CN105561313A - Application of substance capable of lowering content of 5-HT2BR and inhibiting activity of 5-HT2BR in preparation of product for treating and preventing atherosclerosis - Google Patents
Application of substance capable of lowering content of 5-HT2BR and inhibiting activity of 5-HT2BR in preparation of product for treating and preventing atherosclerosis Download PDFInfo
- Publication number
- CN105561313A CN105561313A CN201610049371.8A CN201610049371A CN105561313A CN 105561313 A CN105561313 A CN 105561313A CN 201610049371 A CN201610049371 A CN 201610049371A CN 105561313 A CN105561313 A CN 105561313A
- Authority
- CN
- China
- Prior art keywords
- ht2br
- atherosclerosis
- animal body
- smooth muscle
- application
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
- A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
Abstract
The invention discloses application of a substance capable of lowering the content of a 5-HT2BR and inhibiting the activity of the 5-HT2BR in preparation of a product for treating and preventing atherosclerosis. Experiments prove that a 5-HT2BR specificity antagonist capable of lowering the expression level of the 5-HT2BR can inhibit migration of smooth muscle cells, decrease the content of the smooth muscle cells in atherosclerotic plaques and inhibit formation of the atherosclerotic plaques; a 5-HT2BR specificity agonist capable of increasing the expression level of the 5-HT2BR can promote migration of the smooth muscle cells. The 5-HT2BR and encoding genes of the 5-HT2BR can serve as a target protein and target genes which are used for treating and/or preventing an atherosclerosis lesion respectively, and the substance capable of lowering the expression level of the 5-HT2BR or inhibiting the activity of the 5-HT2BR can be used for treating and preventing diseases caused by atherosclerosis and also can be used for preparing drugs for treating and/or preventing the diseases caused by atherosclerosis.
Description
Technical field
The present invention relates in biomedical sector and reduce 5-HT2BR content and suppress the application of the material of its activity in preparation treatment and the atherosis product of prevention of arterial.
Background technology
Atherosclerosis is because fat, thrombosis, connective tissue and calcium carbonate deposit a kind of harmful state caused at blood vessel (mainly tremulous pulse), it is a kind of major disease that height is fallen ill, height is dead, height is disabled of harm humans health, and it is even dead that this disease can cause patient's myocardial infarction, apoplexy.Atherosclerosis is the multifactor complex process that mechanism is not clear, and cause vascellum tunica interna incrassation, lipid enrichment also forms speckle.Current a kind of controversial theory thinks that the important composition composition-smooth muscle cell of blood vessel result in the growth of speckle, smooth muscle cell damage factor stimulate under there is Phenotypic Change, and from tunica media to inner membrance move, propagation; Be partially converted into foam cell and produce extracellular matrix, thus causing the narrow of Mottling formation and vessel lumen.
Serotonin (5-HT) is a kind of monoamine neurotransmitter, and the 5-HT of 90% derives from enterochromaffin cell, regulation and control enterokinesia.All the other units of the serotoninergic nerve from cental system, regulation and control emotion, appetite and sleep.Platelet is the storage place of 5-HT, and when platelet runs into grumeleuse, 5-HT is released, and causes vasoconstriction, helps blood coagulation.The function of 5-HT is receptor-mediated by 5-HT, and 5-HT receptor has 7 families (5-HT1R-5-HT7R), 14 kinds of subtype acceptors.Except 5-HT3R is part cationic channel, all the other 5-HT receptors are G-G-protein linked receptor (Gprotein-coupledreceptor, GPCR).5-HT2 receptor (5-HT2R) comprises 5-HT2A receptor (5-HT2AR), 5-HT2B receptor (serotonin 2B receptor, 5-HT2BR) and 5-HT2C receptor (5-HT2CR) three kinds of hypotypes.
Summary of the invention
Technical problem to be solved by this invention how to treat and/or prevent atherosclerosis and atherosclerosis associated diseases.
For solving the problems of the technologies described above, the present invention provide firstly the material that reduces 5-HT2BR content in animal body or/and suppress the material of 5-HT2BR activity in animal body to treat and/or prevent atherosclerosis product or by the application in the product of atherosclerosis associated diseases in preparation.
In above-mentioned application, in described reduction animal body, the material of 5-HT2BR content can be and reduces the material that in animal body, 5-HT2BR encoding gene is expressed, as the method disturbed by RNA or the factor expressed by regulating and controlling scalable 5-HT2BR encoding gene reduce the material that in arteries, 5-HT2BR encoding gene is expressed.
In above-mentioned application, in described reduction animal body, in the material of 5-HT2BR content or described suppression animal body, the material of 5-HT2BR activity can be 5-HT2BR antagonist (as LY272015 or RS127445).LY272015 specifically can be TocrisBioscience Products, and article No. is 3077; RS127445 specifically can be TocrisBioscience Products, and article No. is 2993.
In above-mentioned application, described product can be and treats and/or prevents atherosclerosis or the medicine by atherosclerosis associated diseases.
In above-mentioned application, described animal body can be the various positions of described animal, as tremulous pulse.Described tremulous pulse can be aorta, aortic branch, coronary artery, carotid artery, cerebral arteries, renal artery, Mesenteric artery, pulmonary artery or artery of extremity.
In above-mentioned application, the disease that the exception that described atherosclerosis associated diseases can be vascular smooth muscle cell exception or T-CHOL or total content of triglyceride causes; The atherosclerosis that the exception that described atherosclerosis can be vascular smooth muscle cell exception or T-CHOL or total content of triglyceride causes.Described vascular smooth muscle cell is abnormal can be the migration of described vascular smooth muscle cell, propagation and/or Phenotypic change.Described T-CHOL or total content of triglyceride can be T-CHOL or total content of triglyceride in blood plasma.The exception of described T-CHOL or total content of triglyceride can be T-CHOL or total content of triglyceride in blood plasma and raises.
In above-mentioned application, described atherosclerosis associated diseases can be coronary heart disease.
For solving the problems of the technologies described above, present invention also offers following arbitrary purposes:
H1) in described reduction animal body, in the material of 5-HT2BR content or described suppression animal body, the material of 5-HT2BR activity is treating and/or preventing atherosclerosis or by the application in atherosclerosis associated diseases;
H2) in described reduction animal body, in the material of 5-HT2BR content or described suppression animal body, the material of 5-HT2BR activity suppresses the application in smooth muscle cell migration product in preparation;
H3) in described reduction animal body, in the material of 5-HT2BR content or described suppression animal body, the material of 5-HT2BR activity is suppressing the application in smooth muscle cell migration;
H4) 5-HT2BR is treating and/or preventing atherosclerosis or by the application in atherosclerosis associated diseases as target proteins;
H5) encoding gene of 5-HT2BR is treating and/or preventing atherosclerosis or by the application in atherosclerosis associated diseases as target gene;
H6) application of 5-HT2BR or 5-HT2BR agonist in preparation Atherosclerosis Model.
In such use, described 5-HT2BR agonist can be 5-HT2BR specific agonist BW723C86.BW723C86 specifically can be TocrisBioscience Products, and article No. is 1059.
In such use, described animal body can be the various positions of described animal, as tremulous pulse.Described tremulous pulse can be aorta, aortic branch, coronary artery, carotid artery, cerebral arteries, renal artery, Mesenteric artery, pulmonary artery or artery of extremity.
In such use, the disease that the exception that described atherosclerosis associated diseases can be vascular smooth muscle cell exception or T-CHOL or total content of triglyceride causes; The atherosclerosis that the exception that described atherosclerosis can be vascular smooth muscle cell exception or T-CHOL or total content of triglyceride causes.Described vascular smooth muscle cell is abnormal can be the migration of described vascular smooth muscle cell, propagation and/or Phenotypic change.Described T-CHOL or total content of triglyceride can be T-CHOL or total content of triglyceride in blood plasma.The exception of described T-CHOL or total content of triglyceride can be T-CHOL or total content of triglyceride in blood plasma and raises.
In such use, described atherosclerosis associated diseases can be coronary heart disease.
For solving the problems of the technologies described above, present invention also offers following X1) or product X2):
X1) treat and/or prevent the medicine of described atherosclerosis or described atherosclerosis associated diseases, its active component is the material of 5-HT2BR activity in the material of 5-HT2BR content in described reduction animal body or described suppression animal body;
X2) be used for the treatment of and/or prevent the material X of described atherosclerosis or described atherosclerosis associated diseases, described material X to be the material of 5-HT2BR activity in the material of 5-HT2BR content in described reduction animal body or described suppression animal body.
In the said goods, described animal body can be the various positions of described animal, as tremulous pulse.Described tremulous pulse can be aorta, aortic branch, coronary artery, carotid artery, cerebral arteries, renal artery, Mesenteric artery, pulmonary artery or artery of extremity.
In the said goods, the disease that the exception that described atherosclerosis associated diseases can be vascular smooth muscle cell exception or T-CHOL or total content of triglyceride causes; The atherosclerosis that the exception that described atherosclerosis can be vascular smooth muscle cell exception or T-CHOL or total content of triglyceride causes.
In the said goods, described vascular smooth muscle cell is abnormal can be the migration of described vascular smooth muscle cell, propagation and/or Phenotypic change.Described T-CHOL or total content of triglyceride can be T-CHOL or total content of triglyceride in blood plasma.The exception of described T-CHOL or total content of triglyceride can be T-CHOL or total content of triglyceride in blood plasma and raises.
In the said goods, described atherosclerosis associated diseases can be coronary heart disease.
In the present invention, treat and/or prevent atherosclerosis, treat and/or prevent atherosclerosis associated diseases and all can be: treat with atherosclerosis associated diseases or before preventing compared with, atheromatous plaque quantity reduces and/or atheromatous plaque reduces and/or in weight loss and/or blood plasma, the content of T-CHOL and/or total triglyceride declines.
In the present invention, described animal can be mammal, as people.Described atherosclerosis and described atherosclerosis associated diseases can be mammal atherosclerosis and atherosclerosis associated diseases respectively, as atherosclerosis and the atherosclerosis associated diseases of people.
In the present invention, 5-HT2BR is the 5-HT2BR in vitro animal tissue, as the 5-HT2BR in people, mice or isolated rat tissue.The aminoacid sequence of the 5-HT2BR of people is sequence 1; The aminoacid sequence of the 5-HT2BR of mice is sequence 2; The aminoacid sequence of the 5-HT2BR of rat is sequence 3.
The Phenotypic change of the vascular smooth muscle cell in the present invention refers to the conversion of vascular smooth muscle cell between higher shrinkage type (differentiated) vascular smooth muscle cell of differentiation degree and lower secreting type (undifferentiated type or the dedifferentiated) vascular smooth muscle cell of differentiation degree.
Experiment proves, 5-HT2BR of the present invention and encoding gene thereof respectively can as target proteins and the target genes treating and/or preventing atherosclerosis associated diseases.On RNA and protein level, the expression of 5-HT2BR in atherosclerosis animal aorta is all significantly higher than non-atherosclerosis animal.The 5-HT2BR specific antagonists reducing 5-HT2BR expression can suppress the migration of smooth muscle cell, the 5-HT2BR specific agonist improving 5-HT2BR expression can promote the migration of smooth muscle cell: 1) process 24 hours, the migration distance of the smooth muscle cell after the process of 5-HT2BR specific agonist is 221.4 ± 12.8 μm, is respectively 1.621 times and 0.922 times of untreated and 5-HT process; The migration distance of the smooth muscle cell after the process of 5-HT2BR specific antagonists is 133.7 ± 10.9 μm, is respectively untreated, 0.979 times, 0.557 times and 0.604 times of the process of 5-HT and 5-HT2BR specific agonist.2) process 24 hours, the migratory activity of the smooth muscle cell after the process of 5-HT2BR specific agonist is 96.80 ± 20.63, is respectively 2.151 times and 0.896 times of untreated and 5-HT process; The migratory activity of the smooth muscle cell after the process of 5-HT2BR specific antagonists is 52.60 ± 7.467, is respectively untreated, 1.169 times, 0.487 times and 0.543 times of the process of 5-HT and 5-HT2BR specific agonist.The 5-HT2BR specific antagonists reducing 5-HT2BR expression can suppress the formation of atheromatous plaque: the atheromatous plaque area 2.758 ± 0.456mm of the test group of animals of 5-HT2BR specific antagonists RS127445 process
2, be significantly less than control animals; The aortic valve plaque area of the test group of animals of 5-HT2BR specific antagonists RS127445 process is 0.138 ± 0.022mm
2, be significantly less than control animals.The 5-HT2BR specific antagonists reducing 5-HT2BR expression can reduce total cholesterol level and total content of triglyceride in the body weight of animal and animal blood slurry.The 5-HT2BR specific antagonists reducing 5-HT2BR expression can also reduce the content of smooth muscle cell in atheromatous plaque: in the test group of animals aortic valve speckle of 5-HT2BR specific antagonists process, smooth muscle cell accounts for the percentage ratio of plaque area is 0.106 ± 0.023%, for 0.435 times of control animal, significantly lower than control animals.5-HT2BR specific antagonists can reduce total cholesterol level and total content of triglyceride in animal blood slurry: process the 12nd week, in test group of animals blood plasma, total cholesterol level is 0.78 times of control animals, and in test group of animals blood plasma, total content of triglyceride is 0.61 times of control animals.
Experiment proves, 5-HT2BR of the present invention and encoding gene thereof respectively can as target proteins and the target genes treating and/or preventing atherosclerosis associated diseases.The material reducing 5-HT2BR expression can be used for treating and/or preventing atherosclerosis associated diseases, also can be used for preparing the medicine treating and/or preventing atherosclerosis associated diseases.
Accompanying drawing explanation
Fig. 1 is that ApoE-/-mice feeds the oil red O stain result of different food aorta posterior from C57BL/6J mice.Wherein, A-F figure represents that ApoE-/-mice western diet (westerndiet, WD) feeds speckle oil red O stain after 12 weeks (illustrating that atherosclerosis animal model is successfully established).
Fig. 2 is the expression of the 5-HT2BR in each group of mouse aorta.Wherein, A is the expression of the 5-HT2BR on rna level in each group mouse aorta, and B is the expression respectively organizing the 5-HT2BR in mouse aorta at protein level; " * " represents that difference reaches significant level.
Fig. 3 is the result that each group of mouse aorta 5-HT2BR antibody carries out immunohistochemical staining.Wherein, A is the immunohistochemical staining result that ApoEWD (westerndiet, western diet) organizes mouse aorta (with plaque site), and in A, lower-left figure is the partial enlarged drawing of coloration result; B is the immunohistochemical staining result that ApoEWD (westerndiet, western diet) organizes mouse aorta (without plaque site), and in B, lower-left figure is the partial enlarged drawing of coloration result; C is C57 mouse aorta immunohistochemical staining result, and in C, lower-left figure is the partial enlarged drawing of coloration result; D is negative control.
Fig. 4 is the immunofluorescence dyeing result of mouse aorta.Wherein, 5-HT2BR represents the immunofluorescence dyeing result of ApoEWD group mouse aorta 5-HT2BR antibody; SMA represents the immunofluorescence dyeing result of ApoEWD group mouse aorta α-SMA antibody; DAPI represents ApoEWD group mouse aorta nuclear targeting result; Merge represents the superposition of 5-HT2BR, SMA and DAPI; NC represents negtivecontrol (negative control).
Fig. 5 is the cell scratch experiment result of different disposal smooth muscle cell migration.Wherein, A is different disposal smooth muscle cell migration situation, and B is the migration distance of different disposal smooth muscle cell; " * " represents that difference reaches significant level.
Fig. 6 is the trans-well experimental result of different disposal smooth muscle cell migration.Wherein, A is different disposal smooth muscle cell migration situation, and B is the migratory activity of different disposal smooth muscle cell; " * " represents that difference reaches significant level.
Fig. 7 is the impact of RS127445 on Atherosclerosis Model atherosclerotic plaque in mice.Wherein, A is the Aorta atheromatous plague of mice after RS127445 process; B is the concrete measured value of the Aorta atheromatous plague of mice after RS127445 process; C is the aortic valve atheromatous plaque of mice after RS127445 process; D is the concrete measured value of the aortic valve atheromatous plaque of mice after RS127445 process.RS127445 represents experimental group, and velhicle represents matched group." * " represents that difference reaches significant level.
Fig. 8 is the impact of RS127445 on total cholesterol level and total content of triglyceride in Atherosclerosis Model Mouse Weight and blood plasma.Wherein, A is the impact of RS127445 on body weight, and B is the impact of RS127445 on total cholesterol level in blood plasma, and C is the impact of RS127445 on content of triglyceride total in blood plasma.RS127445 represents experimental group, and velhicle represents matched group." * " represents that difference reaches significant level.
Fig. 9 is the impact of RS127445 on Atherosclerosis Model mice smooth muscle cell.Wherein, A is immunofluorescence dyeing result, and lumen represents aortic blood tube chamber, and RS127445 represents experimental group, and velhicle represents matched group; B is the percentage ratio that smooth muscle cell accounts for plaque area, and RS represents experimental group, and V represents matched group, and " * " represents that difference reaches significant level.SMA represents the immunofluorescence dyeing result of α-SMA antibody; DAPI represents nuclear targeting result; Merge represents the superposition of SMA and DAPI; NC represents negtivecontrol (negative control).
Figure 10 is the impact of RS127445 on 5-HT2BR expression in Atherosclerosis Model mice.Wherein, A is the expression of the 5-HT2BR on rna level in aorta; B utilizes western-blot to the testing result of 5-HT2BR expression; C utilizes immunohistochemical staining to the testing result of 5-HT2BR expression, and C1 is the partial enlarged drawing of Velhicle figure, and C2 is the partial enlarged drawing of RS127445 figure.RS127445 represents experimental group, and Velhicle represents matched group, and " * " represents that difference reaches significant level.
Detailed description of the invention
Below in conjunction with detailed description of the invention, the present invention is further described in detail, the embodiment provided only in order to illustrate the present invention, instead of in order to limit the scope of the invention.
Experimental technique in following embodiment, if no special instructions, is conventional method.
Material used in following embodiment, reagent etc., if no special instructions, all can obtain from commercial channels.
ApoE-in following embodiment/-mice is JacksonLab Products, and article No. is 002052; C57BL/6J mice in following embodiment is JacksonLab Products, and article No. is 000664.
Embodiment 1,5-HT2BR be high expressed in atherosclerosis mouse aorta
1, the foundation of Atherosclerosis Model
The male ApoE-in 20 8 week ages/-mice is divided into two groups at random, is respectively ApoECD (chowdiet, normal diet) group and ApoEWD (westerndiet, western diet) group, often organizes 10; The male C 57 BL/6 J mouse in 20 8 week ages is divided into two groups at random, is respectively C57CD group and C57WD group, often organize 10.Respectively every mice in ApoECD group and C57CD group is normally fed; Carry out high fat nursing to every mice in ApoEWD group and C57WD group respectively, nursing food is westerndiet (western diet, ResearchDiet company, D12079B).
The aorta getting each group of mice after feeding 12 weeks respectively carries out oil red O stain respectively, and result shows, and forms speckle (Fig. 1), show successfully to establish Atherosclerosis Model in ApoEWD group rat aorta blood vessel.
2, in Atherosclerosis Model, the expression of 5-HT2BR detects
In four groups of mices of step 1 with different diet after 12 weeks, rna level detects the expression (in Fig. 2 A) of the 5-HT2BR in aorta, primer is GGAGAAAAGGCTGCAGTACG and ATAACCAGGCAGGACACAGG, internal reference is β-actin, and the primer of internal reference is ATCGTGGGCCGCCCTAGGCACC and CTCTTTAATGTCACGCACGATTTC.Result shows, on rna level, 5-HT2BR in C57CD group and C57WD group mouse aorta expresses basic zero difference, and the equal high expressed of 5-HT2BR in ApoECD group and ApoEWD group mouse aorta, is significantly higher than the 5-HT2BR expression in C57CD group mouse aorta respectively.
In four groups of mices of step 1 with different diet after 12 weeks, utilize western-blot on protein level, detect the expression (in Fig. 2 B) of the 5-HT2BR in aorta, primary antibodie is 5-HT2BR antibody (BDPharmingen, 556334,5-HT2BR antibody can the 5-HT2BR shown in recognition sequence 2), internal reference is β-actin, and the antibody of internal reference is (SantaCruz, sc-47778).Result shows, and on protein level, the 5-HT2BR expression in C57CD group and C57WD group mouse aorta is lower, and the equal high expressed of 5-HT2BR in ApoECD group and ApoEWD group mouse aorta.
, with different diet get aorta and carry out vessel cross-sections frozen section after 12 weeks in four groups of mices of step 1, carry out immunohistochemical staining (Fig. 3) with 5-HT2BR antibody.ApoE-/-form Atherosclerosis Model (AS) after mice height fat feeds 12 weeks, compared with the C57BL/6J mice of normal diet, 5-HT2BR in the blood vessel film and plaque location expresses and increases.
In four groups of mices of step 1 with different diet after 12 weeks, mouse aorta efferent tract speckle frozen section is utilized to carry out immunofluorescence dyeing, use 5-HT2BR antibody (BDPharmingen, 556334) (5-HT2BR antibody is by AlexaFluor555dye labelling) positions 5-HT2BR, use α-SMA antibody (abcam, ab5649) (α-SMA antibody is by AlexaFluor488dye labelling) positions (α-SMA gene is the marker gene of smooth muscle cell) smooth muscle cell, and positions nucleus with DAPI stain.Result (Fig. 4) shows, and 5-HT2BR is positioned speckle smooth muscle cell.
Embodiment 2,5-HT2BR antagonist can suppress the migration of smooth muscle cell and the formation of atheromatous plaque
1,5-HT2BR and antagonist thereof are for the impact of smooth muscle cell migration function
Utilize cell cut and trans-well experiment to detect the impact of 5-HT2BR for smooth muscle cell migration function, experiment in triplicate.
Cell scratch experiment process is as follows: rat aorta smooth muscle cell was cultivated in containing serum-free DMEM after 24 hours, with aseptic sample injector suction nozzle scraping cell surface, form the acellular region of the wide damage of 0.5mm, 5-HT, 5-HT2BR specific agonist BW723C86 or 5-HT2BR specific antagonists LY272015+5-HT process cell is added under serum-free culturing conditions, process 0,3,6,12 and 24 hours, application phase contrast microscope is taken a picture, and measure damage field both sides iuntercellular distance, with the speed healed to represent the change of cell migration ability.Wherein BW723C86 and LY272015 is TocrisBioscience Products, and article No. is respectively 1059 and 30772; 5-HT is Sigma-Aldrich Products, and article No. is H9523; Rat aorta smooth muscle cell is SD rat primary cultured cell.
Result as shown in Figure 5, result shows, 5-HT and 5-HT2BR specific agonist BW723C86 can promote the migration of smooth muscle cell, and the cell migration that 5-HT2BR specific antagonists LY272015 suppresses 5-HT to cause: process 24 hours, in matched group (ctrl), the migration distance of smooth muscle cell was 136.6 ± 7.8 μm; The migration distance of the smooth muscle cell after 5-HT process is 240.2 ± 21.3 μm; The migration distance of the smooth muscle cell after BW723C86 process is 221.4 ± 12.8 μm, is respectively matched group and 5-HT process 1.621 times and 0.922 times; The migration distance of the smooth muscle cell after LY272015 process is 133.7 ± 10.9 μm, be respectively matched group, 0.979 times, 0.557 times and 0.604 times of 5-HT and BW723C86 process.
Trans-well experimentation is as follows: rat aorta smooth muscle cell, through trypsinization, is collected with containing the DMEM of trypsin inhibitor (1mg/ml), to be incubated in the Boyden cell of the plain bag quilt of fiber adhesion (4 × 10
4individual cells/well), after synchronization, the serum-free DMEM containing PDGF-BB (10ng/ml) and different disposal (5-HT, 5-HT2BR specific agonist BW723C86 or 5-HT2BR specific antagonists LY272015+5-HT) is added in lower room, (PDGF-BB is the chemoattractant of smooth muscle cell migration), hatches 24 hours for 37 DEG C.With the little indoor surface cell in cotton swab erasing upper strata, bottom cell 4% paraformaldehyde fixes 20 minutes, and through haematoxylin dyeing, under inverted microscope, (200 ×) get 6 visuals field observations at random, counting cells number.The violet staining of another use 0.1%, observation of cell migration quantity, i.e. migratory activity.
Result as shown in Figure 6, result shows, 5-HT and 5-HT2BR specific agonist BW723C86 can promote the migration of smooth muscle cell, and the cell migration that 5-HT2BR specific antagonists LY272015 suppresses 5-HT to cause: process 24 hours, in matched group (ctrl), the migratory activity of smooth muscle cell was 45.00 ± 7.918; The migratory activity of the smooth muscle cell after 5-HT process is 108.0 ± 17.87; The migratory activity of the smooth muscle cell after BW723C86 process is 96.80 ± 20.63, is respectively matched group and 5-HT process 2.151 times and 0.896 times; The migratory activity of the smooth muscle cell after LY272015 process is 52.60 ± 7.467, be respectively matched group, 1.169 times, 0.487 times and 0.543 times of 5-HT and BW723C86 process.
Show, 5-HT2BR has mediated the smooth muscle cell migration that 5-HT causes, and 5-HT2BR antagonist can suppress the migration of smooth muscle cell.
2,5-HT2BR antagonist can suppress the formation of atheromatous plaque
Get the male ApoE-/-mice in 10 8 week ages, be divided into two groups at random, be respectively experimental group and matched group, often organize 5.Carry out following process to experimental group and matched group, experiment in triplicate.
Control group mice is processed in accordance with the following methods: respectively high fat nursing is carried out to every mice in matched group, feeding food is westerndiet (western diet, ResearchDiet company, D12079B), the first day of feeding at high fat starts mouse peritoneal injection continuous 84 day every day every velhicle (ethanol: propylene glycol: water [volume ratio is 10:50:40]) 50 μ l/10g body weight, by first time injection when Zhou Jiwei process the 1st week.Carrying out high fat nursing and injection velhicle pre-test body weight.
Experimental mice is processed in accordance with the following methods: respectively high fat nursing is carried out to every mice in matched group, feeding food is westerndiet (western diet, ResearchDiet company, D12079B), the first day of feeding at high fat starts mouse peritoneal injection continuous 84 day every day every antagonist solution, and (antagonist solution is made up of 5-HT2BR specific antagonists RS127445 (TocrisBioscience2993) and velhicle, the concentration of RS127445 is 1mg/5ml) 50 μ l/10g body weight, by first time injection when Zhou Jiwei process the 1st week.
1) matched group and experimental mice are respectively after corresponding process, within the 12nd week, get its aorta respectively and carry out oil red O stain (in Fig. 7 A), and measure the gross area (in Fig. 7 B) of atheromatous plaque in process.Result shows, and the plaque area of the experimental mice of injection RS127445 is less than the control group mice of injection velhicle, and the plaque area of the control group mice of injection velhicle is 8.080 ± 0.735mm
2, the plaque area of the experimental mice of injection RS127445 is 2.758 ± 0.456mm
2, be significantly less than the control group mice of injection velhicle.Show, 5-HT2BR antagonist can suppress the formation of atheromatous plaque.
2) matched group and experimental mice are respectively after corresponding process, within 12nd week, get its aortic valve speckle respectively in process carry out frozen section and carry out oil red O stain (in Fig. 7 C), and measure the gross area (in Fig. 7 D) of aortic valve speckle.Result shows, and the aortic valve plaque area of the experimental mice of injection RS127445 is less than the control group mice of injection velhicle, and the aortic valve plaque area of the control group mice of injection velhicle is 0.269 ± 0.034mm
2, the aortic valve plaque area of the experimental mice of injection RS127445 is 0.138 ± 0.022mm
2, be significantly less than the control group mice of injection velhicle.Show, 5-HT2BR antagonist can suppress the formation of aortic valve atheromatous plaque.
3) in matched group and experimental mice after respective handling, measure body weight once (in Fig. 8 A) weekly.In the 0-7 week of velhicle process control group mice, the basic zero difference of experimental mice body weight of control group mice body weight time corresponding to RS127445 process, at the 8th, 9,11 and 12 week of velhicle process control group mice, control group mice body weight is significantly higher than the experimental mice body weight of RS127445 process corresponding time: velhicle process the 8th, 9,11 and 12 weeks, and the body weight of control group mice is respectively 29.7 ± 0.4g, 29.9 ± 0.4g, 29.8 ± 0.5g and 30.2 ± 0.5g; RS127445 process the 8th, 9,11 and 12 weeks, the body weight of experimental mice is respectively 28.0 ± 0.4g, 28.2 ± 0.5g, 27.9 ± 0.5g and 28.1 ± 0.5g.Show, RS127445 can reduce Mouse Weight.
4) in matched group and experimental mice after respective handling, within every three weeks, measure total cholesterol level and total content of triglyceride (in Fig. 8 B and C, table 1) in mice plasma respectively.
Total cholesterol level in the mice plasma of table 1, different disposal and total content of triglyceride (mg/dL)
Result shows, in process 3-12 week, and the total cholesterol level remarkable control group mice lower than the respective handling time respectively in experimental mice blood plasma, process the 12nd week, in experimental mice blood plasma, total cholesterol level was 0.78 times of control group mice; In process 6-12 week, total content of triglyceride remarkable control group mice lower than the respective handling time respectively in experimental mice blood plasma, process the 12nd week, in experimental mice blood plasma, total content of triglyceride was 0.61 times of control group mice.Show, RS127445 can reduce T-CHOL and total content of triglyceride in mice plasma.
5) matched group and experimental mice are respectively after corresponding process, get its aortic valve speckle respectively to carry out frozen section and carry out immunofluorescence dyeing, use the α-SMA antibody in embodiment 1 to dye to smooth muscle cell, and with DAPI stain, nucleus is positioned.
The smooth muscle cell content of experimental mice aortic valve speckle reduces (Fig. 9), in control group mice aortic valve speckle, smooth muscle cell accounts for the percentage ratio of plaque area is 0.2441 ± 0.0224%, in experimental mice aortic valve speckle, smooth muscle cell accounts for the percentage ratio of plaque area is 0.1061 ± 0.0227%, for 0.44 times of control mice, significantly lower than control group mice.Show that RS127445 is in atheromatous plaque forming process, have impact on smooth muscle shift function.
6) matched group and experimental mice are respectively after corresponding process, get the expression that its aorta detects 5-HT2BR respectively.
According to the method in embodiment 1, rna level detects the expression (in Figure 10 A) of the 5-HT2BR in aorta.Result shows, and on rna level, the 5-HT2BR in control group mice aorta expresses and is significantly higher than experimental group.
According to the method in embodiment 1, utilize western-blot on protein level, detect the expression (in Figure 10 B) of 5-HT2BR.Result shows, and on protein level, the 5-HT2BR in control group mice aorta expresses higher than experimental group.
According to the method in embodiment 1, carry out immunohistochemical staining (in Figure 10 C) with 5-HT2BR Antibody on Mouse aorta.Result shows, and on protein level, the 5-HT2BR in control group mice aorta expresses higher than experimental group.
Above result shows, RS127445 can suppress the expression of 5-HT2BR.
Claims (10)
1. reduce the material of 5-HT2BR content in animal body or/and suppress the material of 5-HT2BR activity in animal body to treat and/or prevent atherosclerosis product or by the application in the product of atherosclerosis associated diseases in preparation.
2. application according to claim 1, is characterized in that: in described reduction animal body, the material of 5-HT2BR content is reduce the material that in animal body, 5-HT2BR encoding gene is expressed.
3. application according to claim 1 and 2, is characterized in that: in described reduction animal body, in the material of 5-HT2BR content or described suppression animal body, the material of 5-HT2BR activity is 5-HT2BR antagonist; And/or described product is medicine; And/or described animal body is tremulous pulse.
4. following arbitrary application:
H1) in claim 1-3 in arbitrary described reduction animal body in the material of 5-HT2BR content or described suppression animal body the material of 5-HT2BR activity treating and/or preventing atherosclerosis or by the application in atherosclerosis associated diseases;
H2) in claim 1-3 in arbitrary described reduction animal body in the material of 5-HT2BR content or described suppression animal body the material of 5-HT2BR activity suppress the application in smooth muscle cell migration product in preparation;
H3) in claim 1-3 in arbitrary described reduction animal body in the material of 5-HT2BR content or described suppression animal body the material of 5-HT2BR activity suppressing the application in smooth muscle cell migration;
H4) 5-HT2BR is treating and/or preventing atherosclerosis or by the application in atherosclerosis associated diseases as target proteins;
H5) encoding gene of 5-HT2BR is treating and/or preventing atherosclerosis or by the application in atherosclerosis associated diseases as target gene;
H6) application of 5-HT2BR or 5-HT2BR agonist in preparation Atherosclerosis Model.
5. apply according to claim 4, it is characterized in that: described 5-HT2BR agonist is BW723C86; And/or described animal body is tremulous pulse.
6. apply according to claim 3 or 5, it is characterized in that: described tremulous pulse is aorta, aortic branch, coronary artery, carotid artery, cerebral arteries, renal artery, Mesenteric artery, pulmonary artery or artery of extremity.
7. according to described application arbitrary in claim 1-6, it is characterized in that: described atherosclerosis associated diseases is the disease that the exception of vascular smooth muscle cell exception or T-CHOL or total content of triglyceride causes; The atherosclerosis that the exception that described Atherosclerosis turns to vascular smooth muscle cell exception or T-CHOL or total content of triglyceride causes.
8. apply according to described in claim 7, it is characterized in that: the abnormal migration for described vascular smooth muscle cell of described vascular smooth muscle cell, propagation and/or Phenotypic change; And/or described T-CHOL or total content of triglyceride are T-CHOL or total content of triglyceride in blood plasma.
9. according to described application arbitrary in claim 1-8, it is characterized in that: described atherosclerosis associated diseases is coronary heart disease.
10. following X1) or X2):
X1) treat and/or prevent the medicine of arbitrary described atherosclerosis or described atherosclerosis associated diseases in claim 1-9, its active component is the material of 5-HT2BR activity in the material of 5-HT2BR content in arbitrary described reduction animal body in claim 1-3 or described suppression animal body;
X2) be used for the treatment of and/or prevent the material X of arbitrary described atherosclerosis or described atherosclerosis associated diseases in claim 1-9, described material X to be the material of 5-HT2BR activity in the material of 5-HT2BR content in arbitrary described reduction animal body in claim 1-3 or described suppression animal body.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610049371.8A CN105561313B (en) | 2016-01-25 | 2016-01-25 | It reduces 5-HT2BR content and its active substance is inhibited to treat and prevent the application in atherosclerosis product in preparation |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610049371.8A CN105561313B (en) | 2016-01-25 | 2016-01-25 | It reduces 5-HT2BR content and its active substance is inhibited to treat and prevent the application in atherosclerosis product in preparation |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105561313A true CN105561313A (en) | 2016-05-11 |
| CN105561313B CN105561313B (en) | 2018-12-25 |
Family
ID=55872305
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610049371.8A Active CN105561313B (en) | 2016-01-25 | 2016-01-25 | It reduces 5-HT2BR content and its active substance is inhibited to treat and prevent the application in atherosclerosis product in preparation |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105561313B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2023217249A1 (en) * | 2022-05-11 | 2023-11-16 | 上海交通大学医学院附属仁济医院 | Use of htr2b activator in improvement of cerebral ischemia-reperfusion injury |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102573993A (en) * | 2009-07-31 | 2012-07-11 | Anamar股份公司 | Compounds for treatment of inflammation |
| CN103467596A (en) * | 2012-06-06 | 2013-12-25 | 北京大学 | Novel target spot for treatment of pulmonary arterial hypertension |
-
2016
- 2016-01-25 CN CN201610049371.8A patent/CN105561313B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102573993A (en) * | 2009-07-31 | 2012-07-11 | Anamar股份公司 | Compounds for treatment of inflammation |
| CN103467596A (en) * | 2012-06-06 | 2013-12-25 | 北京大学 | Novel target spot for treatment of pulmonary arterial hypertension |
Non-Patent Citations (3)
| Title |
|---|
| HABIB ABUL MUNTASIR等: "Identification of a Key Amino Acid of the Human 5-HT2B Serotonin Receptor Important for Sarpogrelate Binding", 《J PHARMCOL SCI》 * |
| 余元勋等: "《中国分子心脏病学》", 31 August 2015 * |
| 温绍君等: "5-羟色胺2受体拮抗剂对血管系统的作用研究进展", 《中华内科杂志》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2023217249A1 (en) * | 2022-05-11 | 2023-11-16 | 上海交通大学医学院附属仁济医院 | Use of htr2b activator in improvement of cerebral ischemia-reperfusion injury |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105561313B (en) | 2018-12-25 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Ma et al. | Piperine attenuates pathological cardiac fibrosis via PPAR-γ/AKT pathways | |
| Paul et al. | SLIT3–ROBO4 activation promotes vascular network formation in human engineered tissue and angiogenesis in vivo | |
| Stahl et al. | Identification of the major intestinal fatty acid transport protein | |
| Leeper et al. | Apelin prevents aortic aneurysm formation by inhibiting macrophage inflammation | |
| JP2020524706A (en) | Use of cannabidiol in the treatment of tuberous sclerosis complex | |
| Naska et al. | An Essential Role for the Integrin-Linked Kinase–Glycogen Synthase Kinase-3β Pathway during Dendrite Initiation and Growth | |
| Li et al. | Fusaric acid (FA) protects heart failure induced by isoproterenol (ISP) in mice through fibrosis prevention via TGF-β1/SMADs and PI3K/AKT signaling pathways | |
| Salajegheh | Angiogenesis in health, disease and malignancy | |
| EP2968238A1 (en) | Treatment of a diastolic cardiac dysfunction with a trpv2 receptor agonist | |
| WO2009035251A1 (en) | Novel use of dimethylfumarate | |
| KR102097191B1 (en) | Composition for enforcing the priming effect of stem cell comprising histone deacetylase inhibitor and priming factors | |
| Liu et al. | Lysophosphatidic acid protects mesenchymal stem cells against ischemia-induced apoptosis in vivo | |
| Zhang et al. | PDGF-mediated PI3K/AKT/β-catenin signaling regulates gap junctions in corpus cavernosum smooth muscle cells | |
| Jia et al. | Different roles of BAG3 in cardiac physiological hypertrophy and pathological remodeling | |
| TW202023541A (en) | Application of chiglitazar and its related compounds | |
| CN105561313A (en) | Application of substance capable of lowering content of 5-HT2BR and inhibiting activity of 5-HT2BR in preparation of product for treating and preventing atherosclerosis | |
| Zhou et al. | MnTBAP stimulates angiogenic functions in endothelial cells through mitofusin-1 | |
| CN107257687A (en) | Method for treating heart failure | |
| Romero-Trejo et al. | The systemic administration of neural stem cells expressing an inducible and soluble form of growth arrest specific 1 inhibits mammary gland tumor growth and the formation of metastases | |
| Zhu et al. | The expression of overexpressed PTEN enhanced IR-induced apoptosis of myocardial cells. | |
| CN116036287A (en) | Application of Gefitinib combined with EGCG and/or EGF in preparation of medicines for treating EGFR wild type tumors | |
| CN115066244A (en) | Compounds, compositions and methods for treating ischemia-reperfusion injury and/or lung injury | |
| CN111419832A (en) | Pharmaceutical composition and application thereof in preparing medicines for treating tumors | |
| Meng et al. | LBP1C-2 from Lycium barbarum maintains skeletal muscle satellite cell pool by interaction with FGFR1 | |
| CN115120729B (en) | Application of transmembrane protein41B as drug target in preparation of drug for treating pathological myocardial hypertrophy |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |