CN105548118A - FRET biosensor for detecting function of MMP-3 and construction method and application of FRET biosensor - Google Patents
FRET biosensor for detecting function of MMP-3 and construction method and application of FRET biosensor Download PDFInfo
- Publication number
- CN105548118A CN105548118A CN201610023419.8A CN201610023419A CN105548118A CN 105548118 A CN105548118 A CN 105548118A CN 201610023419 A CN201610023419 A CN 201610023419A CN 105548118 A CN105548118 A CN 105548118A
- Authority
- CN
- China
- Prior art keywords
- mmp
- fret
- biology sensor
- albumen
- function
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N21/00—Investigating or analysing materials by the use of optical means, i.e. using sub-millimetre waves, infrared, visible or ultraviolet light
- G01N21/62—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light
- G01N21/63—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light optically excited
- G01N21/64—Fluorescence; Phosphorescence
- G01N21/6486—Measuring fluorescence of biological material, e.g. DNA, RNA, cells
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N21/00—Investigating or analysing materials by the use of optical means, i.e. using sub-millimetre waves, infrared, visible or ultraviolet light
- G01N21/62—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light
- G01N21/63—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light optically excited
- G01N21/64—Fluorescence; Phosphorescence
- G01N21/6402—Atomic fluorescence; Laser induced fluorescence
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Physics & Mathematics (AREA)
- General Health & Medical Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Chemical & Material Sciences (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- General Physics & Mathematics (AREA)
- Immunology (AREA)
- Pathology (AREA)
- Optics & Photonics (AREA)
- Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
Provided are an FRET biosensor for detecting the function of an MMP-3 and a construction method and application of the FRET biosensor. The FRET biosensor comprises a eukaryotic expression vector of fusion protein constructed by protein of a ligand MMP-3 specific substrate and protein of a fluorescence donor and a fluorescence receptor. The construction method and application of the FRET biosensor are further included. The interaction relationship between molecules or protein in living cartilage cells can be determined, the pathological effect of the MMP-3 can be observed, and the function of medicine in living cells, the application of the treatment technology in a living cell state and the like can be clarified. The FRET biosensor for detecting the function of the MMP-3 has the advantages of being easy and convenient to operate, visual in result and the like.
Description
Technical field
The present invention relates to a kind of unimolecular FRET biology sensor and construction method thereof and application, be specifically related to detect in a kind of living cells the unimolecular FRET biology sensor of MMP-3 function and construction method thereof and application.
Background technology
Osteoarthritis (Osteoarthritis, OA), as a kind of chronic degenerative diseases, is more common in the elderly, and its induced pain, disability rate are high, has a strong impact on the quality of life of the elderly.Epidemiology survey show, the elderly OA morbidity rate of domestic and international more than 60 years old up to 50%, and along with the increase morbidity rate at age be remarkable ascendant trend.Research shows, the generation of OA raises to age, sex, immune response, iop, the factor such as degraded, cell factor of enzyme to cartilage is relevant, also has comparatively Important Relations in addition with gene polynorphisms.Wherein, the proteolytic enzyme of the participation extracellular matrix produced by cartilage cell and basement membrane components degraded becomes the pathogenetic focus of Chinese scholars research OA, but its concrete pathogenesis is still unclear.Up-to-date research shows, matrix metalloproteinase (MMPs) plays an important role in the regression of cartilage, in synovial tissue, macrophage system may be the key link impelling cartilaginous tissue regression in addition, the principal element of its inducing cartilage regression is the MMP-3 of macrophages secrete, in normal steady state tissue, MMP-3 expression is little, and its expression rises under inflammatory cytokine, hormone, factors stimulated growth and in cell conversion process, the function and efficacy therefore studying MMP-3 is extremely important.But the biotechnology grown up in recent years is broken for cost all with cell, cannot interaction under living cells state between Study on Protein and molecule, application FRET (fluorescence resonance energy transfer) technology (FRET) also just in time compensate for this defect in conjunction with technology such as genetic engineerings.
At present, FRET is a kind of new technology of observing the interphase interaction of molecule in living cells etc., as the optics " molecule chi " in 1 ~ 10nm distance range, there is high resolving power, high sensitivity, simply and easily advantage, can timing, quantitatively, location, undamaged detection living cells internal protein interact and proteinase activity etc.; Its ultimate principle is the range information that the efficiency information of FRET (fluorescence resonance energy transfer) by being easy to detect reflects two molecular groups, and distance to be close between 10nm be two domains of two interactions of molecules or a part strong evidence close to each other because of conformational change.Can occur between detection molecules to interact by the enhancing of FRET efficiency or conformational change and close; Weakening of FRET efficiency can be used for proof two molecule away from thus losing interaction, or between two parts proving a molecule because of molecule is cut-off or conformational change and mutually away from.FRET mainly can be divided into FRET and intermolecular FRET in molecule, i.e. unimolecular FRET and bimolecular type FRET: the former refers to mark two probes on a molecule, detects some changes that this molecule self occurs; The latter refers to mark donor and acceptor probe respectively on different two molecules, detects the interaction between these two molecules, and by the impact of several respects, bimolecular type FRET is not as unimolecular FRET.Therefore, utilize FRET principle the destination protein that will study and fluorescin to be linked together construction of fusion protein, make it at cells, under certain condition just can Study on Protein, the interphase interaction of various molecule and the activity of proteinase.But when making unimolecular FRET biology sensor, distinctive energy trasfer coverage makes complicated surface-functionalized of when relating to energy transfer system needs, for the chemical bond between acceptor fluorescent protein and destination protein and preparation process, wherein, joint sequence (Linker) design is one of gordian technique of gene fusion technique success, namely by one section of suitable nucleotide sequence, different genes of interest is coupled together, make it express in suitable biosome to become the peptide chain that single, the amino acid wherein playing connection function is called Linker.Can two kinds of compositions in fusion form correct space structure respectively, better play biologic activity, closely related with the joint sequence being connected two kinds of compositions in fusion.The fusion that restructuring generates requires that the linker inserted in fusion can not affect destination protein function separately, and therefore, design and the selection of Linker sequence are most important to the structure of fusion.Cause developing highly sensitive unimolecular biology sensor by above-mentioned many factors and receive larger restriction.
Summary of the invention
Technical matters to be solved by this invention is, provide a kind of detect MMP-3 function FRET biology sensor and construction method and application.
The technical scheme that the present invention solves the employing of its technical matters is,
A kind of FRET biology sensor detecting MMP-3 function of the present invention, described FRET biology sensor contains the carrier for expression of eukaryon of the fusion that the albumen of part MMP-3 specific substrate and fluorogenic donor and fluorescent receptor albumen build.
Further, described FRET biology sensor is also containing pcDNA3.1 (+) plasmid gene sequence.
Further, the albumen of described part MMP-3 specific substrate is made up of the amino acid sequence shown in SEQIDNO:1.
Further, the base sequence of albumen of described part MMP-3 specific substrate is encoded as shown in SEQIDNO:2.
Further, described fluorogenic donor is ECFP; Fluorescent receptor is EYFP.
A kind of construction method detecting the FRET biology sensor of MMP-3 function of the present invention, comprises the following steps:
(1) gene clone of fluorogenic donor albumen and fluorescent receptor albumen, qualification: design two couples of primer P1 and P2 for the correspondingly gene order of, receptor protein plasmid according to fluorescence, P3 and P4, and add HindIII restriction enzyme site at the 5 ' end of P1,5 ' the end of P2 adds BamHI restriction enzyme site, and the 5 ' end of P3 adds base sequence, the Linker base sequence (GGSGGT-GGCGGCAGCGGCGGCACC) of the albumen of BamHI restriction enzyme site and described part MMP-3 specific substrate; Add EcoRI restriction enzyme site at the 5 ' end of P4, clone supplies containing fluorescence, the full length gene sequence of acceptor;
(2) structure of FRET biology sensor: the PCR primer of pcDNA3.1 (+) and fluorogenic donor is carried out the process of HindIII and BamHI double digestion respectively, and the PCR primer of fluorogenic donor is inserted in pcDNA3.1 (+), recon pcDNA3.1 (+)-ECFP in the middle of obtaining; Then the PCR primer of recon pcDNA3.1 (+)-ECFP and fluorescent receptor in the middle of BamHI and EcoRI double digestion is used, and recon pcDNA3.1 (+)-ECFP in the middle of the pcr amplification product of fluorescent receptor is inserted, obtain recombinant plasmid vector MMP-3 biology sensor, and cut by PCR, enzyme, the accuracy of sequence verification clone object fragment.
Further, in step (1), described fluorescence confession, receptor protein grain-by-grain seed selection are from pECFP-C1, pEYFP-C1; Correspondingly clone primer pair P1 and P2 of ECFP, as SEQIDNO:3 with as shown in SEQIDNO:4; Correspondingly clone primer pair P3 and P4 of EYFP, as such as SEQIDNO:5 with as shown in SEQIDNO:6.
The FRET biology sensor of a kind of MMP-3 of detection function of the present invention detects the application of MMP-3 function in living cells.
Albumen containing specificity MMP-3 substrate is loaded on to merge by the FRET biology sensor of the detection MMP-3 function of the present invention to be had on the carrier of two kinds of fluorescence, due to two kinds of fluorescin space close together, therefore apply microscope and can capture specific wavelength of fluorescence.But when biology sensor of the present invention and active MMP-3 albumen generation molecular action, active MMP-3 is combined with specific substrate, cause two kinds of fluorescin generation space displacements, the wavelength of fluorescence of now catching under microscope changes, the interaction relationship of living between cartilage cell's Middle molecule or albumen and the pathological effect observing MMP-3 can be determined thus, and the application etc. for the treatment of technology under the effect of medicine under living cells, living cells state can be specified.
Transfection cartilage cell of the present invention, living cells workstation is dynamically observed ECFP-YFP two kinds of fluorescence transfer changes, also after the effect of observable different stimulated thing, the dynamic change of the fluorescent quenching process of MMP-3 biology sensor in cartilage cell, the time of MMP-3 molecule, spatial variations effect, thus be checked through the concrete effect of MMP-3 in cartilage degeneration intuitively.As can be seen here, the FRET biology sensor of the detection MMP-3 function of the present invention has the features such as easy and simple to handle, visual result.
Accompanying drawing explanation
Fig. 1 is for building MMP-3 biology sensor carrier major part structural representation.Wherein CMVpromoter:CMV promoter; ECFP: Enhanced expressing cyan fluorescent protein; Linker:EYFP: yellow fluorescence protein.
Fig. 2 is MMP-3 biology sensor fundamental diagram.
Fig. 3 is MMP-3 biology sensor (pcDNA3.1 (+)-ECFP-MMP3substrate-linker-EYFP) recon double digestion qualification result.Wherein, 1:MMP-3 biology sensor recon BamHI and EcoRI double digestion; M:DNAmakerIII.
Fig. 4 is the FRET phenomenon of MMP-3 in synovial cell.(A) fluoroscopic image of CFP passage; (B) fluoroscopic image of YFP passage; (C) fluoroscopic image of FRET passage.
Fig. 5 is the FRET phenomenon of synovial cell under IL-1 stimulates with Computer Analysis transfection MMP-3 biology sensor.
Fig. 6 is the building process figure of unimolecular FRET biology sensor.
Embodiment
Below in conjunction with embodiment, the present invention is illustrated further.
Embodiment 1: the structure of unimolecular FRET biology sensor:
1, the structure of MMP-3 specific substrate: coded polypeptide gene reference document obtains; Expression vector PECFP-c1, PEYFP-c1, pcDNA3.1 (+) all buy gained; This laboratory of host DH5 α is preserved; Cacl
2heat shock method is by channel genes host; Antibody screening method collects transformant.
MMP-3 substrate is 11 amino acid polypeptides of autonomous Design synthesis.The albumen of MMP-3 specific substrate is by GVPLSLTMGLG, and the amino acid sequence as shown in SEQIDNO:1 forms; The base sequence GGCGTACCCCTATCCCTAACCATGGGCCTAGGC of MMP-3 specific substrate, as shown in SEDIDNO:2.
2, fluorescence supplies, acceptor gene is cloned, qualification: correspondingly ECFP, EYFP gene order according to existing plasmid pECFP-C1, pEYFP-C1 designs two couples of primer P1 and P2, P3 and P4; The upstream and downstream primer P1:CCC of described clone ECFP
aAGCTTaTGGTGAGCAAGGGCGAGG, as shown in SEQIDNO:3, P2:CG
gGATCC(single lower stroke straight line represents HindIII restriction enzyme site, BamHI restriction enzyme site to CTTGTACAGCTCGTCCATGC respectively; The upstream and downstream primer of described clone EYFP), as shown in SEQIDNO:4; P3:
CG
gGATCC gTGAGCAAGGGCGAGGAG, as shown in SEQIDNO:5; P4:
G
gAATTC(single lower stroke straight line represents BamHI restriction enzyme site, EcoRI restriction enzyme site to TTAAGCTCGAGATCTGAGTCC respectively, single lower tracing represents the base sequence of the albumen of described part MMP-3 specific substrate, a two lower stroke straight line represents Linker base sequence), as shown in SEQIDNO:6.And adding HindIII restriction enzyme site at the 5 ' end of P1, the 5 ' end of P2 adds base sequence, Linker base sequence that 5 ' of BamHI, P3 holds the albumen adding BamHI and described part MMP-3 specific substrate; Add EcoRI restriction enzyme site at the 5 ' end of P4, clone supplies containing fluorescence, the full length gene sequence of acceptor;
3, the structure of FRET biology sensor: the PCR primer of pcDNA3.1 (+) and ECFP is carried out the process of HindIII and BamHI double digestion respectively, and the PCR primer of ECFP is inserted in pcDNA3.1 (+), recon pcDNA3.1 (+)-ECFP in the middle of obtaining; Then the PCR primer of recon pcDNA3.1 (+)-ECFP and EYFP in the middle of BamHI and EcoRI double digestion is used, and recon pcDNA3.1 (+)-ECFP in the middle of the pcr amplification product of EYFP is inserted, obtain recombinant plasmid vector MMP-3 biology sensor, as shown in Figure 6, and cut by PCR, enzyme, the accuracy of sequence verification clone object fragment.
Embodiment 2: the fluorescence analysis of unimolecular FRET biology sensor
Cultivate SD rat cartilage cell, transfection MMP-3 biology sensor, when CFP is in 420nm excitation, MMP-3 substrate two ends are merged with CFP and YFP respectively, make MMP-3 substrate do not have cleaved before just can there is FRET, what now detect be exactly the emission wavelength of YFP is the fluorescence of 515nm, can observe the fluoroscopic image of ECFP, YFP and FRET passage simultaneously, see Fig. 2 and Fig. 4; Application inflammatory factor IL-1 stimulates cartilage cell after 24 hours as induction agent, cartilage cell secretes a large amount of MMP-3, these MMP-3 activated act on MMP-3 substrate, make after MMP-3 substrate cleavage becomes two fragments, the Lock-out of FRET effect, what thus detect be the emission wavelength of CFP is the fluorescence of 485nm, sees Fig. 2.Observable cartilage cell change in fluorescence process, is shown in Fig. 5 thus.As shown in Figure 5, the MMP-3 activated from 16min acts on MMP-3 substrate, and FRET effect starts to weaken, until FRET effect thoroughly disappears during 24min, MMP-3 substrate two ends recover again to merge with CFP and YFP gradually afterwards, thus the live effect of clear and definite cartilage cell's secreting, expressing MMP-3.Relative to traditional protein detection technology, the method is more directly perceived, sensitive.
Claims (8)
1. detect a FRET biology sensor for MMP-3 function, it is characterized in that, described FRET biology sensor contains the carrier for expression of eukaryon of the fusion that the albumen of part MMP-3 specific substrate and fluorogenic donor and fluorescent receptor albumen build.
2. the FRET biology sensor of detection MMP-3 function according to claim 1, it is characterized in that, described FRET biology sensor is also containing pcDNA3.1 (+) positive plasmid gene order.
3. the FRET biology sensor of detection MMP-3 function according to claim 1 and 2, is characterized in that, the composition of the amino acid sequence shown in Protein S EQIDNO:1 of described part MMP-3 specific substrate.
4. the FRET biology sensor of detection MMP-3 function according to claim 1 and 2, it is characterized in that, the base sequence of the albumen of described part MMP-3 specific substrate of encoding is as shown in SEQIDNO:2.
5. according to the FRET biology sensor of the detection MMP-3 function one of Claims 1 to 4 Suo Shu, it is characterized in that, described fluorogenic donor albumen is ECFP; Fluorescent receptor albumen is EYFP.
6. a construction method for the FRET biology sensor of the detection MMP-3 function as described in one of Claims 1 to 5, is characterized in that, comprise the following steps:
(1) gene clone of fluorogenic donor albumen and fluorescent receptor albumen, qualification: design two couples of primer P1 and P2 for the correspondingly gene order of, receptor protein plasmid according to fluorescence, P3 and P4, and add HindIII restriction enzyme site at the 5 ' end of P1,5 ' the end of P2 adds BamHI restriction enzyme site, and the 5 ' end of P3 adds base sequence, the Linker base sequence of the albumen of BamHI restriction enzyme site and described part MMP-3 specific substrate; At 5 ' the end interpolation EcoRI restriction enzyme site of P4, with pcDNA3.1 (+) plasmid for template, the fluorescence of clone containing upstream and downstream fragment supplies, the full length gene sequence of acceptor;
(2) structure of FRET biology sensor: the PCR primer of pcDNA3.1 (+) and fluorogenic donor is carried out the process of HindIII and BamHI double digestion respectively, the PCR primer of enzyme being cut the fluorogenic donor after process is inserted in pcDNA3.1 (+) carrier of same HindIII and BamHI double digestion process, recon pcDNA3.1 (+)-ECFP in the middle of obtaining; Then the PCR primer of recon pcDNA3.1 (+)-ECFP and fluorescent receptor in the middle of BamHI and EcoRI double digestion is used, and recon pcDNA3.1 (+)-ECFP in the middle of the pcr amplification product of fluorescent receptor is inserted, obtain recombinant plasmid vector MMP-3 biology sensor, and cut by PCR, enzyme, the accuracy of sequence verification clone object fragment.
7. the construction method of the FRET biology sensor of detection MMP-3 function according to claim 6, is characterized in that, in step (1), described fluorescence confession, receptor protein grain-by-grain seed selection are from pECFP-C1, pEYFP-C1; Correspondingly clone primer pair P1 and P2 of ECFP, as SEQIDNO:3 with as shown in SEQIDNO:4; Correspondingly clone primer pair P3 and P4 of EYFP, as SEQIDNO:5 with as shown in SEQIDNO:6.
8. in living cells, the application of MMP-3 function is detected according to the FRET biology sensor of the detection MMP-3 function one of Claims 1 to 5 Suo Shu.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610023419.8A CN105548118A (en) | 2016-01-14 | 2016-01-14 | FRET biosensor for detecting function of MMP-3 and construction method and application of FRET biosensor |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610023419.8A CN105548118A (en) | 2016-01-14 | 2016-01-14 | FRET biosensor for detecting function of MMP-3 and construction method and application of FRET biosensor |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN105548118A true CN105548118A (en) | 2016-05-04 |
Family
ID=55827457
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610023419.8A Pending CN105548118A (en) | 2016-01-14 | 2016-01-14 | FRET biosensor for detecting function of MMP-3 and construction method and application of FRET biosensor |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105548118A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110514628A (en) * | 2018-05-21 | 2019-11-29 | 中国海洋大学 | A kind of biological inductor/the method and application of quick detection O-GlcNAc modification |
| CN112725373A (en) * | 2020-12-04 | 2021-04-30 | 天津大学 | Construction method for amplifying cadmium ion whole-cell biosensor circuit |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102449485A (en) * | 2009-04-27 | 2012-05-09 | 韩国生命工学研究院 | Method for detecting a ligand using fret biosensor |
| CN104592396A (en) * | 2015-02-26 | 2015-05-06 | 南京大学 | Caspase-8 activity assay fluorescent probe based on fluorescence resonance energy transfer technology |
| CN104762385A (en) * | 2015-04-02 | 2015-07-08 | 王维山 | FRET biosensor for detecting uPA function as well as construction method and application of FRET biosensor for detecting uPA function |
| CN104788569A (en) * | 2015-02-10 | 2015-07-22 | 深圳市第二人民医院 | Extracellular matrix MMP13 (metalloproteinase-13) detection BRET (bioluminescence resonance energy transfer) probe, gene, expression vector and construction method |
| CN104861073A (en) * | 2015-02-10 | 2015-08-26 | 深圳市第二人民医院 | FRET fusion fluorescence probe for detecting activity of MMP-13, and detection method, DNA and expression vector thereof |
-
2016
- 2016-01-14 CN CN201610023419.8A patent/CN105548118A/en active Pending
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102449485A (en) * | 2009-04-27 | 2012-05-09 | 韩国生命工学研究院 | Method for detecting a ligand using fret biosensor |
| CN104788569A (en) * | 2015-02-10 | 2015-07-22 | 深圳市第二人民医院 | Extracellular matrix MMP13 (metalloproteinase-13) detection BRET (bioluminescence resonance energy transfer) probe, gene, expression vector and construction method |
| CN104861073A (en) * | 2015-02-10 | 2015-08-26 | 深圳市第二人民医院 | FRET fusion fluorescence probe for detecting activity of MMP-13, and detection method, DNA and expression vector thereof |
| CN104592396A (en) * | 2015-02-26 | 2015-05-06 | 南京大学 | Caspase-8 activity assay fluorescent probe based on fluorescence resonance energy transfer technology |
| CN104762385A (en) * | 2015-04-02 | 2015-07-08 | 王维山 | FRET biosensor for detecting uPA function as well as construction method and application of FRET biosensor for detecting uPA function |
Non-Patent Citations (3)
| Title |
|---|
| GAE BAIK KIM等: "Analysis of Protease Activity Using Quantum Dots and Resonance Energy Transfer", 《THERANOSTICS》 * |
| JONG-KAI HSIAO等: "In-vivo imaging of tumor associated urokinase-type plasminogen activator activity", 《JOURNAL OF BIOMEDICAL OPTICS》 * |
| SHI-YING LI等: "A dual-FRET-based fluorescence probe for the sequential detection of MMP-2 and caspase-3", 《CHEM. COMMUN.》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110514628A (en) * | 2018-05-21 | 2019-11-29 | 中国海洋大学 | A kind of biological inductor/the method and application of quick detection O-GlcNAc modification |
| CN112725373A (en) * | 2020-12-04 | 2021-04-30 | 天津大学 | Construction method for amplifying cadmium ion whole-cell biosensor circuit |
| CN112725373B (en) * | 2020-12-04 | 2023-02-07 | 天津大学 | Construction method for amplifying cadmium ion whole-cell biosensor circuit |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US11198864B2 (en) | Protease-resistant systems for polypeptide display and methods of making and using thereof | |
| Sato et al. | Fluorescent indicators for cyclic GMP based on cyclic GMP-dependent protein kinase Iα and green fluorescent proteins | |
| US11661442B2 (en) | Vesicles for characterization of botulinum neurotoxins | |
| JP5815852B2 (en) | Non-FRET Botulinum Assay | |
| US20140088292A1 (en) | Water-Soluble Polypeptides Comprised of Repeat Modules, Method for Preparing the Same and Method for a Target-Specific Polypeptide and Analysis of Biological Activity Thereof | |
| CN104762385A (en) | FRET biosensor for detecting uPA function as well as construction method and application of FRET biosensor for detecting uPA function | |
| EP3067696B1 (en) | Genetically modified cells for resonance energy transfer assay with synaptobrevin substrate moiety | |
| Schroder et al. | The C-terminal tail of CRTH2 is a key molecular determinant that constrains Gαi and downstream signaling cascade activation | |
| US8173863B2 (en) | Sucrose biosensors and methods of using the same | |
| Vu et al. | P120 catenin potentiates constitutive E-cadherin dimerization at the plasma membrane and regulates trans binding | |
| CN105548118A (en) | FRET biosensor for detecting function of MMP-3 and construction method and application of FRET biosensor | |
| KR20070013024A (en) | Maltose biosensor for quantitative measurement of maltose in the cell | |
| CN105572088A (en) | FRET biosensor for detecting function of MMP-9 and construction method and application of FRET biosensor | |
| US20220155286A1 (en) | High throughput drug screening methods | |
| JP2004187544A (en) | Fluorescent indicator using fret | |
| Wang et al. | Identification of amino acids at two dimer interface regions of the α-factor receptor (Ste2) | |
| TWI647237B (en) | Enzyme assay with repetitive fluorophore | |
| KR20230164228A (en) | Methods and compounds for increasing sensitivity of botulinum assays | |
| Hawkes et al. | Heterotrimeric G proteins and the single-transmembrane domain IGF-II/M6P receptor: functional interaction and relevance to cell signaling | |
| US9409968B2 (en) | Toll-like receptor-based biosensors | |
| Lyu et al. | Methodologies for measuring protein trafficking across cellular membranes | |
| Marino et al. | Topogenesis of heterologously expressed fragments of the human Y4 GPCR | |
| US20160116457A1 (en) | Transmembrane proteins as biosensors | |
| Ham et al. | The SpACE-CCM: A facile and versatile cell culture medium-based biosensor for detection of SARS-CoV-2 spike-ACE2 interaction | |
| Northrop | Investigation of the Oligomeric State of Membrane-bound SecA Using Förster Resonance Energy Transfer |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20160504 |