CN105543262A - A human metallothionein-3 fusion protein expression vector - Google Patents
A human metallothionein-3 fusion protein expression vector Download PDFInfo
- Publication number
- CN105543262A CN105543262A CN201510976740.3A CN201510976740A CN105543262A CN 105543262 A CN105543262 A CN 105543262A CN 201510976740 A CN201510976740 A CN 201510976740A CN 105543262 A CN105543262 A CN 105543262A
- Authority
- CN
- China
- Prior art keywords
- expression vector
- fusion protein
- human metallothionein
- protein expression
- mankind
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/825—Metallothioneins
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/20—Fusion polypeptide containing a tag with affinity for a non-protein ligand
- C07K2319/21—Fusion polypeptide containing a tag with affinity for a non-protein ligand containing a His-tag
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Biophysics (AREA)
- General Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- General Health & Medical Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biochemistry (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Peptides Or Proteins (AREA)
Abstract
A human metallothionein-3 fusion protein expression vector is disclosed. The upstream of a cloning region of the expression vector comprises a human fatty acid binding protein (hFABP6) and the downstream of the cloning region comprises metallothionein MT3. A method of applying the expression vector is also disclosed and includes basic manners for expression strain construction, amplification, inducible expression and fusion protein purification. The hFABP6-MT3 fusion protein expression vector is characterized by (1) efficient expression of MT3 protein and (2) soluble expression.
Description
Technical field
The invention belongs to genetically engineered and field of fermentation engineering, relate to a kind of human metallothionein-3 fusion protein expression vector, especially relate to and a kind of there is mankind's free-fat acid binding protein of companion's sample protein function and the amalgamation and expression of human metallothionein.
Background technology
Nineteen fifty-seven Margoshes and Vallee is when studying metal biological action, isolate a kind of new protein from animal organ, it contains abundant sulfydryl, the metal ion that energy chelating is a large amount of, this material is called metallothionein(MT) (English is Metallothionein, is called for short MT).
About metallothionein(MT), the whole world was from 1978 to 1999, and successively held four International Workshop symposials altogether in Switzerland, Japan, the U.S., the 5th International Workshop symposial is held in October, 2005 in Beijing.Within 1987, MT is listed in [863] plan by China, and " eight or five ", " 95 " great brainstorm project, list national level [torch plan] for 1994 in; MT project in 2003 is classified as by the Ministry of Science and Technology that " national science and technology achievement key popularization plan project, nineteen ninety-five, MT was listed in the biological technology products recommended to countries in the world by United Nations.As can be seen here from domestic abroad to the great attention of the research of MT, exploitation, popularization, application.
Metallothionein(MT) (Metallothionein, MT), also known as sulfydryl metal binding protein., except the MT containing cadmium (Cd), zinc (Zn), also there is the MT containing copper (Cu), mercury (Hz), element such as gold (Au), bismuth (Bi) etc. at nature in one class non-enzymatic protein.Not containing die aromatischen Aminosaeuren and Histidine in the protein molecular of MT.The pH value allowing in MT the metal ion of 50% dissociate is respectively: Zn-MT:3.5 ~ 4.5; Cd-MT:2.5 ~ 3.5; Cu-MT<1.0.Because MT lacks die aromatischen Aminosaeuren, therefore at 280nm place without absorption peak, but there is the absorption peak relevant to metal.The MT of metal is gone to have an absorption peak at 190nm place.All MT is contained in all vertebratess, most plants and microbe.Be no matter that natural birth survives be the MT that induction produces, its amino acid composition is substantially identical, main difference is at institute's containing metal and content thereof.
Mankind MT is divided into four subgroups by characterization of molecules and distribution: MT1, MT2, MT3, MT4.MT1 divides again 9 subclass, and MT2 divides MT2a and MT2b again.MT1 and MT2 distributes whole body, and MT3 is distributed in brain, and MT4 is mainly distributed in skin.
Free radical is the first arch-criminal of human senility, and also some the diseases of middle-and old-aged persons are closely related free radical with the mankind, cause body immunity progressively to decline, and MT is best free-radical scavengers known at present, and reducing free radical just can delaying human body caducity paces.Meanwhile, MT is also current unique effective heavy metal detoxification and removes albumen.Human body heavy metals exceeding standard or poisoning, infringement liver, kidney, bone, brain and memory function, cause various diseases.
A large amount of scientific experiments and clinical effectiveness show: MT is in ionizing radiation-resistant, uviolizing, releasing metal toxin, treatment or alleviate digestive tract ulcer, myocardial infarction, various inflammation, various cancer, protect skin, alleviate smoking and environmental pollution all has significant curative effect in the harm of human body and antianaphylaxis etc.
Current MT product mainly extracts from rabbit liver, horse kidney, pork liver and microorganism (as thick neurospora) etc., and cost is high, yield poorly, and inhibits her widely using, such as food, drink, makeup etc.
Summary of the invention
The object of this invention is to provide a kind of human metallothionein's fusion protein expression vector.
Object of the present invention realizes by following technical scheme:
A kind of human metallothionein's fusion protein expression vector, described human metallothionein's fusion protein expression vector is the polyclone district gained of the fusion protein expression vector encoding sequence of human metallothionein-3 (MT3) being inserted companion's sample albumen as desired protein coding sequences; The encoding sequence of mankind's free-fat acid binding protein-6 is contained in the fusion protein expression vector upstream of described companion's sample albumen, and mankind's free-fat acid binding protein encoding sequence downstream comprises one section of flexible joint district and the polyclone district for inserting target protein.
Described mankind's free-fat acid binding protein-6 is equal to or greater than 85% with the protein-bonded homology of the natural free fatty acids of the mankind, and the encoding sequence of described mankind's free-fat acid binding protein-6 is preferably past codon optimized encoding sequence.
The encoding sequence of described mankind's free-fat acid binding protein-6 is preferably as shown in SEQIDNO.1.
Described flexible joint district and polyclone region sequence are preferably as shown in SEQIDNO.3.
Its aminoacid sequence of described human metallothionein-3 is preferably equal to or greater than 75% with the homology of the aminoacid sequence of mankind's native metal sulfoprotein.
Human metallothionein-3 (MT3) aminoacid sequence as shown in SEQIDNO.21, through codon optimized human metallothionein-3 (MT3) encoding sequence preferably as shown in SEQIDNO.20.
In described expression vector, the upstream of the encoding sequence of mankind's free-fat acid binding protein-6 also comprises the sequence of coding for separating of the label of purified fusion protein, the sequence that optimized encoding is histidine-tagged.
Beneficial effect:
1. the recombinant expression vector that the present invention builds can promote or induce the folding of Fused downstream human metallothionein's fusion rotein, has the characteristic of chaperone sample albumen.
2. this FABP albumen is humanized, there is not the immunogenicity to human body in theory, is suitable for solving target protein inclusion body problem in pharmaceutical industry, and can retains fusion rotein together pharmacy.
Accompanying drawing explanation
Fig. 1, hFABP fusion rotein schematic diagram
Fig. 2, pET28a-hFABP6 expression vector physical map
Fig. 3, pET28-hFABP6-MT3 cyclic plasmid physical map.
Embodiment
Below by specific embodiment, application of the present invention is described, for embodiment be only to of the present invention should be used as generality illustrate, contribute to understanding purposes of the present invention better, but range of application of the present invention can't be limited.Experimental technique described in following embodiment, if no special instructions, is ordinary method; Described reagent and material, if no special instructions, all can obtain from commercial channels.
Embodiment 1
A construction process for the fusion protein expression vector of companion's sample albumen, comprises the following steps:
The synthetic of the coding DNA of step one, hFABP and optimization, the present embodiment is for hFABP6:
(1) get hFBP6 aminoacid sequence (SEQIDNO.2) converse translation and become DNA encoding sequence, codon priority, rrna land sequence optimisation obtain sequence (SEQIDNO.1), but be not limited thereto sequence, be equal to or greater than 85% with the protein amino acid sequence homology after translating and be limited.
(2) by this encoding sequence salvage oligonucleotide single stranded DNA (SEQIDNO.5 ~ 18).
(3) polymerase chain reaction (PCR) method synthesis total length DNA sequences encoding, comprises 5 '-6xHisTag (SEQIDNO.4), hFBP6 amino acid coding, 3 '-flexible linker sequence (Linker) and polyclone district (SEQIDNO.3).
(4) through sequencing reaction checking full length DNA sequence (shown in SEQIDNO.19).
Prepared by step 2, carrier:
(1) step one is synthesized the hFABP6 encoding sequence (SEQIDNO.19) obtained, comprise 5 '-6xHisTag, 3 '-flexible linker sequence (Linker) and polyclone district, through restriction digest, agarose gel purification, obtain the Insert Fragment that two ends are the adhesive bond of NcoI and XhoI respectively.
(2) prepare expression vector pET28a, but be not limited to this expression vector:
1. pET28a carrier 1 μ g is got, with restriction enzyme NcoI and XhoI double digestion.
2. the pET28a carrier after agarose gel electrophoresis separation, purified linear.
3. with T4DNA ligase enzyme, the Insert Fragment comprising hFABP6 sequence is connected with the pET28a expression vector that 2. step prepares.
4. transformation of E. coli competence bacterial strain DH5 α, containing the antibiotic culture dish overnight incubation of kantlex (Kan), then picking list bacterium colony, PCR method qualification positive colony, conventional preparation DNA plasmid.
5. positive colony plasmid is delivered DNA sequence analysis, choose and retain clone's confession expression test of correct sequence.
6. carrier called after pET28a-hFABP6 (SEQIDNO.22)
The expression test of step 3, carrier:
(1) pET28a-hFABP6 carrier DNA plasmid transformation escherichia coli BL21 (DE3) competent cell step 2 obtained, obtains the bacterium colony of Kan resistance.
(2) picking list bacterium colony is several, LB culture medium culturing, and IPTG induces 4-12 hour, collects bacterium liquid 1mL, collected by centrifugation thalline, and once, settling flux is in 0.5mL1 × PBS, and ultrasonication thalline, centrifugal going is precipitated in 1 × PBS washing.
(3) get appropriate 20 μ L supernatants to mix with sample-loading buffer, 95 DEG C of heat denatured 10 minutes, at the bottom of collected by centrifugation to pipe, as on ice.
(4) 10 μ L loading 15% polyacrylamide gel electrophoresises are got, coomassie brilliant blue staining, decolouring, the expression of observing protein band and hFABP6 albumen.
(5) recombinate hFABP6, comprises N-HisTag, flexible joint, polyclone district, altogether 158aa, molecular weight 17.2kDa.HFABP6 accounts for 20% of bacterial protein, solubility expression.
Embodiment 2
1, the full genome synthesis of MT3:
The method of synthesis is general two-step PCR (PCR, polymerase chain reaction), obtain MT3 coding DNA: 1) Overlap extension PCR (OverlapPCR) is with as template each other synthesis full length DNA sequence, the primer 4 (SEQIDNO:23 ~ 26); 2) and with this product for template, pcr amplification full length DNA, the primer 2 (SEQIDNO.27,28).
(1) joining seam extension PCR parameter: 94 DEG C/30 seconds, 56 DEG C/30 seconds, 72 DEG C/30 seconds, 15 circulations, polishing extended 72 DEG C/2 minutes.
(2) total length synthesis PCR parameter: 94 DEG C/30 seconds, 58 DEG C/30 seconds, 72 DEG C/45 seconds, 30 circulations, polishing extended 72 DEG C/5 minutes.
2, hFABP6-MT3 fusion protein expression vector builds:
(1) the MT3DNA sequence obtained by synthetic, respectively through the process of KpnI/XhoI double digestion, electrophoresis, cuts glue purification;
(2) simultaneously by the KpnI/XhoI double digestion process of pET28-hFABP6 carrier, purifying;
(3) with T4DNA ligase enzyme, the DNA fragmentation processed through (1) and (2) is connected respectively, is formed and connect product: pET28-hFABP6-MT3 (SEQIDNO.29).
(4) product conversion competence coli strain BL21 (DE3) will be connected, picking list bacterium colony, PCR method qualification positive colony, delivers DNA sequence analysis, pET28-hFABP6-MT3/BL21 (DE3) clone that reservation queue is correct, preserves bacterial classification.
Embodiment 3
(1) structure of control vector pET28-MT3
(1) PCR of MT3
The PCR primer of MT3, upstream primer:
5 '-TTTTGGTACCATGGATCCTGAAACTTGTCCTTGTCCTTCCGG-3 ' (SEQIDNO.27), downstream primer: 5 ’ – TTTTCTCGAGTTACTGACAGCAGGAACATTTTTCCGCTTCCGCTTCAGCG – 3 ' (SEQIDNO.28).
PCR parameter is: 94 DEG C/30 seconds, 56 DEG C/30 seconds, 72 DEG C/30 seconds, 30 circulations.
(2) digestion with restriction enzyme of MT3PCR product
PCR primer NcoI/XhoI double digestion, electrophoresis cuts glue purification.
3., with NcoI/XhoI double digestion process pET28 carrier, electrophoresis cuts glue purification.
4.T4DNA ligase enzyme connecting linear pET28 carrier and Insert Fragment MT3.
5. will connect product conversion competent escherichia coli cell BL21 (DE3), picking list bacterium colony amplification qualification recon, sequencing analysis obtains correct pET28-MT3 clone.
6. get above-mentioned correct clone, LB substratum incubated overnight increases bacterium.
7. get overnight culture 1:10 and be inoculated in fresh LB, after 4 hours, or OD=0.6, add IPTG to 0.1mM, continue induction 12 hours.
8. get 1mL culture, collected by centrifugation thalline, PBS washs 1 time, add 0.5mLPBS resuspension, ultrasonication, retain upper cleer and peaceful precipitation respectively, throw out 0.5mLPBS settling flux, gets supernatant 20 μ L respectively, 2x protein electrophoresis damping fluid 20 μ L, 95 DEG C are heated 10 minutes, place 2 minutes on ice, centrifugal 12000RPM, 5 minutes, collect supernatant, give over to polyacrylamide gel electrophoresis.
9. get 10 μ L sample loading polyacrylamide gels respectively, electrophoresis arrives lower 1/3 of gel to dye front, receives glue, coomassie brilliant blue staining, decolouring.
10. observe the band of expression with or without 6.9kDa and band concentration (accounting for the ratio of total protein).
(2) the expression test of pET28-hFABP6-MT3
(1) correct clone's incubated overnight of pET28-hFABP6-MT3/BL21 (DE3) is increased bacterium;
(2) get overnight culture 1:10 and be inoculated in fresh LB, after 4 hours, or OD=0.6, add IPTG to 0.1mM, continue induction 12 hours.
(3) get 1mL culture, collected by centrifugation thalline, PBS washs 1 time, add 0.5mLPBS resuspension, ultrasonication, retain upper cleer and peaceful precipitation respectively, throw out 0.5mLPBS settling flux, gets supernatant 20 μ L respectively, 2x protein electrophoresis damping fluid 20 μ L, 95 DEG C are heated 10 minutes, place 2 minutes on ice, centrifugal 12000RPM, 5 minutes, collect supernatant, give over to polyacrylamide gel electrophoresis.
(4) get 10 μ L sample loading polyacrylamide gels respectively, electrophoresis arrives lower 1/3 of gel to dye front, receives glue, coomassie brilliant blue staining, decolouring.
(5) observe the band of expression with or without about 23.1kDa and band concentration, the results are shown in following table.
The expression situation of table 1.MT3 in two kinds of different expression vectors
| Sample type | pET28-MT3 | pET28-hFABP6-MT3 |
| Supernatant solution (accounting for total protein than row) | Not obvious | ≈20-22％ |
| In throw out | Not obvious | Not obvious |
Claims (9)
1. human metallothionein's fusion protein expression vector, is characterized in that: described human metallothionein's fusion protein expression vector is the polyclone district gained of the fusion protein expression vector encoding sequence of human metallothionein-3 being inserted companion's sample albumen as desired protein coding sequences; The encoding sequence of mankind's free-fat acid binding protein-6 is contained in the fusion protein expression vector upstream of described companion's sample albumen, and mankind's free-fat acid binding protein encoding sequence downstream comprises one section of flexible joint district and the polyclone district for inserting desired protein coding sequences.
2. human metallothionein's fusion protein expression vector according to claim 1, is characterized in that: described mankind's free-fat acid binding protein-6 is equal to or greater than 85% with the protein-bonded homology of the natural free fatty acids of the mankind; The encoding sequence of described mankind's free-fat acid binding protein-6 is the encoding sequence that codon is optimized.
3. human metallothionein's fusion protein expression vector according to claim 2, is characterized in that: the encoding sequence of described mankind's free-fat acid binding protein-6 is as shown in SEQIDNO.1.
4. human metallothionein's fusion protein expression vector according to claim 1, is characterized in that: described flexible joint district and polyclone district encoding sequence are as shown in SEQIDNO.3.
5. human metallothionein's fusion protein expression vector according to claim 1, is characterized in that: the homology of the aminoacid sequence of its aminoacid sequence of described human metallothionein-3 and mankind's native metal sulfoprotein is equal to or greater than 75%.
6. human metallothionein's fusion protein expression vector according to claim 5, is characterized in that: human metallothionein-3 aminoacid sequence is as shown in SEQIDNO.21.
7. human metallothionein's fusion protein expression vector according to claim 6, is characterized in that: human metallothionein-3 encoding sequence is as shown in SEQIDNO.20.
8. human metallothionein's fusion protein expression vector according to claim 1, is characterized in that: in described expression vector, the upstream of the encoding sequence of mankind's free-fat acid binding protein-6 also comprises the sequence of coding for separating of the label of purified fusion protein.
9. human metallothionein's fusion protein expression vector according to claim 8, is characterized in that: in described expression vector, the upstream of the encoding sequence of mankind's free-fat acid binding protein-6 also comprises the sequence of encoding histidine label.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510976740.3A CN105543262B (en) | 2015-12-22 | 2015-12-22 | A kind of -3 fusion protein expression vector of human metallothionein |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510976740.3A CN105543262B (en) | 2015-12-22 | 2015-12-22 | A kind of -3 fusion protein expression vector of human metallothionein |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105543262A true CN105543262A (en) | 2016-05-04 |
| CN105543262B CN105543262B (en) | 2018-11-23 |
Family
ID=55822820
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510976740.3A Active CN105543262B (en) | 2015-12-22 | 2015-12-22 | A kind of -3 fusion protein expression vector of human metallothionein |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105543262B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109529046A (en) * | 2018-11-09 | 2019-03-29 | 北京大学 | A kind of preparation and application of the self-assembled protein nano particle of targetted mitochondria |
| CN110484551A (en) * | 2019-07-29 | 2019-11-22 | 因之彩生物科技（武汉）有限公司 | Expression of Metallothionein carrier and its application |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1343789A (en) * | 2000-09-18 | 2002-04-10 | 中山大学 | Efficient prokaryotic expression carrier |
| CN101144093A (en) * | 2006-09-13 | 2008-03-19 | 广州暨南大学医药生物技术研究开发中心 | Recombination expression carrier and method for soluble expressing human I-type metallothionin |
| CN101849005A (en) * | 2007-11-05 | 2010-09-29 | 普罗梅加公司 | Hybrid fusion reporter and uses thereof |
-
2015
- 2015-12-22 CN CN201510976740.3A patent/CN105543262B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1343789A (en) * | 2000-09-18 | 2002-04-10 | 中山大学 | Efficient prokaryotic expression carrier |
| CN101144093A (en) * | 2006-09-13 | 2008-03-19 | 广州暨南大学医药生物技术研究开发中心 | Recombination expression carrier and method for soluble expressing human I-type metallothionin |
| CN101849005A (en) * | 2007-11-05 | 2010-09-29 | 普罗梅加公司 | Hybrid fusion reporter and uses thereof |
Non-Patent Citations (3)
| Title |
|---|
| NP_001436.1: "gastrotropin isoform 2[Homo sapiens]", 《GENBANK》 * |
| NP_005945.1: "metallothionein-3[Homo sapiens]", 《GENBANK》 * |
| 张桂春: "金属硫蛋白的功能及应用前景", 《烟台师范学院学报（自然科学版）》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109529046A (en) * | 2018-11-09 | 2019-03-29 | 北京大学 | A kind of preparation and application of the self-assembled protein nano particle of targetted mitochondria |
| CN109529046B (en) * | 2018-11-09 | 2020-10-27 | 北京大学 | Preparation and application of mitochondrion-targeted self-assembled protein nanoparticles |
| CN110484551A (en) * | 2019-07-29 | 2019-11-22 | 因之彩生物科技（武汉）有限公司 | Expression of Metallothionein carrier and its application |
| CN110484551B (en) * | 2019-07-29 | 2021-04-02 | 因之彩生物科技（武汉）有限公司 | Metallothionein expression vector and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105543262B (en) | 2018-11-23 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101899102A (en) | Method for separating high purity phycocyanin from spirulina | |
| CN105358694A (en) | Yeast promoters from pichia pastoris | |
| CN114349836B (en) | Mussel-like mucin with strong adhesion and preparation method thereof | |
| CN114292820B (en) | Insect-resistant protein Cry3Bb hybridoma cell strain, antibody produced by same and application thereof | |
| CN105543262A (en) | A human metallothionein-3 fusion protein expression vector | |
| CN105483150A (en) | Human metallothionein-2a fused protein expression vector | |
| CN105441472A (en) | Human metallothionein-4 fusion protein expression vector | |
| CN103146710A (en) | Yunnan red pear PybMYB gene as well as prokaryotic expression vector and application thereof | |
| CN108300728A (en) | A kind of bis- dissolutions expression sequence labels of TrxA and SUMO and application | |
| CN113604450B (en) | KOD DNA polymerase mutant and preparation method and application thereof | |
| CN105175554B (en) | One type elastin polypeptide and 90 alpha fusion protein of heat stress proteins and its preparation method and application | |
| CN105385704A (en) | Human metallothionein-1 fusion protein expression vector | |
| MX2023005386A (en) | Monoclonal antibodies directed against programmed death-1 protein and their use in medicine. | |
| JPS61501152A (en) | Human erythropoietin cDNA clone | |
| CN105624082B (en) | Functionalized bacterial magnetic particle for expressing single-chain antibody scFV or polypeptide aptamer and application thereof | |
| CN108003243A (en) | A kind of method of purifying protein | |
| CN111996195A (en) | Prokaryotic recombinant expression and purification method of procalcitonin mutant protein | |
| CN108300725A (en) | Soluble single-chain antibody super antigen fusion and albumen and its preparation and application | |
| CN107779464A (en) | A kind of preparation method of human source copper-zinc superoxide dismutase | |
| CN108864273B (en) | Simulated human-derived antibacterial peptide and preparation method thereof | |
| CN104195124B (en) | A kind of Cyanea capillata 3,4,3',4'-tetraketo-.beta.-carotene sample metalloproteases CALP1 and encoding gene thereof and expression | |
| CN108484770B (en) | Recombinant rat anti-mouse CD4 monoclonal antibody, preparation method and application | |
| CN105176897A (en) | Recombinant engineering strain expressing GnRH/M2 fusion polypeptide and construction and application thereof | |
| CN111235129A (en) | PPK2 protein and application thereof in polyacrylamide gel electrophoresis 30kd standard substance | |
| CN106916842B (en) | Expression method of saliva allergen FSA1 of potamogeton fetida flea |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20220126 Address after: 570100 collective household of Nansha community, room 1001, building a, Guosen Plaza, 64 Nansha Road, Longhua District, Haikou City, Hainan Province Patentee after: Sun Yuanye Address before: Floor 8, block B, Zhongdan Park, No. 3-1, xinjinhu Road, Pukou high tech Zone, Nanjing, Jiangsu 210032 Patentee before: PANGOGENE BIOSCIENCE Ltd. |