CN105567659A - Mouse NRDP1 gene site-specific modification system and applications thereof - Google Patents
Mouse NRDP1 gene site-specific modification system and applications thereof Download PDFInfo
- Publication number
- CN105567659A CN105567659A CN201610005851.4A CN201610005851A CN105567659A CN 105567659 A CN105567659 A CN 105567659A CN 201610005851 A CN201610005851 A CN 201610005851A CN 105567659 A CN105567659 A CN 105567659A
- Authority
- CN
- China
- Prior art keywords
- nrdp1
- mouse
- gene
- plasmid
- talen
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
- C12N9/22—Ribonucleases RNAses, DNAses
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/8509—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells for producing genetically modified animals, e.g. transgenic
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2227/00—Animals characterised by species
- A01K2227/10—Mammal
- A01K2227/105—Murine
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2267/00—Animals characterised by purpose
- A01K2267/03—Animal model, e.g. for test or diseases
Abstract
The invention belongs to the technical field of gene engineering, and provides a mouse NRDP1 gene site-specific modification system, which is the transcription activator like effector nuclease TALENs for cutting target sequence of mouse NRDP1 gene. The target sequence of mouse NRDP1 gene is represented by SEQ ID No.1. The 20 to 40th nucleotides are the recognition module TALNRD-2F. The complementary sequence of 57 to 74th nucleotide is the recognition module TALNRD-2R. The 40 to 56th nucleotides are the spacer sequence. The transcription activator like effector nuclease TALENs is composed of nuclease TALEN-L for recognizing the recognition module TALNRD-2F and nuclease TALEN-R for recognizing the recognition module TALNRD-2R; wherein the nuclease TALEN-L is protein encoded by the nucleotide sequence represented by SEQ ID No.2; and the TALEN-R is protein encoded by the nucleotide sequence represented by SEQ ID No.3. The invention also provided applications of the mouse NRDP1 gene site-specific modification system.
Description
Technical field
The invention belongs to gene engineering technology field, particularly the gene site-directed modification system of a kind of mouse NRDP1 and application thereof.
Background technology
The degraded of protein is mainly through two kinds of approach: the proteasome degradation pathway of lysosomal degradation pathway and ubiquitin mediation.Lysosomal degradation pathway is a non-selected proteolytic pathway, and principal degradation is by taking the photograph grain effect or pinosome enters intracellular exogenous protein; And the approach of ubiquitin mediation is a specific protein degradation pathway being subject to strict spatiotemporal database, the albumen be degraded is by E1 (ubiquitin activating enzyme, Ubiquitin-activatingenzyme), E2 (ubiquitin conjugate enzyme, Ubiquitin-conjungatingenzyme) and after E3 (ubiquitin ligase, Ubiquitinligase) a series of effect and multiple ubiquitin covalent attachment identified by proteasome (Proteasome) and degrade.This Ubiquitin-Proteasome Pathway of degrading in kytoplasm for biomacromolecule (ubiquitimproteosomepathway).This approach wide participation is in many vital processes such as cell cycle, inflammatory reaction, apoptosis, angtigen presentation.
Nrdp1 (neuregulinreceptordegradationprotein-1) is a kind of E3 ubiquitin ligase.Two signal paths (degraded MyD88 anti-inflammatory, activates TRIF and TBK1 growth-promoting Interferon, rabbit) of Nrdp1 energy two-ways regulation TLR mediation, finally mediate anti-inflammatory and antiviral double effect.The inflammatory factor IL-6 that process LAN Nrdp1 can suppress lipopolysaccharides (LPS) to be induced and the mRNA of TNF α and the expression of albumen, but the generation of I type Interferon, rabbit (IFN-β) can be promoted; Interference Nrdp1 then facilitates the generation of inflammatory cytokine, but inhibits the generation of IFN-β.Further discovery Nrdp1 can promote the ubiquitination of MyD88 and TBK1 molecule, the degraded of induction MyD88, but promotes the activation of TBK1, thus the activation of the NF-κ B suppressing MyD88 to rely on, cause the generation of inflammatory cytokine to reduce; Promote the phosphorylation of IRF3 simultaneously, increase the generation of I type IFN.Further checking shows, after the scavenger cell of transgenic mice of Nrdp1 and E3 ubiquitin enzymic activity disappearance is subject to TLR ligand stimulation, promotes the generation of the Pro-inflammatory Cytokine that MyD88 relies on, but the generation of the IFN-β suppressing TRIF to rely on.Therefore, Nrdp1 plays-two-way ‖ regulation mechanism in the intracellular signaling process of TLR, the generation of the inflammatory factor of TLR induction is suppressed on the one hand by degraded MyD88, generation on the other hand by promoting the activation of TBK1-IRF3 to promote I type Interferon, rabbit, for the molecular Regulation Mechanism research of TLR provides new thinking.Therefore, Nrdp1 is a drug targets possible all in the treatment of various pathogenic infection with potential using value, has a extensive future in anti-inflammatory and anti-virus infection.
Summary of the invention
The object of the present invention is to provide the gene site-directed modification system of a kind of mouse NRDP1, to realize the pointed decoration to mouse NRDP1 gene.
Another object of the present invention is to provide the application of the gene site-directed modification system of above-mentioned mouse NRDP1 in mammalian cell or embryo NRDP1 genetic modification.
An also object of the present invention is the establishment method providing a kind of NRDP1 gene knock-out mice model.
For solving the problems of the technologies described above, embodiments of the present invention provide firstly the gene site-directed modification system of a kind of mouse NRDP1, and this gene site-directed modification system is the transcriptional activation sample effector nuclease TALENs shearing mouse NRDP1 gene target sequence.Wherein, above-mentioned mouse NRDP1 gene target sequence is as shown in SEQIDNO.1, specifically, in SEQIDNO.1 sequence: 20 ~ 40 Nucleotide be identification module TALNRD-2F, with the complementary sequence of 57 ~ 74 Nucleotide be identification module TALNRD-2R, 40 ~ 56 Nucleotide are intervening sequence.Above-mentioned transcriptional activation sample effector nuclease TALENs is by identifying the nuclease TALEN-L of above-mentioned identification module TALNRD-2F and identifying that the nuclease TALEN-R of above-mentioned identification module TALNRD-2R forms; Nuclease TALEN-L is protein nucleotide sequence coded shown in SEQIDNO.2, and nuclease TALEN-R is protein nucleotide sequence coded shown in SEQIDNO.3.
Further, in the gene site-directed modification system of mouse NRDP1 that embodiments of the present invention provide, nuclease TALEN-L is formed with merging through engineered DNA scinderin Fok-I by the recognition structure territory TALEN-L of described identification module TALNRD-2F; Described nuclease TALEN-R is formed with merging through engineered DNA scinderin Fok-I by the recognition structure territory TALEN-R of described identification module TALNRD-2R.
Embodiments of the present invention also provide the application of the gene site-directed modification system of above-mentioned mouse NRDP1 in mammalian cell or embryo NRDP1 genetic modification.
Specifically, the application of the gene site-directed modification system of above-mentioned mouse NRDP1 in mammalian cell or embryo NRDP1 genetic modification that embodiments of the present invention provide, refers to and sets up NRDP1 gene knock-out mice model.
Embodiments of the present invention also provide the establishment method of NRDP1 gene knock-out mice model, comprise the steps: that (1) is according to mouse NRDP1 gene target sequence as shown in SEQIDNO.1, build there is nucleotide sequence shown in SEQIDNO.2 pTALEN-L plasmid and SEQIDNO.3 shown in the pTALEN-R plasmid of nucleotide sequence; (2) by the in-vitro transcription mRNA mixture that to obtain with described pTALNRD-L plasmid and pTALNDR-R plasmid be template, microinjection is to ovum week of mice embryonic in gap; (3) mice embryonic that step (2) obtains is transplanted to Recipient mice uterus, farrowing obtains the mouse of NRDP1 genetic modification; (4) mouse of the NRDP1 genetic modification making step (3) obtain and wild-type mice mating, the newborn mouse obtained records through PCR and Western-Blotting and knocks out heterozygote individual, between heterozygote, mating obtains homozygote mouse, namely completes the foundation of NRDP1 gene knock-out mice model.
Further, embodiments of the present invention also provide in the establishment method of NRDP1 gene knock-out mice model, also comprise the step of the pTALNRD-L plasmid obtained in step (1) and pTALNDR-R plasmid being carried out to Activity determination, select, to mouse NRDP1 gene, there is the pTALNRD-L plasmid of modification activities and pTALNDR-R plasmid is the in-vitro transcription that template carries out in described step (2).Specifically, the step stated the pTALNRD-L plasmid obtained in step (1) and pTALNDR-R plasmid carry out Activity determination is: by described pTALEN-L plasmid and pTALEN-R plasmid co-transfection in mouse cell, whether pcr amplification goal gene, undergone mutation by order-checking qualification goal gene.
Further, embodiments of the present invention also provide in the establishment method of NRDP1 gene knock-out mice model, also comprise the step of described NRDP1 gene knock-out mice model being carried out to identification and analysis after step (4).Specifically, above-mentionedly to the step that NRDP1 gene knock-out mice model carries out identification and analysis be: (1) carries out DNA sequencing to NRDP1 target site, the genotype of qualification mouse model; (2) disappearance of mouse each histoorgan NRDP1 albumen is detected by Western-Blotting; (3) utilize Western-Blotting to monitor and cause because of NRDP1 protein delation the change that each signaling pathway protein is expressed; (4) observe each histoorgan of mouse or organize whether because of NRDP1 protein delation, pathology occurs.
In addition, embodiments of the present invention also provide the recombinant expression vector of the gene site-directed modification system encoding gene of above-mentioned mouse NRDP1, recombinant bacterium or recombinant cell lines.
To sum up, the preparation method of the NRDP1 gene knock-out mice model that the present invention relates to, it is according to mouse NRDP1 gene order, design can effectively identify, modify the transcriptional activation sample effector nuclease TALENs of mouse NRDP1 gene target sequence, construction of expression vector also obtains the mRNA mixture of target NRDP1 gene by in-vitro transcription, be injected to mice embryonic and travelling backwards obtains the mouse of NRDP1 genetic modification to the female mouse of acceptor.The gene Knockout that the present invention utilizes TALENs to mediate, design and synthesis can specific recognition modify a pair TALENs of mouse NRDP1 gene, and inject mice embryonic by in-vitro transcription mRNA, single stage method obtains the transgenic mice that NRDP1 diallele knocks out.Test period is short, efficient and save cost.NRDP1 gene knock-out mice model prepared by the present invention, not only can deepen the understanding to NRDP1 gene regulating in disease of immune system pathogenic process, and can provide high-caliber experimental animal model for translational medicine and new drug development.
Accompanying drawing explanation
Fig. 1 is the action principle schematic diagram of TALENs pointed decoration mouse NRDP1 gene;
Fig. 2 is TLANEs in-vitro transcription mRNA product electrophorogram;
Fig. 3 is the gene sequencing peak figure of NRDP1 knock out mice F0 for s84 mouse;
Fig. 4 is the gene sequencing peak figure of NRDP1 knock out mice F0 for s86 mouse;
Fig. 5 is the gene sequencing peak figure of NRDP1 knock out mice F0 for s87 mouse;
Fig. 6 is the gene sequencing peak figure of NRDP1 knock out mice F0 for s168 mouse;
Fig. 7 is the gene sequencing peak figure of NRDP1 knock out mice F0 for s168 mouse;
Fig. 8 is the gene sequencing peak figure of NRDP1 knock out mice F0 for s170 mouse;
Fig. 9 is the gene sequencing peak figure of NRDP1 knock out mice F0 for s173 mouse;
Figure 10 is that NRDP1 knock out mice F3 is for part homozygote mouse PCR detected result electrophorogram;
Figure 11 to be sample number into spectrum be 55 NRDP1 knock out mice F3 for the gene sequencing peak figure of part homozygote mouse;
Figure 12 to be sample number into spectrum be 58 NRDP1 knock out mice F3 for the gene sequencing peak figure of part homozygote mouse.
Embodiment
For making the object, technical solutions and advantages of the present invention clearly, below in conjunction with accompanying drawing, the embodiments of the present invention are explained in detail.But, persons of ordinary skill in the art may appreciate that in each embodiment of the present invention, proposing many ins and outs to make reader understand the application better.But, even without these ins and outs with based on the many variations of following embodiment and amendment, each claim of the application technical scheme required for protection also can be realized.
NRDP1 gene and body anti-inflammatory and antiviral relevant may be the drug targets all in the treatment of various pathogenic infection with potential using value.The present embodiment application TALENs technology, codon mutation operation is carried out in the AGCT site for mouse NRDP1 gene exon1, thus realizes the modification of mouse NRDP1 gene.
Experimental program relates to as follows:
The first step, designs according to the gene order that need knock out and has specific sequence TALEN target spot;
Second step, the TALEN target spot according to designing constructs TALEN plasmid;
3rd step, TALEs plasmid modifies the detection of the efficiency of goal gene;
4th step, in-vitro transcription obtains the efficient mRNA modifying the TALEN plasmid of goal gene, in all gaps of ovum of injection mouse fertilized egg, migrates in the uterus of the female mouse of acceptor, obtains the transgenic mice of goal gene modification after farrowing.
5th step, genetic modification mouse and wild-type mice mating, the newborn mouse obtained records heterozygote individual through PCR and Western-Blotting, and between heterozygote, mating obtains homozygote mouse.
The action principle schematic diagram of TALENs pointed decoration mouse NRDP1 gene as shown in Figure 1.
The experimental technique used in following example is ordinary method if no special instructions, and material used in following example, reagent etc., if no special instructions, all can buy acquisition from commercial channels, and available similar reagents or test kit substitute.
The design of embodiment 1 mouse NRDP1 gene TALENs target sequence and plasmid construction
This example material requested and reagent FastTALETMTALENAssemblykit test kit are provided by SidansaiBiotechnologyCO., LTD (http://www.sidansai.com/).This test kit is by 8 skeleton carriers, and 172 RVD monomer identification modules and 5 kinds of model calling operate the compositions such as liquid.
This example, for mouse NRDP1 gene exon1 sequence, adopts TALeffectorNucleotideTarger2.0 (https: //tale-nt.cac.cornell.edu/node/add/talen) to design identification module, and 5' end retains T base.Choosing TALMEX-1F and TALMEX-1R is that the AGCT site of identification module to mouse NRDP1 gene exon1 sequence is modified.
TALNRD-1F:CCTCAGTAAACTTCGCCT
TALNRD-1R:TATAGCATCTTTGCTGAT
With reference to FastTALETMTALENAssemblykit operation instruction, select corresponding link block according to TALMEX-1F and TALMEX-1R identification module, build pTALEN-L plasmid and pTALEN-R plasmid respectively.Transformed competence colibacillus cell is gone forward side by side row filter, and ClaI enzyme is cut qualification and order-checking and obtained and connect correct pTALEN-L and pTALEN-R plasmid.
Embodiment 2TALENs Activity determination
The amplification of pTALEN-L plasmid, pTALEN-R plasmid and cell DNA, extraction and purification are carried out with reference to the method for " Molecular Cloning: A Laboratory guide " second edition.Recovery mouse 3T3-L1 cell is (containing 1640 substratum, 10%FBS), utilize lipofectacmin2000 by pTALEN-L and pTALEN-R plasmid co-transfection in mouse 3T3-L1 cell, pcr amplification goal gene, by the catastrophe of its goal gene of order-checking qualification, go step as follows:
(1) be that the cell of 3x105 is inoculated into 6 orifice plates by density, treat that cytogamy is to 90% ~ 95%, prepare transfection;
(2) 240 μ LOpti-MEM dilute the liposome of 4 μ g plasmids and 10 μ L respectively, and room temperature respectively places 5min;
(3) liposome diluted and plasmid mixing, room temperature places 20min;
(4) mixed solution joins in the cell hole containing the serum free medium of 2mL;
(5) in 37 DEG C, cultivate 6h under 5%CO2 condition;
(6) the full nutrient solution changed after cultivating 6h containing serum continues to cultivate.
After TALENs transfected 3T3-L1 cell 48h, collecting cell, extracts its complete genome DNA, carries out PCR detection.It is as follows that PCR detects primer:
NRDP1-F:acctctgctcctagaatctgcttgc
NRDP1-R:agcgttgtcacaggcaatctgtag
PCR reaction conditions: 95 DEG C of denaturation 5min; 94 DEG C of sex change 30s, 58 DEG C of renaturation 30s, 72 DEG C extend 30s, totally 30 circulations; Then 72 DEG C extend 10min, last 4 DEG C of preservations; Utilize agarose electrophoresis to detect PCR primer, obtain single comparatively bright wisp band and carry out TA clone, next day, picking mono-clonal carried out order-checking qualification, and sequencing primer is primers designed;
Utilize NCBIBLASt to carry out wild-type mice NRDP1 the sequence that order-checking obtains to compare, if there is transgenation, then goal gene obtains sudden change, judges the modification of the TALENs of goal gene according to mutant clon number/total clone's number x100%.
When detected result illustrates and uses the mouse 3T3-L1 clone of TALENs process of the present invention, that can efficiently fix a point modifies mouse NRDP1 gene, thus realization is to the transformation of NRDP1 gene coded sequence or knock out.
Embodiment 3 in-vitro transcription obtains the mRNA of goal gene TALENs
The present invention with in embodiment 2 obtain a pair TALENs for template, in-vitro transcription obtains mRNA, and obtains the transgenic mice of goal gene modification in direct injection to mice embryonic, and mouse model prepared by the present invention is not containing any external source screening-gene, cycle is short, and cost is low and efficiency is high.
The test kit mMESSAGE of in-vitro transcription
highyieldcappedRNA transcript reagent box and RNA purification kit MEGAclear
tMkit is all purchased from Ambion, and its operation steps is as follows:
The preparation of template DNA: pcr template or linearization plasmid
Add cap responsive transcription:
1. under room temperature, system is transcribed in preparation
Consumption | Composition |
To20μL | Nuclease-free Water |
10μL | 2×NTP/CAP |
2μL | 10×Reaction Buffer |
1μL | (optional)[α-32P]UTP as a tracer |
1μg | Linear template DNA (1 μ g linearized plasmid templates) |
2μL | Enzyme Mix |
2. thoroughly mix
Hatch 1h for 3.37 DEG C
4.RNA purifying, MEGclearKit
TLANEs in-vitro transcription mRNA product electrophorogram as shown in Figure 2.
The acquisition of embodiment 4NRDP1 genetic modification mouse model
Use the mouse of C57BL/6 background as laboratory mice, be used for preparing NRDP1 knock out mice, its operation steps is as follows:
1. the superovulation of female mouse and mating
2. operation obtains super row's mouse fertilized egg
3.TALENsmRNA mixture microinjection mouse is fertilized
4. zygote vitro culture, migrates to Recipient mice.
5. Recipient mice spontaneous labor, newborn mouse carries out PCR identified gene type
The present embodiment co-transplantation three acceptor replace-conceive mouse, young 12 of common property, have the NRDP1 gene of 10 mouse to there occurs sudden change after testing, the efficiency of its genetic modification is 83.3%.
Concrete NRDP1 genetic modification efficiencies is as shown in the table:
The acceptor number of transplanting | Litter size | The mutant number of farrowing | Mutation rate |
1 | 5 | 3 | 60% |
1 | 2 | 2 | 100% |
1 | 5 | 5 | 100% |
The genotype identification of embodiment 5NRDP1 knock out mice
Cut the ear (about 3mm2) of the NRDP1 hybrid mice obtained through embodiment 4 or toe in mouse ear Digestive system, 55 DEG C digest at least 4 hours, boil 5-10 minute, room temperature 12, centrifugal 5 minutes of 000rpm, precipitation, after 70% washing with alcohol twice, is dissolved in 50ul distilled water, is namely can be used as pcr template.
Mouse ear Digestive system composition: KCl500mM, Tris-HCl100mM, gelatin 0.1mg/ml, NP-400.45%,
Tween200.45%, Proteinase K (face used time add) 0.5mg/ml.
PCR detects primer:
NRDP1-F:acctctgctcctagaatctgcttgc
NRDP1-R:agcgttgtcacaggcaatctgtag
PCR reaction conditions 95 DEG C of denaturation 5min; 94 DEG C of sex change 30s, 58 DEG C of renaturation 30s, 72 DEG C extend 30s, totally 30 circulations; Then 72 DEG C extend 10min, last 4 DEG C of preservations;
Utilize agarose electrophoresis to detect PCR primer, obtain single comparatively bright wisp band and carry out order-checking qualification, sequencing primer is primers designed;
Utilize NCBIBLASt to carry out wild-type mice NRDP1 the sequence that order-checking obtains to compare, obtain NRDP1 mutant mouse genotype.
NRDP1 knock out mice F0 for s84, s86, s87, s168, s169, s170, s173 sample order-checking peak figure and TA cloning and sequencing result (note: WT represents wildtype gene sequence) as shown in accompanying drawing 3 ~ 9, wherein:
Accompanying drawing 3 is the gene sequencing peak figure of NRDP1 knock out mice F0 for s84 mouse, and graphical results shows, order-checking qualification result is gomphosis mouse.After PCR primer being connected into Topo carrier, chimeric rate is at 4/10 (-1bp).
Accompanying drawing 4 is the gene sequencing peak figure of NRDP1 knock out mice F0 for s86 mouse, and graphical results shows:
WT:ttctaggcgcctcattgtgagcatgccttctgcaacg
Mut:ttct------------------------------------gcaacg-27bp
Order-checking qualification result is for singly to strike chimeric mice, and 25bp is on exon.
Accompanying drawing 5 is the gene sequencing peak figure of NRDP1 knock out mice F0 for s87 mouse, and graphical results shows:
WT:ttctaggcgcctcattgtgagcatgccttctgcaacg
Mut1:ttctaggcgcctcattgtga-------------tgcaacg-10bp
Mut2:ttctaggcgcctcattgtgagAcatgccttctgcaacg+1b
Order-checking qualification result strikes Mice homozygous for two.
Accompanying drawing 6 is the gene sequencing peak figure of NRDP1 knock out mice F0 for s168 mouse, and graphical results shows:
WT:ttctaggcgcctcattgtgagcatgccttctgcaacg
Mut:ttct------------------------------------gcaacg-27bp
Order-checking qualification result is for singly to strike chimeric mice.
Accompanying drawing 7 is the gene sequencing peak figure of NRDP1 knock out mice F0 for s168 mouse, and graphical results shows:
WT:cagcagacgtgtccggtagaccgt
Mut:cag---acgtgtccggtagaccgt-3bp
Order-checking qualification result is for singly to strike chimeric mice.
Accompanying drawing 8 is the gene sequencing peak figure of NRDP1 knock out mice F0 for s170 mouse, and graphical results shows:
WT:gtgagcatgccttctgcaacg
Mut:gtg-----------------caacg-13bp
Order-checking qualification result is for singly to strike chimeric mice.
Accompanying drawing 9 is the gene sequencing peak figure of NRDP1 knock out mice F0 for s173 mouse, and graphical results shows:
WT:gcctcattgtgagcatgccttctgcaacgcctgcatcac
Mut1:gc------------------------------aacgcctgcatcac-23bp
Mut2:gcct-------------------------------------gcatcac-28bp
Order-checking qualification result strikes homozygote mouse for two.
The cultivation of embodiment 6 homozygote NRDP1 gene knock-out mice model
Mouse feeder is in SPF level Animal House, and clean drinking-water, freely takes food.Environment adopts light and shade circulation in 12 hours, and morning 6, evening 6 to next day is 6 nothing illuminations early to 6 illuminations in evening.All experimentation on animalies are all carried out according to institute of Shanghai Univ. of Traditional Chinese Medicine management of laboratory animal regulations.Identify that the F0 that obtains backcrosses for NRDP1 clpp gene deratization heterozygote and C57BL/6J mouse (must triumphant Experimental Animal Center purchased from the western pul in Shanghai), obtain F1 generation NRDP1 clpp gene deratization heterozygote, the mutual mating of heterozygote, obtain 22 F2 for the deratization of NRDP1 clpp gene, wherein wild-type 6, heterozygote 11, homozygote 5; Meet mendel's law, the NRDP1 clpp gene deratization homozygote PCR method obtained and the qualification of Western-Blotting method, sub-mouse wean after 3 weeks, male and female sub-cage rearing, every cage is no more than 5.Mouse special feed must triumphant Experimental Animal Center be provided by the western pul in Shanghai.
NRDP1 knock out mice F3 for part homozygote mouse PCR detected result electrophorogram as shown in Figure 10.NRDP1 knock out mice F3 checks order peak figure as shown in accompanying drawing 11 and accompanying drawing 12 for part homozygote mouse, wherein:
Accompanying drawing 11 for sample number into spectrum be the NRDP1 knock out mice F3 of 55 for the gene sequencing peak figure of part homozygote mouse, graphical results shows:
WT:ttctaggcgcctcattgtgagcatgccttctgcaacg
Mut:ttctaggcgcctcatt------------------ctgcaacg-13bp
Accompanying drawing 12 for sample number into spectrum be the NRDP1 knock out mice F3 of 58 for the gene sequencing peak figure of part homozygote mouse, graphical results shows:
WT:ttctaggcgcctcattgtgagcatgccttctgcaacg
Mut:ttct--------------------------------------gcaacg-27bp
Embodiment 7Western-Blotting detects the expression of the endogenous NRDP1 albumen of NRDP1 clpp gene deratization
(1) Tissue Lysis: extract mouse tissue total protein with RIPA cracking process, concrete operations are as follows: add lysate by tissue block 8-10 times of volume, and with the abundant homogenate of glass homogenizer, be placed in cracking 30min on ice, waggle makes the abundant cracking of cell.By Tissue Lysis product centrifugal 5min of 12000rpm at 4 DEG C, draw supernatant ,-20 DEG C of preservations are stand-by.
(2) total protein of cell is quantitative: adopt BCA method to carry out the quantitative of total protein of cell, concrete steps are shown in Pierce company specification sheets.
(3) polyacrylamide gel electrophoresis (SDS-PAGE): add isopyknic 2 × loadingbuffer by each sample 15ug, boiling water bath 5min.Prepare 12% polyacrylamide gel, in glycine electrophoresis is slow, electrophoresis under 120V condition.
(4) transferring film: utilize semi-dryelectroblotting albumen in gel to be transferred to pvdf membrane, constant voltage 12V, transferring film time 45min.
(5) close: at 4 DEG C, on horizontal shaker, close 1h with confining liquid.
(6) combination of first antibody: goat against murine NRDP1 monoclonal antibody is diluted 2000 times with confining liquid, dilutes 1000 times with confining liquid by mouse-anti goat β-actin monoclonal antibody, hatches 1h at 4 DEG C on horizontal shaker with pvdf membrane.Afterwards, with TBST buffer solution filter membrane 3 times, each 15min.
(7) combination of second antibody: with confining liquid, horseradish peroxidase HRP is coupled the anti-sheep IgG antibody of rabbit and dilutes 1000 times, hatch 1h with pvdf membrane at 4 DEG C on horizontal shaker.With TBST buffer solution filter membrane 3 times, each 10min.
(8) color reaction: mixed with the ratio of 1:1 by SolutionA and B in nitrite ion before using, be placed in by pvdf membrane on clean preservative film, ECL mixed solution instills from top to bottom, left at room temperature reaction 5min; With clean paper handkerchief, ECL mixed solution unnecessary on pvdf membrane is removed, then to wrap with preservative film, put into piece pressing clip together with film in darkroom exposure, expose rear developing liquid developing, distilled water cleans, stop bath fixing come exposed plate.
Persons of ordinary skill in the art may appreciate that the respective embodiments described above realize specific embodiments of the invention, and in actual applications, various change can be done to it in the form and details, and without departing from the spirit and scope of the present invention.
Claims (10)
1. the gene site-directed modification system of mouse NRDP1, is characterized in that, described gene site-directed modification system is the transcriptional activation sample effector nuclease TALENs shearing mouse NRDP1 gene target sequence;
Described mouse NRDP1 gene target sequence as shown in SEQIDNO.1, in described SEQIDNO.1 sequence: 20 ~ 40 Nucleotide be identification module TALNRD-2F, with the complementary sequence of 57 ~ 74 Nucleotide be identification module TALNRD-2R, 40 ~ 56 Nucleotide are intervening sequence;
Described transcriptional activation sample effector nuclease TALENs is by identifying the nuclease TALEN-L of described identification module TALNRD-2F and identifying that the nuclease TALEN-R of described identification module TALNRD-2R forms; Described nuclease TALEN-L is protein nucleotide sequence coded shown in SEQIDNO.2, and described nuclease TALEN-R is protein nucleotide sequence coded shown in SEQIDNO.3.
2. the gene site-directed modification system of mouse NRDP1 according to claim 1, is characterized in that, described nuclease TALEN-L is formed with merging through engineered DNA scinderin Fok-I by the recognition structure territory TALEN-L of described identification module TALNRD-2F; Described nuclease TALEN-R is formed with merging through engineered DNA scinderin Fok-I by the recognition structure territory TALEN-R of described identification module TALNRD-2R.
3. the application of the gene site-directed modification system of mouse NRDP1 described in claim 1 in mammalian cell or embryo NRDP1 genetic modification.
4. application according to claim 3, is characterized in that, described in be applied as and set up NRDP1 gene knock-out mice model.
5. an establishment method for NRDP1 gene knock-out mice model, is characterized in that, comprises the steps:
(1) according to mouse NRDP1 gene target sequence as shown in SEQIDNO.1, build there is nucleotide sequence shown in SEQIDNO.2 pTALEN-L plasmid and SEQIDNO.3 shown in the pTALEN-R plasmid of nucleotide sequence;
(2) by the in-vitro transcription mRNA mixture that to obtain with described pTALNRD-L plasmid and pTALNDR-R plasmid be template, microinjection is to ovum week of mice embryonic in gap;
(3) mice embryonic that step (2) obtains is transplanted to Recipient mice uterus, farrowing obtains the mouse of NRDP1 genetic modification;
(4) mouse of the NRDP1 genetic modification making step (3) obtain and wild-type mice mating, the newborn mouse obtained records through PCR and Western-Blotting and knocks out heterozygote individual, between heterozygote, mating obtains homozygote mouse, namely completes the foundation of NRDP1 gene knock-out mice model.
6. the establishment method of NRDP1 gene knock-out mice model according to claim 5, it is characterized in that, also comprise the step of the pTALNRD-L plasmid obtained in step (1) and pTALNDR-R plasmid being carried out to Activity determination, select, to mouse NRDP1 gene, there is the pTALNRD-L plasmid of modification activities and pTALNDR-R plasmid is the in-vitro transcription that template carries out in described step (2).
7. the establishment method of NRDP1 gene knock-out mice model according to claim 6, it is characterized in that, the step that described pTALNRD-L plasmid to obtaining in step (1) and pTALNDR-R plasmid carry out Activity determination is: by described pTALEN-L plasmid and pTALEN-R plasmid co-transfection in mouse cell, whether pcr amplification goal gene, undergone mutation by order-checking qualification goal gene.
8. the establishment method of NRDP1 gene knock-out mice model according to claim 5, is characterized in that, also comprises the step of described NRDP1 gene knock-out mice model being carried out to identification and analysis after step (4).
9. the establishment method of NRDP1 gene knock-out mice model according to claim 8, is characterized in that, describedly to the step that NRDP1 gene knock-out mice model carries out identification and analysis is:
(1) DNA sequencing is carried out to NRDP1 target site, the genotype of qualification mouse model;
(2) disappearance of mouse each histoorgan NRDP1 albumen is detected by Western-Blotting;
(3) utilize Western-Blotting to monitor and cause because of NRDP1 protein delation the change that each signaling pathway protein is expressed;
(4) observe each histoorgan of mouse or organize whether because of NRDP1 protein delation, pathology occurs.
10. the recombinant expression vector containing the gene site-directed modification system encoding gene of mouse NRDP1 according to claim 1, recombinant bacterium or recombinant cell lines.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201610005851.4A CN105567659A (en) | 2016-01-05 | 2016-01-05 | Mouse NRDP1 gene site-specific modification system and applications thereof |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201610005851.4A CN105567659A (en) | 2016-01-05 | 2016-01-05 | Mouse NRDP1 gene site-specific modification system and applications thereof |
Publications (1)
Publication Number | Publication Date |
---|---|
CN105567659A true CN105567659A (en) | 2016-05-11 |
Family
ID=55878289
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201610005851.4A Pending CN105567659A (en) | 2016-01-05 | 2016-01-05 | Mouse NRDP1 gene site-specific modification system and applications thereof |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN105567659A (en) |
Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN101897950A (en) * | 2009-05-31 | 2010-12-01 | 中国人民解放军第二军医大学 | Antiviral actions, implementation method and use of novel antiviral molecule DRP |
WO2013192316A1 (en) * | 2012-06-21 | 2013-12-27 | Recombinetics, Inc. | Genetically modified animals and methods for making the same |
-
2016
- 2016-01-05 CN CN201610005851.4A patent/CN105567659A/en active Pending
Patent Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN101897950A (en) * | 2009-05-31 | 2010-12-01 | 中国人民解放军第二军医大学 | Antiviral actions, implementation method and use of novel antiviral molecule DRP |
WO2013192316A1 (en) * | 2012-06-21 | 2013-12-27 | Recombinetics, Inc. | Genetically modified animals and methods for making the same |
Non-Patent Citations (9)
Title |
---|
CHEN WANG ET AL.: "The E3 ubiquitin ligase Nrdp1‘preferentially’promotes TLR-mediated production of type I interferon", 《NATURE IMMUNOLOGY》 * |
J. KEITH JOUNG ET AL.: "TALENs: a widely applicable technology for targeted genome editing", 《NATURE REVIEWS MOLECULAR CELL BIOLOGY》 * |
LILY YEN ET AL.: "Loss of Nrdp1 Enhances ErbB2/ErbB3-Dependent Breast Tumor Cell Growth", 《CANCER RESEARCH》 * |
SKARNES W C ET AL.: "Mus musculus targeted KO-first, conditional ready, lacZ-tagged mutant allele Rnf41:tm1a(EUCOMM)Hmgu; transgenic Accession number:JN945847.1", 《GENBANK》 * |
YE S ET AL.: "Mus musculus ring finger protein 41 (Rnf41),transcript variant 1,RNA Accession number:NM_001164237.1", 《GENBANK》 * |
叶硕: "E3连接酶Nrdp1调控巨噬细胞功能及其分子机制研究", 《中国博士学位论文全文数据库-医药卫生科技辑》 * |
张欢欢等: "利用TALEN技术高效制备TXNIP基因敲除小鼠模型", 《中国比较医学杂志》 * |
曹雪涛: "E3泛素连接酶Nrdp1优先促进TLR介导的I型干扰素产生", 《中国基础科学》 * |
杨明金: "E3泛素连接酶CHIP和Nrdp1在免疫应答反应中的调控作用及其机制研究", 《中国博士学位论文全文数据库-医药卫生科技辑》 * |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Sun et al. | Screening and characterization of sex-linked DNA markers and marker-assisted selection in the Nile tilapia (Oreochromis niloticus) | |
Wang et al. | Multiplex gene editing via CRISPR/Cas9 exhibits desirable muscle hypertrophy without detectable off-target effects in sheep | |
CN106191113A (en) | A kind of preparation method of MC3R gene knock-out pig | |
CN107287245A (en) | A kind of construction method of the Glrx1 Gene Knock-Out Animal Model models based on CRISPR/Cas9 technologies | |
CN106191114A (en) | CRISPR Cas9 system is utilized to knock out the breeding method of Fish MC4R gene | |
CN105132427A (en) | Method for acquiring gene editing sheep by RNA-mediated specific double-gene knockout and special sgRNA for method | |
CN107119076A (en) | A kind of immunodeficient mouse model, its preparation method and application | |
Rehman et al. | Whole-genome sequencing and characterization of buffalo genetic resources: recent advances and future challenges | |
WO2018045727A1 (en) | Method for constructing an animal model for mucopolysaccharidosis type ii, and applications thereof | |
CN110055223A (en) | A kind of preparation method and applications of the immunodeficient animals of B2m genetic modification | |
CN103798169B (en) | A kind of method setting up YY supermale yellow cartfish improvement breeding line fast | |
Chen et al. | Research advances and future perspectives of genomics and genetic improvement in allotetraploid common carp | |
WO2018141127A1 (en) | Construction method for immunodeficient rat model | |
CN109593762A (en) | Diamondback moth APN1 gene and its application are knocked out using CRISPR/Cas9 gene editing system | |
CN106480099B (en) | The H11 fixed point that conditionity is overexpressed Spp1 gene knocks in hybrid mice model and its construction method | |
CN111560401A (en) | Molecular breeding method for thickening interpuscular spurs of erythroculter ilishaeformis and megalobrama amblycephala | |
Hu et al. | Differences in sex reversion and growth between normal and neomale stock in half-smooth tongue sole, Cynoglossus semilaevis | |
Wang et al. | Genetic evidence for the mating system and reproductive success of black sea bream (Acanthopagrus schlegelii) | |
CN113699152A (en) | Construction method and application of SLC35E2B gene knockout mouse animal model | |
Wang et al. | CRISPR/Cas9 microinjection of transgenic embryos enhances the dual-gene integration efficiency of antimicrobial peptide genes for bacterial resistance in channel catfish, Ictalurus punctatus | |
CN105505879B (en) | A kind of method and culture medium for cultivating transgenic animal embryo cell or transgenic animals | |
CN108300738B (en) | Preparation method of humanized mouse model with NOD genetic background and neutrophilic granulocyte deletion | |
Guo et al. | Efficient and Specific Generation of MSTN-Edited Hu Sheep Using C-CRISPR | |
CN106399308A (en) | RNA interference fragment of zfy gene, expression vector and applications of RNA interference fragment and expression vector | |
Owen et al. | Harnessing endogenous repair mechanisms for targeted gene knock-in of bovine embryos |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
RJ01 | Rejection of invention patent application after publication |
Application publication date: 20160511 |
|
RJ01 | Rejection of invention patent application after publication |