CN105543340A - Isothermal amplification detection kit of mutton-derived component nucleic acid, and detection method thereof - Google Patents
Isothermal amplification detection kit of mutton-derived component nucleic acid, and detection method thereof Download PDFInfo
- Publication number
- CN105543340A CN105543340A CN201510811021.6A CN201510811021A CN105543340A CN 105543340 A CN105543340 A CN 105543340A CN 201510811021 A CN201510811021 A CN 201510811021A CN 105543340 A CN105543340 A CN 105543340A
- Authority
- CN
- China
- Prior art keywords
- nucleic acid
- mutton
- amplification
- derived component
- primer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses an isothermal amplification detection kit of a mutton-derived component nucleic acid, and a detection method thereof. The kit comprises an isothermal amplification reaction solution, a positive reference substance and a negative reference substance; the detection kit has the advantages of high specificity and high sensitivity; a nucleic acid amplification reaction is carried out at a constant same temperature for 30min, a nucleic acid test strip detection result is obtained 1-2min later, the whole detection process from sample receiving to result obtaining only takes about 40min, and only one isothermal device is needed in the whole reaction process, so the kit and the method are especially suitable for onsite rapid detection of the mutton-derived component nucleic acid.
Description
(1) technical field
The present invention relates to a kind of constant-temperature amplification Fast Detection Technique for mutton derived component nucleic acid, be applicable to detecting the on-the-spot fast qualitative of mutton derived component nucleic acid.
(2) background technology
In recent years, the adulterated food-safety problem becoming social extensive concern of meat product.2013, " the horseflesh disturbance " that relate to European 16 states shocked whole Europe.In China, media have also exposed the meat adulteration doping event of a lot of " hanging out a sheep's head but actually sell dog's meat " repeatedly, and wherein the adulteration incident of mutton is the most common.Meat raw material and a small amount of cattle and sheep fat, tankage mix at a low price to use relatively inexpensive pork, duck etc. in the market of farm produce and indivedual illegal businessman or individual, mutton goods are pretended to be to carry out selling to seek great number interests, this adulterated behavior not only relates to the problem such as nutritive value and food safety, and also constituted a serious infringement consumer legitimate right.
At present, regular-PCR and real-time fluorescence quantitative PCR are the most frequently used methods of meat product Variety identification, and regular-PCR method exists length consuming time, complex operation, insufficient sensitivity, easily produce the shortcomings such as crossed contamination.Real-time fluorescence PCR rule has cost intensive, length consuming time, and technical requirements is high, and need the shortcomings such as large-scale plant and instrument, therefore its application still has some limitations.Isothermal amplification technology is a kind of new isothermal DNA amplification that developed recently gets up after round pcr, the technology of the present invention have developed constant-temperature amplification mutton derived component nucleic acid, and the colour developing of bind nucleic acid test strip judges detected result, and whole reaction process does not open reaction tubes lid, test strip flow detection process is airtight, has stopped nucleic acid amplification product and has polluted extraneous possibility.Research shows that the constant-temperature amplification-nucleic acid test strip detection method of this mutton derived component nucleic acid has the advantages such as high specificity, susceptibility is high, simple to instrument requirements, detection time is short, use so be useful in very much inspection body of basic unit, on the Site Detection of the market of farm produce, also there is good application prospect simultaneously.
(3) summary of the invention
The object of the invention is to provide a kind of constant-temperature amplification detection kit that is accurate, sensitive, detection mutton derived component nucleic acid rapidly and detection method thereof.
The technical solution used in the present invention is:
The invention provides a kind of constant-temperature amplification detection kit of mutton derived component nucleic acid, described test kit comprises following composition:
(1) isothermal amplification reactions liquid, comprising: primer, reverse peripheral primer, a probe, two ring primers, two intersections amplimer, 1 × Thermolbuffer, MgSO just to the periphery
4, dNTPs solution, BstDNA polysaccharase and aseptic double-distilled water; Wherein:
Described peripheral primer is respectively:
Primer is just to the periphery: 5 '-GCAAACCCACTTAACACTC-3 ' (SEQIDNO.2);
Reverse peripheral primer is: 5 '-AGGTCGGCTACTAGGATTC-3 ' (SEQIDNO.3);
The sequence of described two ring primers is respectively:
Forward: 5 ' end Biotin label probe 5 '-Biotin-
GCGTACGCAAATAGGAAGTATCA-3′(SEQIDNO.4)；
Reverse: 5 '-ACATCAAAGCAACGGAGCATAA-3 ' (SEQIDNO.5);
Described two amplification cross primers are respectively:
Amplification forward primer:
5′-GGACTCCTCCTAGTTTATTAGGGATCCCTCACATCAAACCTGAA-3′(SEQIDNO.6)；
Amplification reverse primer:
5′-GTCCTAGTAATTATACCCCTCCTCCATTGACTGATTGGTCGGAAT-3′(SEQIDNO.7)；
5 ' end Fitc label probe: 5 '-Fitc-TCGCCCTAATCCTCTCAATCCT-3 ' (SEQIDNO.8);
(2) positive control: the DNA plasmid belonging to specific Cytb gene fragment containing sheep;
(3) negative control: aseptic double-distilled water.
Further, 1 × Thermolbuffer of the present invention consists of: (the NH of KCl, 10mM of Tris-HCl, 10mM of 20mM
4)
2sO
4, 2mM MgSO
4and mass concentration is the TritonX-100 of 0.1%, pH8.8.
Further, positive control of the present invention is the fragment that the sheep containing long 221bp belongs to specific Cytb gene order, the nucleotide sequence following (SEQIDNO.1) of described fragment:
GCAAACCCACTTAACACTCCCCCTCACATCAAACCTGAATGATACTTCCTATTTGCGTACGCAATCTTACGATCAATCCCTAATAAACTAGGAGGAGTCCTCGCCCTAATCCTCTCAATCCTAGTCCTAGTAATTATACCCCTCCTCCATACATCAAAGCAACGGAGCATAATATTCCGACCAATCAGTCAATGTATATTCTGAATCCTAGTAGCCGACCT。
Further, positive control of the present invention is prepared as follows:
Belong to specific Cytb gene fragment for template with the sheep comprising amplification region, carry out pcr amplification by two peripheral primers and obtain goal gene; PCR purification kit (Promega) is utilized to carry out purifying to pcr amplification product; Amplified production after purifying is built the complete plasmid sequence containing goal gene by T-easy plasmid transfection test kit (Promega), with spectrophotometer, A is surveyed to the plasmid of institute's extracting
280quantitatively and be diluted to 10 copy/μ l, acquisition positive control ,-20 DEG C of preservations.
Further, isothermal amplification reactions liquid of the present invention consists of: two peripheral primer 5.7nmol separately, two ring primers and probe 11.4nmol separately, two cross primer 22.8nmol separately, 1 × Thermolbuffer, MgSO
4be 0.2 μm of ol, dNTPs solution each 35pmol, BstDNA polysaccharase 8U, aseptic double-distilled water composition complements to 25 μ l.
The present invention also provides a kind of detection method of constant-temperature amplification detection kit of described mutton derived component nucleic acid, and described detection method is:
A) extract specimen dna to be detected: clip is about the meat samples of grain of rice size (50mg), vibrate after adding 500 μ L distilled waters 15s, in 95 DEG C of effect 5min, gets supernatant, namely obtain DNA after centrifugal;
B) step a) being extracted the DNA obtained joins in the PCR pipe that isothermal amplification reactions liquid is housed as template, amplified reaction 30 minutes at 65 DEG C; Standard positive template (i.e. positive control) adds in positive control PCR pipe, standard negative template (i.e. negative control) adds in negative control PCR pipe, described standard positive template is the DNA plasmid belonging to specific Cytb gene fragment containing sheep, and described standard negative template is aseptic double-distilled water;
C) reacted PCR pipe is placed in the anti-pollution proofing unit of nucleic acid test strip (Hangzhou You Sida biotech company No. 3 devices) and detects, sentence read result after 2 minutes, when the detection line of test strip is positive, containing mutton derived component nucleic acid in interpret sample.This test strip is included on the liner with non-setting adhesive sample pad, coloured particle binding substances pad and absorbent filter pad in order, each part mentioned above partly overlaps at adjacent, tunica fibrosa is provided with detection line and nature controlling line, coloured particle wherein on coloured particle binding substances pad has anti-Fitc antibody bag quilt, detection line there is avidin bag quilt, nature controlling line has anti-Fitc antibody, coloured particle is selected from colloid gold particle, latex particle.
In test kit provided by the invention, there are two peripheral primers, two cross primers and two detection probes.6 oligonucleotide sequences in this test kit rely on the highly active strand displacement characteristic of BstDNA polysaccharase, make strand displacement DNA synthesize continuous self-amplification cycles.In the constant-temperature amplification detection kit of mutton derived component nucleic acid provided by the invention, different reaction conditionss is optimized, as the concentration of primer and probe, Mg
2+concentration, the optimization of temperature of reaction etc., and the present invention is combined with nucleic acid detection test strip detection system, establish the method for the constant-temperature amplification qualitative detection of mutton derived component nucleic acid.The sensitivity of this test kit can detect 1 copy in each reaction system, can meet the requirement of rapid detection mutton derived component nucleic acid.
The present invention compared with prior art, has the following advantages and effect:
(1) this invention simplifies the extracting method of meat sample nucleic, reduce cost, and substantially reduce detection time.
(2) specificity of the constant-temperature amplification detection kit of mutton derived component nucleic acid is good, highly sensitive, and step is simple, repeatable high;
(3) speed of response is fast, and single sample, from sample process to completing detection, only needs about 40 minutes;
(4) do not need to open PCR pipe lid in whole amplification and testing process, decrease the chance that amplified production pollutes; Whole reaction process does not need complicated instrument.
(4) accompanying drawing explanation
Fig. 1 is nucleic acid detection test strip principle schematic.
Fig. 2 be test kit of the present invention for detecting the specificity of mutton derived component nucleic acid, in figure, 1-7 represents mutton, chicken, duck, pork, beef, positive reference substance, negative controls respectively.
Fig. 3 be test kit of the present invention for detecting the sensitivity of mutton derived component nucleic acid, in figure, 1-7 represents 10 respectively
4copy/microlitre, 10
3copy/microlitre, 10
2copy/microlitre, 10
1copy/microlitre, 10
0copy/microlitre, 10
-1copy/microlitre, negative controls.
(5) embodiment
Below in conjunction with specific embodiment, the present invention is described further, but protection scope of the present invention is not limited in this:
The composition of embodiment 1 test kit of the present invention and preparation
A) the isothermal amplification reactions liquid of mutton derived component nucleic acid: two peripheral primers (5.7nmol),, a probe (11.4nmol), article two, ring primer (11.4nmol) and two amplifications cross primer (22.8nmol), 1 × Thermolbuffer, MgSO
4(0.2 μm of ol), dNTPs solution (each 35pmol), BstDNA polysaccharase (8U) and aseptic double-distilled water composition, it is 25 μ l that total reaction liquid amasss;
Described primer just is to the periphery: 5 '-GCAAACCCACTTAACACTC-3 ';
Reverse peripheral primer is: 5 '-AGGTCGGCTACTAGGATTC-3 ';
The sequence of described two ring primers is respectively:
Forward: 5 '-GCGTACGCAAATAGGAAGTATCA-3 ';
Reverse: 5 '-ACATCAAAGCAACGGAGCATAA-3 ';
Described two amplification cross primers are respectively:
Amplification forward primer:
5′-GGACTCCTCCTAGTTTATTAGGGATCCCTCACATCAAACCTGAA-3′；
Amplification reverse primer:
5′-GTCCTAGTAATTATACCCCTCCTCCATTGACTGATTGGTCGGAAT-3′；
Described probe sequence is: 5 '-TCGCCCTAATCCTCTCAATCCT-3 ';
1 described × Thermolbuffer consists of: (the NH of KCl, 10mM of Tris-HCl, 10mM of 20mM
4)
2sO
4, 2mM MgSO
4and mass concentration is the TritonX-100 of 0.1%, pH7.8.
All primers and probe are by the synthesis of Shanghai raw work biological company limited.
B) positive control: positive control is that the sheep containing long 221bp belongs to specific Cytb gene order, and sequence is as follows:
GCAAACCCACTTAACACTCCCCCTCACATCAAACCTGAATGATACTTCCTATTTGCGTACGCAATCTTACGATCAATCCCTAATAAACTAGGAGGAGTCCTCGCCCTAATCCTCTCAATCCTAGTCCTAGTAATTATACCCCTCCTCCATACATCAAAGCAACGGAGCATAATATTCCGACCAATCAGTCAATGTATATTCTGAATCCTAGTAGCCGACCT。
Positive control is prepared as follows:
Belong to specific Cytb gene fragment for template with the sheep comprising amplification region, carry out pcr amplification by two peripheral primers and obtain goal gene; PCR purification kit is utilized to carry out purifying to pcr amplification product; Amplified production after purifying is built the complete plasmid sequence containing goal gene by T-easy plasmid transfection test kit, with spectrophotometer, A is surveyed to the plasmid of institute's extracting
280quantitatively and be diluted to 10 copy/μ l ,-20 DEG C of preservations.
C) negative control: aseptic double-distilled water.
Embodiment 2 test kit of the present invention detects the concrete grammar of mutton derived component nucleic acid
A) extract in sample to be detected and extract DNA.
B) get specimen dna as template, join in the PCR pipe of the isothermal amplification reactions liquid that mutton derived component nucleic acid is housed, wherein specimen dna 3 μ l, reaction solution 22 μ l, 65 DEG C of amplified reactions 30 minutes; Positive template (sheep containing long 221bp belongs to specific Cytb gene order) and negative template (aseptic double-distilled water) is added respectively in the positive and negative control PCR pipe.
C) reacted PCR pipe is placed in the anti-pollution proofing unit of nucleic acid test strip (Hangzhou You Sida biotech company No. 3 devices) and detects, sentence read result after 2 minutes.When containing mutton derived component nucleic acid in sample, the detection line of test strip is positive.
Repeatedly repeat experiment 3 times, detected result there was no significant difference, the detected result between the different batches that this test kit is described has comparability, has good repeatability.Above-described embodiment illustrates, detects reproducible, and only needs just can complete for about 40 minutes to the detection of sample, greatly shorten detection time with test kit of the present invention.
Detect the reproducible of mutton derived component nucleic acid with test kit of the present invention, and only within about 40 minutes, just can complete the detection of sample, greatly shorten detection time.
Embodiment 3 test kit of the present invention detects the specificity of mutton derived component
Mutton, chicken, duck, pork, beef derived component nucleic acid and detection kit positive reference substance is detected according to the method for embodiment 2, result display test kit of the present invention detects mutton derived component nucleic acid and has very strong specificity, except mutton derived component nucleic acid and test kit positive reference substance, other meat detected results are feminine gender.As shown in Figure 2, in figure, 1-7 represents the experimental result of mutton, chicken, duck, pork, beef, positive reference substance, negative controls respectively.
Embodiment 4 test kit of the present invention detects the sensitivity of mutton nucleic acid
Carry out quantitatively to the plasmid DNA belonging to specific Cytb gene fragment containing sheep, being diluted to concentration is respectively 10
4copy/microlitre, 10
3copy/microlitre, 10
2copy/microlitre, 10
1copy/microlitre, 10
0copy/microlitre, 10
-1copy/microlitre, adopts method described in embodiment 2 to determine that test kit of the present invention is for detecting the sensitivity of mutton nucleic acid.As shown in Figure 3, in figure, 1-7 represents 10 to result respectively
4copy/microlitre, 10
3copy/microlitre, 10
2copy/microlitre, 10
1copy/microlitre, 10
0copy/microlitre, 10
-1the experimental result of copy/microlitre, negative controls, can find that this test kit can detect 1 copy in each reaction system, have very high sensitivity, can meet the requirement of rapid detection mutton derived component nucleic acid.
Claims (6)
1. a constant-temperature amplification detection kit for mutton derived component nucleic acid, is characterized in that described test kit comprises following composition:
(1) isothermal amplification reactions liquid, comprising: primer, reverse peripheral primer, a probe, two ring primers, two increase cross primer, 1 × ThermolBuffer, MgSO just to the periphery
4, dNTPs solution, BstDNA polysaccharase and aseptic double-distilled water;
Described primer just is to the periphery: 5 '-GCAAACCCACTTAACACTC-3 ';
Reverse peripheral primer is: 5 '-AGGTCGGCTACTAGGATTC-3 ';
The sequence of described two ring primers is respectively:
Forward: 5 '-GCGTACGCAAATAGGAAGTATCA-3 ';
Reverse: 5 '-ACATCAAAGCAACGGAGCATAA-3 ';
Described two amplification cross primers are respectively:
Amplification forward primer: 5 ' end Biotin mark
5′-GGACTCCTCCTAGTTTATTAGGGAT-CCCTCACATCAAACCTGAA-3′；
Amplification reverse primer:
5′-GTCCTAGTAATTATACCCCTCCTCC-ATTGACTGATTGGTCGGAAT-3′；
Probe: 5 ' end flag F itc:5 '-Fitc-TCGCCCTAATCCTCTCAATCCT-3 ';
(2) positive control: the DNA plasmid belonging to specific cytochrome b gene Cytb containing sheep;
(3) negative control: aseptic double-distilled water.
2. the constant-temperature amplification detection kit of mutton derived component nucleic acid as claimed in claim 1, is characterized in that described 1 × ThermolBuffer consists of: (the NH of KCl, 10mM of Tris-HCl, 10mM of 20mM
4)
2sO
4, 2mM MgSO
4and mass concentration is the TritonX-100 of 0.1%, pH7.8.
3. the constant-temperature amplification detection kit of mutton derived component nucleic acid as claimed in claim 1, it is characterized in that described positive control is the fragment that sheep containing long 221bp belongs to specific Cytb gene order, the nucleotides sequence of described fragment is classified as shown in SEQIDNO.1.
4. the constant-temperature amplification detection kit of mutton derived component nucleic acid as claimed in claim 1, is characterized in that described positive control is prepared as follows:
Belong to specific Cytb gene fragment for template with the sheep comprising amplification region, carry out pcr amplification by two peripheral primers and obtain goal gene; PCR purification kit is utilized to carry out purifying to pcr amplification product; Amplified production after purifying is built the complete plasmid sequence containing goal gene by T-easy plasmid transfection test kit, with spectrophotometer to the plasmid of institute's extracting quantitatively and be diluted to 10 copy/μ l, acquisition positive control ,-20 DEG C of preservations.
5. the constant-temperature amplification detection kit of mutton derived component nucleic acid as claimed in claim 1, it is characterized in that described constant temperature pcr amplification reaction liquid consists of: two peripheral primer 5.7nmol separately, article two, ring primer and probe 11.4nmol separately, article two, cross primer 22.8nmol separately, 1 × Thermolbuffer, MgSO
4be 0.2 μm of ol, dNTPs solution each 35pmol, BstDNA polysaccharase 8U, aseptic double-distilled water composition complements to 25 μ l.
6. a detection method for the constant-temperature amplification detection kit of mutton derived component nucleic acid described in claim 1, is characterized in that described detection method is:
A) extract specimen dna to be detected: clip is about the meat samples of grain of rice size, vibrate after adding 500 μ L distilled waters 15s, in 95 DEG C of effect 5min, gets supernatant, namely obtain DNA after centrifugal;
B) step a) is extracted the DNA that obtains as template, join in the PCR pipe that isothermal amplification reactions liquid is housed, amplified reaction 30 minutes at 65 DEG C; Standard positive template adds in positive control PCR pipe, and standard negative template adds in negative control PCR pipe, and described standard positive template is the DNA plasmid belonging to specific Cytb gene fragment containing sheep, and described standard negative template is aseptic double-distilled water;
C) reacted PCR pipe is placed in the anti-pollution proofing unit of nucleic acid test strip detects, sentence read result after 2 minutes, when the detection line of test strip is positive, containing mutton derived component nucleic acid in interpret sample.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510811021.6A CN105543340A (en) | 2015-11-20 | 2015-11-20 | Isothermal amplification detection kit of mutton-derived component nucleic acid, and detection method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510811021.6A CN105543340A (en) | 2015-11-20 | 2015-11-20 | Isothermal amplification detection kit of mutton-derived component nucleic acid, and detection method thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN105543340A true CN105543340A (en) | 2016-05-04 |
Family
ID=55822897
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510811021.6A Pending CN105543340A (en) | 2015-11-20 | 2015-11-20 | Isothermal amplification detection kit of mutton-derived component nucleic acid, and detection method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105543340A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105063229A (en) * | 2015-09-14 | 2015-11-18 | 苗丽 | Specific primers and probe by fluorogenic quantitative PCR (Polymerase Chain Reaction) for detecting sheep-derived ingredients in meat products and kit thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1811447A (en) * | 2006-02-08 | 2006-08-02 | 杭州优思达生物技术有限公司 | Nucleic acid membrane chromatographic fast detecting method and its test paper bar and use thereof |
| CN101638685A (en) * | 2008-07-29 | 2010-02-03 | 杭州优思达生物技术有限公司 | Method for amplifying target nucleic acid sequence by using cross primer and kit for amplifying target nucleic acid sequence and application thereof |
| CN105039541A (en) * | 2015-07-14 | 2015-11-11 | 宁波大学 | Primer and probe sequence used for LAMP-LFD detection of vibrio fluvialis and application of primer and probe sequence |
-
2015
- 2015-11-20 CN CN201510811021.6A patent/CN105543340A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1811447A (en) * | 2006-02-08 | 2006-08-02 | 杭州优思达生物技术有限公司 | Nucleic acid membrane chromatographic fast detecting method and its test paper bar and use thereof |
| CN101638685A (en) * | 2008-07-29 | 2010-02-03 | 杭州优思达生物技术有限公司 | Method for amplifying target nucleic acid sequence by using cross primer and kit for amplifying target nucleic acid sequence and application thereof |
| CN105039541A (en) * | 2015-07-14 | 2015-11-11 | 宁波大学 | Primer and probe sequence used for LAMP-LFD detection of vibrio fluvialis and application of primer and probe sequence |
Non-Patent Citations (1)
| Title |
|---|
| 李向丽等: "基于LAMP法快速检测羊肉及其制品中的猪、鸭和羊源性成分", 《中国食品卫生杂志》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105063229A (en) * | 2015-09-14 | 2015-11-18 | 苗丽 | Specific primers and probe by fluorogenic quantitative PCR (Polymerase Chain Reaction) for detecting sheep-derived ingredients in meat products and kit thereof |
| CN105063229B (en) * | 2015-09-14 | 2019-01-04 | 苗丽 | For detecting quantitative fluorescent PCR specific primer, probe and its kit of sheep derived material in meat products |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Yu et al. | Multiple authentications of high-value milk by centrifugal microfluidic chip-based real-time fluorescent LAMP | |
| CN105274099B (en) | The primer of 9 kinds of animal derived materials, probe compositions, kit and its detection method and application in Rapid identification food or feed | |
| CN102373273B (en) | Kit for detecting nucleic acid of mycobacterium tuberculosis | |
| CN105296642A (en) | Isothermal amplification detection kit for pork derived component nucleic acid and detection method | |
| CN105331710A (en) | Nucleic acid isothermal amplification detection kit for Salmonella and detection method | |
| CN103614489B (en) | Constant-temperature amplification detection kit for dengue viruses and detection method | |
| CN105675565B (en) | A kind of method of quick detection aflatoxin B1 | |
| CN103898108B (en) | The nucleotide special to vibrio fluvialis O2, O4, O13, O15 and O18 and application thereof | |
| Dunbar et al. | Luminex® multiplex bead suspension arrays for the detection and serotyping of Salmonella spp. | |
| CN104561275A (en) | Vibrio parahaemolyticus isothermal amplification detection kit and detection method | |
| Wang et al. | A low-cost novel lateral flow nucleic acid assay (LFNAA) for yak milk authentication | |
| CN103397105B (en) | Kit for detecting GII type norovirus and applications thereof | |
| CN110643693A (en) | Primer, probe, kit and detection method for detecting Mcr by RAA fluorescence method | |
| CN105296644A (en) | Isothermal amplification detection kit for chicken derived component nucleic acid and detection method | |
| CN107012229A (en) | Pig derived component quick determination method and kit in food | |
| CN104328190A (en) | PCR (polymerase chain reaction) product melting point analysis method for quantitatively detecting species composition of mixed-type sample | |
| CN113801920A (en) | Kit and method for rapidly detecting salmonella based on CRSIPR-Cas system | |
| CN101570780B (en) | Detection kit and detection method for brucellae in meat products | |
| Fu et al. | Lateral flow strip biosensor based on streptavidin-coated gold nanoparticles with recombinase polymerase amplification for the quantitative point-of-care testing of Salmonella | |
| Li et al. | An autonomous synthetic DNA machine for ultrasensitive detection of Salmonella typhimurium based on bidirectional primers exchange reaction cascades | |
| CN105296643A (en) | Isothermal amplification detection kit and detection method for duck meat derived component nucleic acid | |
| CN104561375A (en) | Isothermal amplification detection kit and detection method of new bunyavirus | |
| CN105543340A (en) | Isothermal amplification detection kit of mutton-derived component nucleic acid, and detection method thereof | |
| CN104313179B (en) | Isothermal amplification detection kit and detection method for Zaire type Ebola virus | |
| CN102827933A (en) | Kit for qualitative detection of pinewood nematode and detection method thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20160504 |
|
| RJ01 | Rejection of invention patent application after publication |