CN105543375A - Detection method and detection kit for patulin - Google Patents

Detection method and detection kit for patulin Download PDF

Info

Publication number
CN105543375A
CN105543375A CN201610043724.3A CN201610043724A CN105543375A CN 105543375 A CN105543375 A CN 105543375A CN 201610043724 A CN201610043724 A CN 201610043724A CN 105543375 A CN105543375 A CN 105543375A
Authority
CN
China
Prior art keywords
claviformin
dna
aptamer
aspergillin
stranded
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201610043724.3A
Other languages
Chinese (zh)
Inventor
曾云龙
符方芬
邓克勤
杨凡
黄昊文
唐春然
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Hunan University of Science and Technology
Original Assignee
Hunan University of Science and Technology
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Hunan University of Science and Technology filed Critical Hunan University of Science and Technology
Priority to CN201610043724.3A priority Critical patent/CN105543375A/en
Publication of CN105543375A publication Critical patent/CN105543375A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/686—Polymerase chain reaction [PCR]

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biophysics (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Analytical Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention relates to a detection method and detection kit for patulin. The method comprises the following steps that (A) a patulin aptamer (Apt) singlestrand signal DNA (ssDNA) probe is subjected to hybridization, and a hybridization chain is formed; (B) the hybridization chain is in reaction with a to-be-tested sample, and when patulin exists in the to-be-tested sample, the ssDNA probe is released by the reaction of the hybridization chain and the patulin; (C) the hybridization chain is changed into double chain DNA by the aid of DNA amplification, the double chain DNA hydrolyzed into mononucleotide under the selective catalysis of excision enzyme, and the ssDNA probe in the system is not hydrolyzed but reserved; (D) under ssDNA induction, silver ions are reduced to generate near infrared fluorescent silver nano clusters; the system fluorescence intensity is detected, so that the content of the patulin in the to-be-tested sample is measured. The method has the advantages that the sensitivity is high, the operation is simple, the cost is low and the like.

Description

The detection method of claviformin and detection kit
Technical field
The present invention relates to nano-biosensing and field of biological detection, specifically, be to provide a kind of detection method and detection kit of claviformin.
Background technology
Claviformin is a kind of poisonous fungus metabolite produced by mould.Can produce the mould of claviformin, mainly comprise the moulds such as Penicillium, Aspergillus, silk clothes are mould, these moulds, can infect various fruits, vegetables, grain, feed and Chinese medicinal materials widely, cause these crops and goods thereof to pollute by claviformin.As the apple by these fungal infections, apart from the pulp of its mildew and rot spot 3 centimeters, still claviformin can be detected.Claviformin is to thermally-stabilised, and 100 DEG C of heating still can not destroy its structure in 15 minutes, and can preserve for a long time in acidic solution and organic solvent.Claviformin Zeng Yinwei its suppress multiple bacteria growing and be used as microbiotic, it has acute toxicities such as causing tic, intestinal bleeding, pulmonary hemorrhage, kidney damage, and claviformin all has stronger toxicity to neural system, respiratory system, urinary system, immunity system and reproductive system etc.There is genotoxicity, teratogenesis, the chronic toxicity such as carcinogenic simultaneously.The method of current test bar aspergillin has: chromatography, hyphenated techniques chromatography, euzymelinked immunosorbent assay (ELISA) etc.These method detection limits are low, precision is high, but complicated operation, testing cost are high.Set up a kind of claviformin detection method that is quick, simple, low cost significant.
Chinese patent CN104593374A discloses a kind of oligonucleotide aptamers of specific recognition claviformin, and it can be used for the detection of claviformin, but has no the further application of the detection for claviformin.
Summary of the invention
The object of the invention is for problems of the prior art, a kind of method of test bar aspergillin is provided.
The technical solution used in the present invention: a kind of method of test bar aspergillin, comprises the steps:
(A) claviformin aptamer (Apt) and single-stranded signal probe ssDNA(Sp is made) hybridize, form hybridization chain;
(B) make this hybridization chain and testing sample effect, when there being claviformin to exist in testing sample, hybridization chain optionally reacts with claviformin and discharges single-stranded signal probe ssDNA;
(C) eliminate the interference of hybridization chain, utilize DNA cloning, make hybridization chain become double-stranded DNA, then use excision enzyme, optionally catalysis double-stranded DNA is hydrolyzed into mononucleotide, and in system, single-stranded signal probe ssDNA is not hydrolyzed and remains; (D) utilize claviformin aptamer-claviformin combination that silver ion reduction can not be induced to become near-infrared fluorescent silver nanoclusters, single-stranded signal probe ssDNA (Sp) energy inductive formation is only had to have the near infrared silver nanoclusters of hyperfluorescenceZeng Yongminggaoyingguang, fluorescence intensity in detection system, thus the content measuring the mycotoxins claviformin in testing sample.
Described claviformin aptamer is
5’-CAGCTCAGAAGCTTGATCCCGGCCCGCCAACCCGCATCATCTACACTGATATTTTACCTT GACTATCAGTCGTGC-3’。
The described single-stranded signal DNA probe can hybridized with claviformin aptamer is 5 '-CCCCCCACACCCGATCCCCCC gCACGACTGATAGTC-3 '.
Cleaning Principle of the present invention is as follows: first allow Apt and Sp hybridize (underscore part); When there being claviformin to exist, hybridization chain and claviformin react and discharge Sp; Apt-Sp (remaining) is there is, Apt-claviformin and Sp in system.Apt-claviformin can not induce silver ion reduction to generate the silver nanoclusters of near-infrared fluorescent, noiseless to mensuration; Hybridization chain may have interference; In order to eliminate the interference of hybridization chain: a. utilizes DNA cloning, and make hybridization chain become double-stranded DNA, b. exonuclease, optionally catalysis double-stranded DNA is hydrolyzed into mononucleotide, and in system, single-stranded signal probe ssDNA is not hydrolyzed and remains; Now only staying in system can the Sp of silver nanoclusters of inductive formation near-infrared fluorescent, take wavelength as the light of 585nm be exciting light, the fluorescence intensity of mensuration system fluorescent emission (610-800nm) spectrum, the relation of the amount of foundation fluorescence intensity and claviformin, thus the content of mycotoxins claviformin can be measured.Due to the interference of background fluorescence in elimination system, sensitivity and the precision of detection can be improved.
Present invention also offers a kind of test kit of test bar aspergillin, it at least comprises: claviformin aptamer, single-stranded signal probe ssDNA, DNA cloning system, exonuclease, the silver ion reduction detection system that can hybridize with claviformin aptamer.
Described claviformin aptamer is 5 '-CAGCTCAGAAGCTTGATCCCGGCCCGCCAACCCGCATCATCTACACTGATATTTTA CCTTGACTATCAGTCGTGC-3 '.
Described single-stranded signal probe ssDNA is 5 '-CCCCCCACACCCGATCCCCCCGCACGACTGATAGTC-3 '.
Described DNA cloning system comprises buffered soln, and buffered soln is by Tris-HCl, MgCl 2(NH 4) 2sO 4composition, triphosphoric acid deoxymononucleotide mixing solutions dNTP and Phi29DNA polysaccharase.
Described exonuclease is ExoIII exonuclease.
Reductive agent in described silver ion reduction detection system is xitix.
Present invention also offers a kind of claviformin aptamer that can be used for test bar aspergillin, its base sequence is 5 '-CAGCTCAGAAGCTTGATCCCGGCCCGCCAACCCGCATCATCTACACT
GATATTTTACCTTGACTATCAGTCGTGC-3’。
Advantage of the present invention:
Adopt detection method of the present invention and test kit, can interference be eliminated, 0.008 – 0.30ng/mL, detectability 3pg/mL.
Accompanying drawing explanation
Fig. 1 is the concentration relationship figure of Sp-Ag nanocluster fluorescence and claviformin.
Embodiment
Embodiment 1
A kind of test kit of test bar aspergillin at least comprises: claviformin aptamer, the single-stranded signal DNA probe can hybridized with claviformin aptamer, DNA cloning system, exonuclease, silver ion reduction detection system.Claviformin aptamer is 5 '-CAGCTCAGAAGCTTGATCCCGGCCCGCCAACCCGCATCATCTACACTGATATTTTA CCTTGACTATCAGTCGTGC-3 '.Single-stranded signal DNA probe is 5 '-CCCCCCACACCCGATCCCCCCGCACGACTGATAGTC-3 '.DNA cloning system comprises buffered soln, and (buffered soln is by Tris-HCl, MgCl 2(NH 4) 2sO 4composition), triphosphoric acid deoxymononucleotide mixing solutions dNTP and Phi29DNA polysaccharase.。Exonuclease is ExoIII exonuclease.Reductive agent in described silver ion reduction detection system is xitix.
Embodiment 2
A method for test bar aspergillin, specific operation process is as follows:
By each DNA storing solution at 95 DEG C through heat treated 5 minutes, before using, and at room temperature place 30 minutes.Then, get hybridization buffer 40 μ L and the 3.0 μm of ol signal probe ssDNA(Sp containing 3.0 μm of ol claviformin aptamers (Apt) respectively) hybridization buffer 40 μ L be placed in 2ml centrifuge tube, hybridize 1 hour at 37 DEG C, generate claviformin aptamer-signal probe hybrid (Apt-Sp).
At 37 DEG C, be that the claviformin of 0 ~ 50ng/mL adds in Apt-Sp solution respectively successively by concentration, in claviformin and Apt-Sp, Apt section is reacted, and generates aptamer-claviformin, discharges Sp.At this moment, the materials such as Sp, residue (unreacted) Apt-Sp and aptamer-claviformin are had in system.
(buffered soln consists of 50mMTris-HCl, 10mMMgCl to add 10 μ L buffered soln 2, 10mM (NH 4) 2sO 4, pH7.5), then add dNTP (10mM) 18 μ L.In system, add 2 μ LPhi29DNA polysaccharases (10u/ μ l) again, reacting 15 minutes at 37 DEG C, making to increase into double-stranded DNA with claviformin aptamer-signal probe hybridization sequences (Ap-Sp) for touching plate.Keep Phi29DNA being deactivated in 10 minutes at 65 DEG C.
In this reaction system, add 2 μ LExoIII exonucleases (20u/ μ L) again, react 30 minutes at 37 DEG C, ExoIII optionally catalysis double-stranded DNA is hydrolyzed into mononucleotide, and single-stranded signal probe Sp is not hydrolyzed and remains.
25 μ L1mmol Silver Nitrates and 180 μ L sodium citrate buffer solution (10mM, pH7.8) are added in reaction solution.Then, mixture is at room temperature placed after 10 minutes in lucifuge or darkroom, under fast stirring, adds the freshly prepd ascorbic acid solution that 100 μ L concentration are 1mM.Then at 45 DEG C, 5min is reacted.Solution is transferred to microcolorimetric ware, take wavelength as the light of 585nm be exciting light, measure the fluorescence intensity of system fluorescent emission (610-800nm) spectrum, according to the relation of the amount of fluorescence intensity and claviformin, carry out the quantitative assay of claviformin, result as shown in Figure 1.
Linearity range 0.005 – 0.30ng/mL, linear equation is y=32.28+775.8C, and relation conefficient is r=0.9969, and detectability 3pg/mL, the rate of recovery is 96.5 ~ 106.2%.The detections of biological micromolecule to claviformin such as other mycotoxins are noiseless.
<110> University Of Science and Technology Of Hunan
The detection method of <120> claviformin and detection kit
<160>2
<210>1
<211>75
<212>DNA
<213> claviformin aptamer
<400>1
5’-CAGCTCAGAAGCTTGATCCCGGCCCGCCAACCCGCATCATCTACACTGATATTTTACCTTGACTATCAGTCGTGC-3’
<210>2
<211>36
<212>DNA
<213> single-stranded signal probe
<400>2
5’-CCCCCCACACCCGATCCCCCCGCACGACTGATAGTC-3’

Claims (9)

1. a detection method for claviformin, is characterized in that, the method comprises the steps:
(A) claviformin aptamer Apt and single-stranded signal probe ssDNA is hybridized, and forms hybridization chain;
(B) make this hybridization chain and testing sample effect, when there being claviformin to exist in testing sample, in hybridization chain, Apt section is optionally reacted with claviformin and is generated Apt-claviformin, discharges single-stranded signal probe ssDNA simultaneously;
(C) eliminate hybridization chain interference, utilize DNA cloning, make hybridization chain become double-stranded DNA, then with excision enzyme optionally catalysis double-stranded DNA be hydrolyzed into mononucleotide, in system, single-stranded signal probe ssDNA is not hydrolyzed and remains;
(D) utilize claviformin aptamer-claviformin combination that silver ion reduction can not be induced to become near-infrared fluorescent silver nanoclusters, only have single-stranded signal probe ssDNA that silver ion reduction can be induced to generate the principle of the near infrared silver nanoclusters of hyperfluorescenceZeng Yongminggaoyingguang, detection system fluorescence intensity, thus the content measuring the mycotoxins claviformin in testing sample.
2. the detection method of claviformin according to claim 1, is characterized in that, described claviformin aptamer is 5 '-CAGCTCAGAAGCTTGATCCCGGCCCGCCAACCCGCATCATCTACACTGATATTTTA CCTTGACTATCAGTCGTGC-3 '.
3. the detection method of claviformin according to claim 1 and 2, is characterized in that, described single-stranded signal probe ssDNA is 5 '-CCCCCCACACCCGATCCCCCCGCACGACTGATAGTC-3 '.
4. a test kit for test bar aspergillin, is characterized in that, it at least comprises: claviformin aptamer, single-stranded signal DNA probe, DNA cloning system, excision enzyme, silver ion reduction detection system.
5. the test kit of test bar aspergillin according to claim 4, is characterized in that, described claviformin aptamer is 5 '-CAGCTCAGAAGCTTGATCCCGGCCCGCCAACCCGCATCATCTACACTGATATTTTA CCTTGACTATCAGTCGTGC-3 '.
6. the test kit of test bar aspergillin according to claim 4, is characterized in that, described single-stranded signal DNA probe is 5 '-CCCCCCACACCCGATCCCCCCGCACGACTGATAGTC-3 '.
7. the test kit of test bar aspergillin according to claim 4, is characterized in that, described DNA cloning system comprises buffered soln, and buffered soln is by Tris-HCl, MgCl 2(NH 4) 2sO 4composition, triphosphoric acid deoxymononucleotide mixing solutions dNTP and Phi29DNA polysaccharase.
8. the test kit of test bar aspergillin according to claim 4, is characterized in that, described exonuclease is ExoIII exonuclease.
9. the test kit of test bar aspergillin according to claim 4, is characterized in that, the reductive agent in described silver ion reduction detection system is xitix.
CN201610043724.3A 2016-01-24 2016-01-24 Detection method and detection kit for patulin Pending CN105543375A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201610043724.3A CN105543375A (en) 2016-01-24 2016-01-24 Detection method and detection kit for patulin

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201610043724.3A CN105543375A (en) 2016-01-24 2016-01-24 Detection method and detection kit for patulin

Publications (1)

Publication Number Publication Date
CN105543375A true CN105543375A (en) 2016-05-04

Family

ID=55822932

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201610043724.3A Pending CN105543375A (en) 2016-01-24 2016-01-24 Detection method and detection kit for patulin

Country Status (1)

Country Link
CN (1) CN105543375A (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107543810A (en) * 2017-08-11 2018-01-05 樊之雄 A kind of detection method for the hypersensitive fluorescent optical sensor for determining kanamycins
CN111398393A (en) * 2020-05-20 2020-07-10 河南工业大学 Preparation method of electrochemical aptamer rate sensor for patulin detection
CN114088675A (en) * 2021-11-17 2022-02-25 浙江科技学院 Immunoliposome wrapping fluorescent dye and application

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102830113A (en) * 2012-06-14 2012-12-19 青岛科技大学 Signal amplification technology establishment based on target induced chain release and restriction enzyme digestion circulation and detection of ochracin A
CN104593374A (en) * 2015-03-02 2015-05-06 江南大学 Oligonucleotide aptamer for specifically identifying patulin

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102830113A (en) * 2012-06-14 2012-12-19 青岛科技大学 Signal amplification technology establishment based on target induced chain release and restriction enzyme digestion circulation and detection of ochracin A
CN104593374A (en) * 2015-03-02 2015-05-06 江南大学 Oligonucleotide aptamer for specifically identifying patulin

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
ANPING CAO等: ""Real-time detection of transcription factors using target-converted helicase-dependent amplification assay with zero-background signal"", 《ANALYTICAL CHEMISTRY》 *
JINGHUA CHEN等: ""A fluorescent aptasensor based on DNA-scaffolded silver-nanocluster for ochratoxin A detection"", 《BIOSENSORS AND BIOELECTRONICS》 *
萧其杰 张淑华: "《药物化学》", 30 June 1964, 人民卫生出版社 *
陈宏主编: "《基因工程 第2版》", 31 August 2011, 中国农业出版社 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107543810A (en) * 2017-08-11 2018-01-05 樊之雄 A kind of detection method for the hypersensitive fluorescent optical sensor for determining kanamycins
CN111398393A (en) * 2020-05-20 2020-07-10 河南工业大学 Preparation method of electrochemical aptamer rate sensor for patulin detection
CN114088675A (en) * 2021-11-17 2022-02-25 浙江科技学院 Immunoliposome wrapping fluorescent dye and application

Similar Documents

Publication Publication Date Title
Zhang et al. A new approach to light up DNA/Ag nanocluster-based beacons for bioanalysis
Ma et al. Recent developments in G-quadruplex probes
Chen et al. Random dsDNA-templated formation of copper nanoparticles as novel fluorescence probes for label-free lead ions detection
CN103940792B (en) A kind of method simultaneously detecting three kinds of food-borne pathogens based on polychrome up-conversion fluorescent marking
Wang et al. Sensing telomerase: From in vitro detection to in vivo imaging
Kim et al. Plasma components affect accuracy of circulating cancer-related microRNA quantitation
Ma et al. Femtogram ultrasensitive aptasensor for the detection of OchratoxinA
Zeng et al. A quantum dot-based microRNA nanosensor for point mutation assays
CN101281131B (en) Method for detecting enoxacin in biological body fluid with Mn doping ZnS quantum point room temperature phosphorescent
CN104818319B (en) Aflatoxin B1Real-time quantitative PCR detection method
Chen et al. Enzyme-free detection of DNA based on hybridization chain reaction amplification and fluorescence resonance energy transfer
Wang et al. Ultrasensitive detection of microRNA with isothermal amplification and a time-resolved fluorescence sensor
CN105543375A (en) Detection method and detection kit for patulin
Song et al. A sensitive quartz crystal microbalance assay of adenosine triphosphate via DNAzyme-activated and aptamer-based target-triggering circular amplification
He et al. Ultrasensitive SERS Detection of Lysozyme by a Target‐Triggering Multiple Cycle Amplification Strategy Based on a Gold Substrate
Lu et al. Amplified optical aptasensors through the endonuclease-stimulated regeneration of the analyte
Yao et al. A label-free, versatile and low-background chemiluminescence aptasensing strategy based on gold nanocluster catalysis combined with the separation of magnetic beads
Yang et al. Highly sensitive and selective detection of silver (I) in aqueous solution with silver (I)-specific DNA and Sybr green I
Park et al. A DNA-templated silver nanocluster probe for label-free, turn-on fluorescence-based screening of homo-adenine binding molecules
CN105296598A (en) Pb&lt;2+&gt; fluorescent detection method based on 8-17 DNAzyme principle and application of Pb&lt;2+&gt; fluorescent detection method
Zhang et al. Exploring the entropy-driven amplification reaction and trans-cleavage activity of CRISPR-Cas12a for the development of an electrochemiluminescence biosensor for the detection of the SARS-CoV-2 RdRp gene in real samples and environmental surveillance
CN105543376A (en) Rapid detection method for ochratoxin A
Feng et al. Label-free optical bifunctional oligonucleotide probe for homogeneous amplification detection of disease markers
Wang et al. A target-triggered exponential amplification-based DNAzyme biosensor for ultrasensitive detection of folate receptors
Xue et al. Label-free molecular beacon-based quadratic isothermal exponential amplification: a simple and sensitive one-pot method to detect DNA methyltransferase activity

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication
RJ01 Rejection of invention patent application after publication

Application publication date: 20160504