and sources involved in the embodiments of the present invention

pMD18-T vector, prokaryotic expression vector pCold II, various restriction enzymes and DH5 α competent cells were purchased from TaKaRa (Dalian) Limited company, SPF grade Balb/c mice were purchased from the laboratory animal center of the institute for Biotechnology, mouse myeloma cells SP2/0 were prepared in the laboratory, RPMI-1640 medium, Australian limbic fetal bovine serum were purchased from Gibco, HAT selective medium, HT medium and PEG5000 were purchased from Sigma, horseradish peroxidase HRP-labeled goat anti-mouse IgG, fluorescent secondary antibody and TMB substrate developing solution were purchased from Sigma, ECL luminescence kit was purchased from Pierce, Predyed protein Marker was purchased from Thermo, denatured protein gel preparation kit was purchased from Biyuntan Biotech institute, serum medium, liquid paraffin, physiological saline, HiTrap rProtein G HP (Biotech 17-04003, 6-age Healthcare 17-04003, 6-year-old healthy mink from the institute for Industrial science).

EXAMPLE 1 preparation of monoclonal antibody against mink Gamma-Interferon

1. Method of producing a composite material

1.1 preparation of peripheral blood lymphocytes of mink and IFN-gamma induction

Sterile sampling 5mL of peripheral anticoagulation blood of healthy minks, and adding RPMI 1640 culture solution for dilution at a ratio of 1: 1.5 mL of diluted peripheral blood was slowly added to 5mL of human lymphocyte separation medium and centrifuged in a horizontal rotor at 2000r/min at room temperature for 40 min. Transferring the leukocyte layer to another tube with a sterilized long needle, washing the cells with RPMI 1640 culture solution for 2 times, suspending the cells with RPMI 1640 culture solution containing 25 μ g/mL PHA and 10% calf serum, counting the cell suspension, and diluting the cell suspension to 1 × 10 according to the counting result⁶The cells are put in a 24-well cell culture plate at the concentration of one cell/mL and are subjected to CO at 37 DEG C₂The incubator is used for 24 h.

1.2 amplification of MiIFN-gamma Gene by RT-PCR

An amplification primer is designed according to a complete sequence of the ferret IFN-gamma cDNA published on GenBank (Genbank accession number: EF492064), and the sequence of the primer is as follows:

an upstream primer: 5'-ATGAATCACAAAGTGCA-3'

A downstream primer: 5'-TTATTTCGATGCTCTG-3', respectively;

designing and constructing prokaryotic expression mMiIFN-gamma gene amplification primers according to the amplification result:

an upstream primer:

5′-GTGCATCATCATCATCATCATATGGATGACGACGATAAGGGCTATTACTG

TCAGGCCATG-3' (the Nde I enzyme cleavage points are underlined);

a downstream primer:

5′-CTAGACTGCAGGTCGACAAGCTTTTATTTCGATGCTCTGCGGC-3' (HindIII cleavage site underlined).

1.3 amplification of mink IFN-gamma cDNA

Adding 1 mu of LOoligo (dT)15 primer (50 pmol/. mu.L) into 9.5 mu.L of RNA solution, uniformly mixing, placing in a 70 ℃ water bath for acting for 5min, immediately cooling, sequentially adding 10mmol/L dNTP 5. mu.L, AMV Buffer 4. mu.L, RNase inhibitor 0.5. mu.L and AMV 1. mu.L, fully mixing, placing on a PCR instrument for 1h at 42 ℃, inactivating reverse transcriptase at 95 ℃ for 3min, cooling, and directly using for PCR reaction. PCR reaction system 10 XExTaq Buffer 2.5. mu.L, 2.5 mmol/. mu.L dNTP 2. mu.L, upstream and downstream primers (25 pmol/. mu.L) each 1. mu.L, ExTaq DNA polymerase (2 u/. mu.L) 0.125. mu.L, sterile deionized water to make up 25. mu.L. After the reaction solution is mixed evenly, amplification is carried out on a PCR instrument, the cycle parameters are pre-denaturation at 95 ℃ for 5min, pre-denaturation at 94 ℃ for 45s, pre-denaturation at 52.5 ℃ for 1min and pre-denaturation at 72 ℃ for 1min, extension at 72 ℃ for 6min after 32 cycles, and after the amplification is finished, 6 mu L of the mixture is taken to be subjected to electrophoresis observation on 1.5 percent agarose gel.

1.4 expression vector construction and expression

Cloning the amplified IFN-gamma cDNA gene of mink into pMD18-T vector, carrying out enzyme cutting and PCR identification to determine the correct sequence, designing primers for amplifying IFN-gamma mature peptide gene by taking the correct target gene sequence as a template, respectively introducing Nde I and HindIII enzyme cutting sites into upstream and downstream primers, connecting the PCR product after enzyme cutting with pCold vector, transforming BL21 sensitive strain, randomly selecting a single clone strain for further identification, inoculating a positive recombinant bacterium pCold-MiIFN-gamma/DH 5 α into an ampicillin LB culture medium, carrying out shake culture at 37 ℃ overnight, inoculating 1:100 into an ampicillin 2YT on the next day, carrying out shake culture at 37 ℃ until the OD600 value reaches 0.4-0.6, placing for 30min at 15 ℃, carrying out induction at 15 ℃ for 24h through 0.5mmoL/L IPTG, collecting the strains, carrying out ultrasonic wave splitting, collecting supernatant at 4 ℃, and carrying out SDS-electrophoresis analysis on the centrifugal expression product.

1.5 recombinant protein purification

Purification of the soluble recombinant protein was performed according to the instructions of the GE Nickel ion affinity chromatography column (Ni-NTA), and the expression cells collected by centrifugation were resuspended in 20mM Na3PO4, 0.5M NaCl, 20mM imidazole, pH7.4 binding buffer, sonicated to clarify, centrifuged at 12000rpm for 10min, and the supernatant was filtered through a 0.22 μ M sterile filter. The supernatant was collected after sonication, purified by affinity chromatography using 1ml pre-packed Ni-NTA column from GE, eluted with an eluent containing 20mM Na3PO4, 0.5M NaCl, 500mM imidazole, pH7.4, and subjected to SDS-PAGE using samples of different peak values, the purity of which was 90% by detection.

1.5 animal immunization

The purified protein was quantified using BCA quantification kit. The first immunization, the complete emulsification of the recombinant protein and equivalent volume of Freund's complete adjuvant, subcutaneous multi-point injection, and 20 mug/mouse of the primary immunization; after 3 weeks, the second immunization was carried out at 20. mu.g/mouse, and subcutaneous multiple injections were given; after 3 weeks, a third immunization subcutaneous multiple injection; the titer was measured within one week and cell fusion was performed after 3 d.

1.6 establishment of Indirect ELISA detection method and measurement of immune titer

Blood is collected after tail breaking after one week of three-immunity, the mixture is kept still at 37 ℃ for half an hour, stored in a refrigerator at 4 ℃ for 2 hours, centrifuged at 10000rpm for 10min, serum is collected, and the optimal dilution of the antigen and the antibody is determined by adopting an indirect ELISA matrix titration method, which comprises the following steps:

① determination of concentration of coating antigen by diluting recombinant protein with sodium carbonate-sodium bicarbonate, pH9.6 coating solution, the concentration of recombinant protein is 400 μ g/ml, and the initial concentration is 2 times of the 10-fold dilution concentration¹、2²、2³、2⁴、2⁵、2⁶、2⁷、2⁸、2⁹、2¹⁰、2¹¹、2¹²Dilution in 100. mu.l gradientPerwell, add to the ELISA plate, incubate at 37 ℃ for 2h, wash 3 times with a plate washer, 5min each time.

② 2% skimmed milk powder PBS blocking solution, 200 μ l/well, incubating at 37 deg.C for 2 hr, and washing with washing solution for 3 times.

③ Primary antibody (cell culture supernatant), negative control (SP2/0 culture supernatant), blank control (PBS), and positive control (positive serum PBS diluted 200 times) were added to 100. mu.l/well, incubated at 37 ℃ for 1h, and then washed 3 times with washing solution.

④ adding secondary antibody of goat anti-mouse IgG/HRP 20000 times diluted with PBS, 100 μ l/well, incubating at 37 deg.C for 1h, taking out, and washing with washing solution for 3 times.

⑤ developing, 100 mul/hole developing liquid, developing time about 5min, adding 50ul stop solution into each hole to terminate, measuring absorbance at 450nm, and recording and storing data.

1.7 cell fusion

1.7.1 Experimental Equipment

Sterilized surgical instruments: scissors, tweezers, a cell sieve, an inner core of an injector and a sterile plate. Wet box, 500ml beaker, 50ml centrifuge tube, 15ml centrifuge tube.

1.7.2 Experimental reagents

Complete medium with 15% serum IMDM (Gibco); 2.2% methylcellulose (SIGMA); newborn bovine serum PEG1500 (Roche); HAT and HT (Sigma).

1.7.3 Experimental procedures

① well conditioned sp2/0 cells were gently blown off the flask wall and aspirated into a 50ml centrifuge tube.

② mice were bled from the eyeball and then sacrificed by pulling the neck and soaked in 75% ethanol for 5 min.

③ A small amount of serum-free IMDM was poured into a dish, the cell sieve and the inner core of the syringe were placed in the dish, the spleen of the mouse was removed with scissors and forceps, placed on the cell sieve, the spleen was gently crushed sufficiently with the inner core of the syringe, the crushed cells were aspirated into a centrifuge tube containing sp2/0, and centrifuged at 1500rad/min for 5 min.

④ the thymus of the mouse is removed with scissors and forceps, and crushed, the crushed thymocytes are put into a 15ml centrifuge tube, and then 2ml HAT and 2ml HT are added into an incubator for use.

⑤ the centrifuged cells were decanted, the supernatant was decanted, and the cells were gently and gently vortexed with serum-free IMDM and centrifuged (1500rad/min, 5 min).

⑥ pouring the supernatant of the centrifuged cells as much as possible, beating the bottom of the centrifuge tube to suspend the cells sufficiently, putting the centrifuge tube into warm water at 37 ℃, slowly adding 1ml of PEG within 1 minute, standing in warm water for 1 minute, slowly adding 2ml of serum-free IMDM within 2 minutes, slowly adding 8ml of serum-free IMDM within 2 minutes, centrifuging for 1000rad/min, and 5 minutes.

⑦ pouring out the supernatant, adding 10ml of serum, blowing the cells evenly, pouring the prepared thymocytes into the cells, adding 25ml of sterilized semisolid culture medium, mixing well, pouring the mixture into 30 cell culture dishes evenly, putting the cell culture dishes into a wet box, putting the wet box into an incubator for culture, picking cell monoclonals, culturing the monoclonals on a 96-hole cell culture plate (firstly, paving the thymocytes with thymocytes in 100 ul/hole), coating the plate with 1 mu g/ml of soluble recombinant protein, performing first screening on the picked clones by an ELISA method to obtain 66 positive hybridoma cell strains, and performing second screening to obtain 24 positive hybridoma cell strains.

1.8, monoclonal antibody subclass identification:

the SBA Clonotyping System-HRP kit is used for identifying the subtype of the monoclonal antibody. Weighing 15mg ABTS solid dissolved in deionized water, keeping away from light at 2-8 deg.C, 1mL of Goat Anti-Mouse Ig capture antibody (2.5mg/mL) diluted to a concentration of 5-10 μ g/mL with PBS pH7.4, 100 μ l per well in ELISA plate, covering, and standing overnight at 4 deg.C. The plate was washed 3 times with PBS containing 0.05% Tween, and 100. mu.l of PBS containing 1% BSA was added to each well and incubated for 1h at room temperature. The plate was washed 3 times, 100. mu.l of cell supernatant was added to each well, and shaken at room temperature for 1 h. The plate was washed 3 times, 100. mu.l of HRP-labeled antibody was added to each well, and the mixture was shaken at room temperature for 1 hour. The plate was washed 5 times. Preparing a base solution: 525mg of citric acid was weighed out and dissolved in 50ml of water and adjusted to pH 4.0 with 3M NaOH. 10ml of the prepared citrate was taken and 0.2ml of ABTS and 10. mu.l of 30% H2O2 were added, 100. mu.l of the base solution was added to each well and the reading was made at 405nm after 10-20 min.

1.9 monoclonal antibody purification

The ascites was prepared according to the method reported in Liu Xiu Fan et al: (1) 6-well cell culture plates, approximately 2ml of cell culture fluid was added to each well. (2) The cells were removed from the liquid nitrogen and placed in a 37 ℃ water bath for rapid thawing. (3) The cells were aspirated into 5-10ml complete medium, centrifuged at 1000rpm for 5min, and the supernatant was discarded. (4) And (3) sucking up the centrifuged cell supernatant, sucking 1ml of cell culture solution, uniformly mixing the cell culture solution with the precipitated cells, sucking out the cell culture solution, uniformly mixing the cell culture solution with the precipitated cells to corresponding culture plate holes, and putting the culture plates into a cell culture box for incubation. Recovering frozen hybridoma cells, carrying out large-scale culture, centrifuging to remove supernatant when the cells grow to logarithmic phase, washing the cells precipitated for one time by using cell culture solution, diluting properly, injecting 5 multiplied by 105 cells into Balb/c mice which are 6-8 weeks old and are injected with liquid paraffin before 7 days, selecting Balb/c mice with obviously raised abdomens after 7-10 days, collecting ascites, centrifuging and taking supernatant. The supernatant was treated as follows:

① sample pretreatment, diluting with corresponding coupling buffer solution at 1:3, balancing, centrifuging at 10000rpm and 4 deg.C for 20min, filtering with 0.22 μm filter membrane, and removing fat, cell residue and small particulate matter.

② equilibration the pre-packed affinity column was equilibrated with 5-10 column volumes of the corresponding coupling buffer, maintaining a flow rate of 4 s/drop.

③ the sample was loaded by injecting the sample into the upper port of the column using a syringe and collecting the effluent in a 50ml centrifuge tube maintaining a flow rate of 5 s/drop.

④ washing the column with 5 column volumes of coupling buffer to maintain a flow rate of 4 s/drop to avoid excessive washing which would reduce the yield if the interaction between the target protein and the ligand is weak.

⑤ elution the antibody was eluted with 5 column volumes of elution buffer and collected in the above mentioned EP tube.

⑥ regeneration, the column was run with 5 column volumes of elution buffer, pH2.7, maintaining a flow rate of 4 s/drop.

⑦ equilibration the column was equilibrated to pH7.0 with 5-10 column volumes of G-column coupling buffer, maintaining a flow rate of 4 s/drop.

⑧ column preservation the column with pH7.0 was stored at 4 ℃ and the column was left unused for a long time, equilibrated and stored in 20% ethanol.

1.10 identification of antibody specificity of monoclonal antibodies

The method comprises the steps of carrying out induction expression on pCold-IFN-gamma and pET32 a-IFN-gamma vectors expressing mink IFN-gamma and a vector expressing pET32a-IFN- α constructed in the laboratory, collecting thalli, taking 31A, 31B, 31C, E44 and G46 monoclonal antibodies as primary antibodies and goat anti-mouse IgG-HRP as secondary antibodies, detecting and identifying by using a conventional Western blot method, taking thalli samples for processing and carrying out SDS-PAGE, transferring electrophoretic proteins onto an NC membrane, carrying out 200mA transfer printing for 120min, sealing with 5% skimmed milk at room temperature overnight, washing the membrane with PBST for 3 times and 5 min/time, diluting ascites prepared by 1:1000, diluting hybridoma supernatant by 1:50 times, incubating at room temperature for 2h, washing the membrane with PBST for 3 times and 5 min/time, and then incubating with HRP-goat anti-mouse IgG diluted by 1:8000, acting at room temperature for 1h, washing the membrane for 3 times and 5 min/time, and then developing by ECL for color analysis.

1.11 immunofluorescence assay

Designing a pair of specific primers:

upstream 5' -GTGAATTCCAGGCCATGTTTTTTAAAGA-3', primer cleavage site EcoRI

Downstream 5' -GACTCGAGGCAGGATGACCGTTATTTCG-3', introducing a restriction enzyme cutting site Xho I;

amplifying IFN-gamma full-length gene, constructing pcDNA3.1-MiIFN-gamma eukaryotic expression plasmid, transfecting Vero cell, taking pcDNA3.1 empty plasmid as transfection control, taking normal cell as blank control, and carrying out immunofluorescence detection after 48 h. Washing the unfractured monolayer of cells with PBS 3 times; fixing the cells with 4% of precooled paraformaldehyde for 30min, discarding the supernatant, washing with PBS for 3 times, penetrating 0.1% Triton-X-100 for 10min at room temperature, discarding the supernatant, and washing with PBS for 3 times; the hybridoma supernatant diluted 10 times was allowed to act for 30min, the wells were washed 3 times, and the rabbit anti-mouse fluorescently labeled IgG secondary antibody 1 was diluted with 0.01% evans blue PBS (containing sheep serum at a final concentration of 4%): the reaction solution is reacted for 1h at the room temperature of 1000 ℃, washed 3 times by PBS and directly observed by a fluorescence microscope.

1.12 stability detection of hybridoma cell lines

Continuously culturing hybridoma cell strain in vitro, and applyingEstablishing indirect ELISA method and determination standard, taking F therein₅，F₁₀，F₂₀,F₃₀And (4) measuring the titer of the primary cell supernatant and the cell culture supernatant after being frozen and stored for 4 months to recover, and detecting the antibody secretion capacity of the primary cell supernatant and the cell culture supernatant.

2 results

2.1 protein expression and purification

The total length of mink IFN-gamma gene is 501bp, the total sequence length is shown in figure 1, and the GenBank accession number is KJ 888148. The first 19 amino acids are predicted to be signal peptides, the mature peptide protein is composed of 167 amino acids, and the target sequence contains 3 cysteines and 3 potential N-glycosylation sites.

2.2 soluble expression of mink IFN-. gamma.

The mature peptide gene is constructed to pCold II, the IPTG concentration is 1mM/L, the induction is carried out for 10 hours at the temperature of 30 ℃, the expression product is detected by SDS-PAGE, the expression product is soluble expression, and the expression result is shown in figure 2.

2.3 establishment of Indirect ELISA screening method and detection of animal immune level titer

According to the titration of the matrix experiment, the OD value of the ELISA to be detected is about 1.0, and the maximum P/N ratio is determined as the coating concentration of the antigen, so that the antigen dilution factor finally established in the experiment is 1:2560, the concentration is 0.15 mu g/ml, and the antibody dilution factor is 1: 3000.

The serum titer of Balb/c immune mice is detected, and the serum of the mice detected before 5 times of fusion has better antibody titer which reaches 5⁷The above.

2.4 preparation of hybridoma cell lines

After 3 times of subcloning, coating a 96-well plate with recombinant protein of pCold-mFN-gamma 0.15 mu g/ml, using 100 mu l of each well, using hybridoma cells as a primary antibody and using HRP-labeled rabbit anti-mouse IgG as a secondary antibody, detecting the affinity of 24 monoclonal antibodies by ELISA, selecting five hybridoma cell lines which have OD values more than 1 and stably secrete anti-mink-IFN-Y, and respectively naming the five hybridoma cell lines as 31A, 31B, 31G, H44 and F46.

2.5 identification of monoclonal antibody subtypes

The subtype of the obtained 24 monoclonal antibodies is identified according to the operation instruction of the monoclonal antibody subtype identification kit. The results showed that 11 strains were of the IgG1 type, 9 strains were of the IgG2a type, and 2 strains were of the lgG2b type, all of the light chains were K chains, and the experimental results are shown in Table 1:

TABLE 1 identification of monoclonal Hangzhou soma subtypes

2.6 mink IFN-gamma monoclonal antibody binding activity and specificity

Transferring pCold-IFN-gamma and pET32 a-IFN-gamma expressing mink IFN-gamma and expression pET32a-IFN- α expression holoprotein to a nitrocellulose membrane, respectively taking 31A, 31B, 31G, H44 and F46 monoclonal antibodies as primary antibodies and goat anti-mouse IgG-HRP as secondary antibodies, carrying out Western-blotting identification, and adding 100ul TMB ECL for development, wherein the results show that the 5 monoclonal antibodies can respectively see specific reaction bands of 14kDa and 20kDa for the reactions of pCold-IFN-gamma and pET32 a-IFN-gamma, but do not see the bands for the reaction of pET32a-IFN- α protein, which shows that the 5 monoclonal antibodies can respectively and specifically recognize prokaryotic expression products, and the results are shown in figure 3.

2.7 immunofluorescence assay

The constructed pcDNA3.1/MIFN-gamma plasmid is transfected into Vero cells, meanwhile, a reporter gene control and a normal cell control are made, the expression of mink interferon is detected by using 5 screened monoclonal antibodies, only the H44 strain is contained in antibodies secreted by 5 hybridoma cell strains, the transfected cells generate green fluorescence, and the negative serum control and the normal cell control do not have green fluorescence. The results are shown in FIG. 4. 31A, 31B and 31G can only recognize prokaryotic expression products, and H44 and F46 can recognize both prokaryotic expression products and eukaryotic expression products, and can be used for detecting natural mink IFN-gamma. And indirect ELISA experiments further find that the H44 antibody has higher titer and is more sensitive to detection, and can be used for establishing a sandwich ELISA detection method.

The obtained hybridoma cell strain with the serial number of H44 is named as MiIFN-gamma-H44 (H44 for short), is preserved in the China general microbiological culture Collection center, and has the culture preservation serial number of: CGMCC NO. 10953.

2.8 stability detection of hybridoma cell lines

Hybridoma cell F, numbered H44, was assayed by an established indirect ELISA method₅，F₁₀，F₂₀,F₃₀The culture supernatant and the cell culture supernatant after being frozen and stored for 4 months to recover are measured to have the ELISA titer of 1:10⁴-10⁵The hybridoma cells were shown to be able to stably secrete antibodies.

EXAMPLE 2 Mass preparation of monoclonal antibodies

1. Mass production of monoclonal antibodies

An H44 hybridoma cell strain (MiIFN-gamma-H44, CGMCC No.10953) which stably secretes the monoclonal antibody is inoculated into the abdominal cavity of a Balb/c mouse through amplification culture, so that the hybridoma cell strain is proliferated in the abdominal cavity of the mouse in the form of ascites tumor, and a large amount of ascites containing the monoclonal antibody is obtained, and the specific operation is as follows:

1. recovery and expanded culture of hybridoma cells

(1) 6-well cell culture plates, approximately 2ml of cell culture fluid was added to each well.

(2) The cells were removed from the liquid nitrogen and placed in a 37 ℃ water bath for rapid thawing.

(3) The cells were aspirated into 5-10ml complete medium, centrifuged at 1000rpm for 5min, and the supernatant was discarded.

(4) And (3) sucking up the centrifuged cell supernatant, sucking 1ml of cell culture solution, uniformly mixing the cell culture solution with the precipitated cells, sucking out the cell culture solution, uniformly mixing the cell culture solution with the precipitated cells to corresponding culture plate holes, and putting the culture plates into a cell culture box for incubation.

2. Preparation of mice

The corresponding number of mice was prepared according to the number of ascites items to be performed. Paraffin oil is injected by adopting an intraperitoneal injection mode, and 500ul of paraffin oil is injected into one Balb/c mouse.

3. Hybridoma cell collection and injection

(1) When the cells are in logarithmic phase, they can be collected. After sucking 1ml of the supernatant, the cells were blown off and collected in a 15ml centrifuge tube and centrifuged at 1000rmp for 5 min. Resuspending the cell pellet in appropriate physiological saline to adjust the cell concentration to 5X 10⁵—9×10⁵One per ml. (2) Ascites was removed by intraperitoneal injection, and 1ml was injected into each mouse.

4. Ascites collection

(1) Ascites were collected 7 days or so after the hybridoma cells were injected and when the abdominal cavity of the mouse began to bulge greatly.

(2) The left hand holds the mouse firmly, and the right hand holds the needle (for taking ascites) and the needle is parallel to the mouse. The needle is inserted through the triangle formed by the groin and the two lowest nipples. One end of the needle is placed in a spare centrifuge tube. The needle was not inserted too deeply into the abdomen of the mice to avoid injuring the internal organs. The ascites can flow into the centrifuge tube along the needle tube. During fetching, the gesture of the hand is properly changed, and as many fetches and caches as possible are realized. (preferably once every two days)

(3) And centrifuging the taken ascites for 10min at 5000 revolutions, sucking the ascites supernatant into a corresponding centrifuge tube after centrifugation, and marking and recording. Placing the mixture at a designated position with the temperature of-20 ℃ for storage.

5. Antibody purification

(1) Sample pretreatment: diluting with corresponding coupling buffer solution at a ratio of 1:3, balancing, centrifuging at 10000rpm and 4 deg.C for 20min, filtering with 0.22 μm filter membrane, and removing fat, cell residue and small particulate matter. (2) Balancing: the pre-packed affinity column was equilibrated with 5-10 column volumes of the corresponding coupling buffer, maintaining a flow rate of 4 s/drop. (3) Loading: the sample was injected into the upper port of the column using a syringe and the effluent collected in a 50ml centrifuge tube maintaining a flow rate of 5 s/drop. Impurity washing: the column was run with 5 column volumes of coupling buffer, maintaining a flow rate of 4 s/drop. Excessive washing is avoided, which reduces the yield if the interaction between the protein of interest and the ligand is weak. (4) And (3) elution: the antibody was eluted with 5 column volumes of elution buffer and collected in the above EP tube. (5) Regeneration: the elution buffer was passed through the column at 5 column volumes, pH2.7, maintaining a flow rate of 4 s/drop. (6) Balancing: the column was equilibrated back to pH7.0 with 5-10 column volumes of G-column coupling buffer, maintaining a flow rate of 4 s/drop. (7) And (3) column preservation: the column, pH7.0, was stored at 4 ℃. The column, when left unused for a long time, was equilibrated and stored in 20% ethanol. And (5) subpackaging and storing according to requirements after the concentration of the purified antibody is measured and recorded. The results of the detection on 5ul SDS-PAGE gel are shown in FIG. 5.

Example 3 establishment of ELISA method

1. Production and potency assay for mink IFN-gamma polyclonal antibodies

The method comprises the steps of immunizing a long-ear rabbit by recombinant mink IFN-gamma protein, injecting immune at multiple points on the back for three times, injecting mIFN-gamma 30 mu g/Freund's complete adjuvant for the first time, injecting 15 mu g/Freund's incomplete adjuvant for the second time and the third time, respectively separating the first time and the second time, and the third time of immunization for 2 and 4 weeks, collecting marginal vein blood of ears on the 10 th day after the third immunization to measure titer, and collecting serum by aseptic heart blood collection. The initial dilution of serum is 1:100, then the dilution is carried out by a multiple ratio, and the measured ELISA titer of the polyclonal antibody reaches 2 x 10¹²。

2. Establishment of Indirect Sandwich ELISA method (monoclonal antibody-antigen-polyclonal antibody)

Determination of antibody coating amount and serum dilution:

coating concentrations (1 ten thousand, 5 ten thousand and 10 ten thousand times) of 3 monoclonal antibodies (prepared in example 2) and concentrations (1000, 5000, 1 ten thousand and 10 ten thousand) of 4 sandwich antibodies (rabbit anti-IFN-gamma polyclonal antibodies) were selected, and MiIFN-gamma was diluted 100, 200, 400, 1000, 2000, 4000, 10000 and 50000 times to perform sandwich ELISA square matrix titration. Positive control OD value (P) is not less than 0.4, negative OD₄₅₀A value of 0.2 or less is an effective test. By OD₄₅₀The maximum dilution at a value of 0.4 or more is the optimum dilution. According to the titration results, the monoclonal antibody was diluted appropriately with a coating solution (25mmol/L carbonate buffer, pH9.6) at 100. mu.L per well, coated overnight at 4 ℃, washed by a conventional method (washing solution: 5% Tween-20 in PBS, pH7.4) and blocked (blocking solution: 0.2% BSA). Antigen (recombinant MiIFN-. gamma.purified protein or viral infection supernatant) was diluted with a heat-insulating solution (PBS containing 0.2% BSA, 5% Tween-20, pH7.4), 100. mu.L per well, incubated at 37 ℃ for 1 hour, and washed 3 times. Adding heat preservation solution diluted rabbit anti-MiIFN-gamma polyclonal antibody, placing 100 μ L of each well at 37 ℃ for 1 h. Washing for 3 times, adding blocking solution to dilute (1: 5000) HRP-labeled goat anti-rabbit IgG (100 μ L per well), standing at 37 deg.C for 30min, and washing for 4 times. Reaction is carried out in a temperature and light-shielding manner in a TMB substrate liquid chamber of 100 mu L per well for 10min, and 50 mu L of 2M H is added per well₂SO₄Stop solution, 5min at room temperature, and reading the absorbance (OD) at 450nm₄₅₀nm)。

The invention utilizes 2 antibodies of monoclonal antibody and hyperimmune serum to select the concentration of the coating antibody and the concentration of the detection antibody, and finally establishes a double-antibody sandwich ELISA method with the monoclonal antibody as the coating antibody and the polyclonal antibody as the detection antibody. Respectively diluting and coating the purified monoclonal antibody H44 to 1-12 columns of a 96-well plate in a continuous multiple ratio manner, wherein each column is 100 mu l/well; after incubation for 2h at 37 ℃, washing the plate for 3 times, 5min each time; adding 5% skimmed milk powder solution, sealing at 37 deg.C for 1 hr with 200 μ l/hole, and washing the plate; then adding a sample to be detected, reacting for 1h at 37 ℃ in a 100 mu l/hole manner, and washing the plate; adding rabbit anti-mIFN-gamma serum diluted to working concentration by PBST, using HRP-labeled goat anti-rabbit IgG as enzyme-labeled secondary antibody, then adding 100. mu.l/hole TMB developing solution, 50. mu.l/hole 2M H₂SO₄The reaction was terminated.

Performing ELISA matrix titration, and the result proves that the optimal dilution is 10000 times among the dilution of 10000 of the tested three coated antibodies, 50000 and 100000; the 4 dilutions of sandwich antibody were 1000, 5000, 10000 and 10 ten thousand, with the optimal dilution being 1000-fold. When the coated antibody is diluted by 10000 times, the concentration is 0.0118 mug/ml, the sandwich antibody is diluted by 1000 times, the concentration is 0.126 mug/ml, 0.1ug of mink IFN-gamma can be detected, and when the coated antibody is diluted by 100 times, the OD value can still reach 0.8.

1.13 application of double-antibody sandwich ELISA of mink IFN-gamma

Selecting healthy 6-month-old minks which are negative in Canine Distemper Virus (CDV), mink enteritis parvovirus (MEV) and mink Aleutian Disease Virus (ADV), aseptically separating peripheral blood lymphocytes of the minks, and adjusting the cell concentration to 2.5 multiplied by 10 to obtain the cell concentration according to the specific method described in the section of example 11.1⁵Each ml of the culture was cultured in 5ml of 1640 medium and in TCID₅₀Are respectively 10^-5 _. ³CDV wild strains (CDV-Hebei) and 10^-5 _. ⁸The vaccine virus (CDV3) respectively infects lymphocytes, 50 mul of virus solution is added into 5ml of lymphocytes, and meanwhile, infection negative control is set, and cell supernatant is collected for detection at 0h, 3h, 8h, 24h, 48h, 72h and 96 h. And detecting according to the detection method in the steps.

The sandwich ELISA detection method established above was used to detect the levels of gamma-interferon secreted at different times after infection of lymphocytes by the vaccine strain CDV3(GenBank accession No.: EU726268) and the wild strain CDV-Hebei (GenBank accession No.: KC 427278). The gamma-interferon expressed by lymphocytes at different time points of 0h, 3h, 8h, 24h, 48h, 72h and 96h has difference, the gamma-interferon expression level is reduced after the virulent CDV-Hebei strain is infected within the first 24h, the gamma-interferon expression level is increased to the highest peak within 48h, the expression is obviously inhibited within 72h, and the gamma-interferon change trend is less after the vaccine virus CDV3 is infected (the result is shown in figure 6).

Research data indicate that T cell production of IFN- γ is one of the antiviral defense effector mechanisms and is likely to be the most important function in the response, both CD8T and CD4T cells can produce IFN- γ upon viral infection, whereas CD8T cells are the major producers of IFN- γ, approximately 60% -90% of T cells express IFN- γ, and almost all other cells expressing IFN- γ are CD4T cells. The magnitude of the contribution of CD8 and CD4T cells to the IFN- γ response may vary depending on the proportion of each subpopulation responding to a particular viral infection (Fundamental Immunology, tokyo-yu).

In conclusion, the sandwich ELISA method for detecting the IFN-gamma of the mink is established, the method is applied to detect the IFN-gamma change level after the important immune cells, namely the peripheral blood lymphocytes, are infected with the canine distemper virus, and the IFN-gamma indirectly reflects the immune state of an organism. The method is sensitive and specific, can be used for detecting the cytokine IFN-gamma in the peripheral blood serum infected by mink pathogen, and also can be used for detecting the immune response level of mink cells infected by other DNA or RNA viruses.

Claims (5)

1. A hybridoma cell strain capable of stably secreting monoclonal antibodies against mink gamma-interferon is named MiIFN-gamma-H44 and is preserved in the China general microbiological culture Collection center, the strain preservation number is CGMCC No.10953, and the preservation date is 2015, 7 and 2 days.

2. The monoclonal antibody against mink gamma-interferon secreted by the hybridoma cell line of claim 1.

3. The use of the monoclonal antibody of claim 2 in the preparation of a reagent for detecting mink gamma-interferon.

4. An ELISA detection kit for detecting mink gamma-interferon, which is characterized by comprising the monoclonal antibody of claim 2, a polyclonal antibody against mink gamma-interferon and a goat anti-rabbit IgG enzyme-labeled secondary antibody marked by HRP.

5. The kit of claim 4, wherein the monoclonal antibody is a coating antibody, the polyclonal antibody is a detection antibody, the concentration of the coating antibody is 0.0118 μ g/ml, and the concentration of the detection antibody is 0.126 μ g/ml.

Images