CN105543189A - Genetically engineered bacterium expressing microorganism cholesterol esterase and construction method thereof - Google Patents
Genetically engineered bacterium expressing microorganism cholesterol esterase and construction method thereof Download PDFInfo
- Publication number
- CN105543189A CN105543189A CN201610021070.4A CN201610021070A CN105543189A CN 105543189 A CN105543189 A CN 105543189A CN 201610021070 A CN201610021070 A CN 201610021070A CN 105543189 A CN105543189 A CN 105543189A
- Authority
- CN
- China
- Prior art keywords
- sequence
- esterase
- cholesterol esterase
- aminoacid sequence
- sterol esterase
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
- C12N9/18—Carboxylic ester hydrolases (3.1.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y301/00—Hydrolases acting on ester bonds (3.1)
- C12Y301/01—Carboxylic ester hydrolases (3.1.1)
- C12Y301/01013—Sterol esterase (3.1.1.13)
Abstract
The invention discloses a genetically engineered bacterium expressing microorganism cholesterol esterase and a construction method thereof, and belongs to the technical field of enzyme engineering. The method comprises the steps that Burkholderia cepacia. source cholesterol esterase and cholesterol esterase molecular chaperone genes are connected in series to achieve coexpression, wherein cholesterol esterase genes and the molecular chaperone genes are connected through a SD sequence. According to the method, the Burkholderia cepacia. source cholesterol esterase is successively expressed, and active expression and efficient expression of the Burkholderia cepacia. source cholesterol esterase are achieved. The cholesterol esterase activity in a crude enzyme solution fermented by the constructed genetically engineered bacterium can reach 640 U/L.
Description
Technical field
The present invention relates to a kind of genetic engineering bacterium and construction process thereof of expressing microorganism cholesterol esterase, belong to technical field of enzyme engineering.
Background technology
Sterol esterase is a kind of enzyme that catalysis cholesteryl ester is hydrolyzed into cholesterol and lipid acid.Research in recent years shows, the multiple disease of a lot of mankind, as cardiovascular and cerebrovascular diseases, liver and gall diseases, ephrosis, diabetes etc., all occurs abnormal relevant with the cholesterol metabolic of human body, thus, the content measuring total plasma cholesterol is own through becoming an important references index in clinical diagnosis.TC with regard to present stage detects, Sterol esterase is one of them key enzyme, it can detect the concentration of total cholesterol in serum fast and accurately, to be used as diagnosis such as arteriosclerotic lipid disorders disease, further, can be used for studying other many clinical relative diseases as diabetes, ephrosis etc.It is free cholesterol and lipid acid that Sterol esterase is first hydrolyzed cholesteryl ester, through cholesterol oxidation oxydasis, and the H produced
2o
2quinonimine is generated with 4-AA and phenol reactant.Quinonimine has specificabsorption at 500nm, and the colour intensity that reaction produces is directly proportional to cholesterol level, therefore can use the amount of colorimetric method for determining cholesterol.
In early days, Sterol esterase is mainly derived from the positions such as mammiferous pancreas, liver, kidney, intestinal mucosa, and it can help body to digest and assimilate oil substances.In recent years, successively also have the report of some production by biological Sterol esterases, the microorganism that such as can produce Sterol esterase has pseudomonas (Pseudomonasp.), Alcaligenes (Alcaligenesp.), fusarium (Fusariumsp.), streptomycete (Streptomycesp.) etc.It is generally acknowledged now that the cholesteryl ester enzyme spcificity of microbial source and stability are all better, induction can be carried out again and improve production of enzyme, purifying technique simply, therefore oneself common employing in test kit abroad.
Burkholderiacepacia. source Sterol esterase has unique zymologic property, has huge potential utility value.At present, the expression of Sterol esterase utilizes two kinds of compatible vehicle to carry out coexpression mostly, and namely two kinds of replicon differences carrier that thus can coexist in Host Strains carries out coexpression.But such compatible vehicle is not easy to obtain, because most commercialization coli expression carrier is ColE1/pMB1 replicon.And according to having been reported display, Burkholderiacepacia. the expression of source Sterol esterase must have the participation of molecular chaperones, just activated target protein can be detected, analyses and prediction may be that the folding assisted intermediate of molecular chaperones correctly folds, and the energy barrier reduced in this process, for it provides space multistory information, thus synthesis has active substance.In view of employing two kinds of carriers are expressed respectively, there is loaded down with trivial details, the multiple carrier of construction process and add the defects such as cellular metabolism burden, the present invention adopts the artificial SD of interpolation sequence to connect Sterol esterase gene and molecular chaperone carries out coexpression, and generation active substance detected.
Summary of the invention
In order to overcome the problems referred to above, the invention provides a kind of method and genetic engineering bacterium of expression microorganism cholesterol esterase newly.
First object of the present invention is to provide a kind of method expressing microorganism cholesterol esterase, described method is that Sterol esterase gene and Sterol esterase molecular chaperone are carried out series connection coexpression, wherein connected by SD sequence between Sterol esterase gene and molecular chaperone, namely directly after Sterol esterase gene end codon, add SD, to be then directly connected with the initiator codon of chaperone gene.
Described SD sequence is gatccataaggaggcaatctt (as shown in SEQIDNO.1).
In one embodiment of the invention, described microorganism cholesterol esterase is the Sterol esterase (cheS) in Burkholderiacepacia. source, and its aminoacid sequence is the sequence of GenBank:BAD13379.1 on NCBI.
In one embodiment of the invention, described Sterol esterase molecular chaperones is the Sterol esterase molecular chaperones (limS) in Burkholderiacepacia. source, and its aminoacid sequence is the sequence of GenBank:BAD13380.1 on NCBI.
In one embodiment of the invention, the nucleotide sequence of described series connection coexpression is the sequence shown in SEQIDNO.2.
In one embodiment of the invention, described method, be with pET28a (+) be carrier, intestinal bacteria are the expression that host carries out microorganism cholesterol esterase.
In one embodiment of the invention, described host is E.coliBL21 (DE3).
Second object of the present invention is to provide a kind of aminoacid sequence, and described aminoacid sequence is on the basis of cholesteryl ester enzyme amino acid sequence, increases SD sequence and Sterol esterase molecular chaperones aminoacid sequence successively.
In one embodiment of the invention, described cholesteryl ester enzyme amino acid sequence is as shown in GenBank:BAD13379.1 on NCBI; Described SD sequence is gatccataaggaggcaatctt (as shown in SEQIDNO.1); Described molecular chaperones aminoacid sequence is as shown in GenBank:BAD13380.1 on NCBI.
In one embodiment of the invention, described aminoacid sequence is coded by the nucleotide sequence such as shown in SEQIDNO.2.
3rd object of the present invention is to provide a kind of genetic engineering bacterium, described genetic engineering bacterium coexpression Sterol esterase and Sterol esterase molecular chaperones, and wherein Sterol esterase gene and molecular chaperone are by series connection coexpression; Described series connection coexpression is on the basis of cholesteryl ester enzyme amino acid sequence, increases SD sequence and Sterol esterase molecular chaperones aminoacid sequence successively.
In one embodiment of the invention, described series connection coexpression is the nucleotide sequence as shown in SEQIDNO.2 of expressing.
The present invention also provides the application of aforesaid method or genetic engineering bacterium, aminoacid sequence, is be applied to the fields such as food, medicine, weaving, papermaking.
Beneficial effect of the present invention:
The inventive method is by the basis of cholesteryl ester enzyme amino acid sequence, increase SD sequence (gatccataaggaggcaatctt) and Sterol esterase molecular chaperones aminoacid sequence successively, successfully have expressed the Sterol esterase in Burkholderiacepacia. source, and achieve activity expression, the high expression of the Sterol esterase in Burkholderiacepacia. source.The compatible vehicle that instant invention overcomes existing for compatible vehicle coexpression is not easy defects such as obtaining, construction process is loaded down with trivial details.Meanwhile, the present invention build engineering bacteria fermentation crude enzyme liquid in the work of Sterol esterase enzyme can reach 640U/L.
Accompanying drawing explanation
Fig. 1: the sepharose qualification photo of Sterol esterase and molecular chaperone purifying thereof;
The SDS-PAGE of Fig. 2: cheS abduction delivering and purifying identifies photo.
Embodiment
Embodiment 1: the structure of recombinant vectors and genetic engineering bacterium
(1) Sterol esterase cheS gene fragment, sequence such as GenBank accession number is AB175022.1 (Sterol esterase in Burkholderiacepacia. source).SD nucleotide sequencing is: gatccataaggaggcaatctt.Sterol esterase molecular chaperones limS gene fragment, sequence such as GenBank accession number is AB175022.1 (the Sterol esterase molecular chaperones in Burkholderiacepacia. source).
(2) the cal gene fragment of sequence shown in chemosynthesis SEQIDNO.2, or after the cheS gene of previous step, limS gene are optimized, carry out being connected the fragment obtaining sequence shown in SEQIDNO.2 with SD.
(3) with the fragment of sequence shown in SEQIDNO.2 for template, sequence carries out PCR as SEQIDNO.3 and SEQIDNO.4 is respectively upstream and downstream primer, digests PCR primer with quickcutDpn I, remove template plasmid.Obtain recombinant plasmid pET28a (+)-cal containing sequence shown in SEQIDNO.2.
(4) pET28a (+)-cal transformed obtain in E. coli BL21 (DE3), checking recombinant conversion, verify and correct be bacterial strain E.coli-cal, produce Sterol esterase and be CHE.
Embodiment 2: engineering bacteria fermentation produces enzyme
The preparation of crude enzyme liquid
The culture condition of seed liquor: adopt 250mL shake-flask culture, dress liquid is the LB substratum of 20%, and adds the 100mgmL of filtration sterilization in the medium
-1sulphuric acid kanamycin 50 μ L, gets single bacterium colony in substratum, 37 DEG C, 180rpm, incubated overnight.
Fermented liquid culture condition: adopt 500mL shake-flask culture, dress liquid is the fermention medium of 20%, MgSO wherein
47H
2o, glucose, glycerine is made into mother liquor respectively, independent sterilizing, and the used time adds corresponding amount, and adds filtration sterilization 100mgmL
-1sulphuric acid kanamycin 100 μ L, add the seed liquor of 5%, 37 DEG C, 200rpm, cultivate 8h, add the lactose-induced liquid of 20%, 28 DEG C, 200rpm, inducing culture 20h.
The collection of thalline and the acquisition of crude enzyme liquid: by centrifugal for fermented liquid 8000rpm 5min, claim to obtain weight in wet base, add 20mLpH7.0 by 1g wet thallus, the resuspended thalline of ratio of the potassium phosphate buffer of 0.11M, carries out ultrasonication, use procedure broken wall 4min, stop 1min, and blow and beat bacterium liquid, prevent the too high inactivation causing enzyme of Yin Wendu in broken wall process, the centrifugal 10min of 8000rpm after broken wall 30min, supernatant is crude enzyme liquid.After measured, the enzyme work of crude enzyme liquid is 640U/L.
Sterol esterase enzyme is lived and is defined: at 37 DEG C, per minute catalysis 1 μm of ol cholesteryl ester substrate conversion becomes the enzyme amount needed for product to be defined as 1 enzyme activity unit (U).
Wherein, the basic step of enzyme activity determination is first free cholesterol and lipid acid with cholesteryl ester enzymic hydrolysis cholesteryl ester, and cholesterol is oxidized to Δ by rCO again
4-cholestenone and H
20
2.The mensuration of terminal product can survey Δ
4-cholestenone and H
20
2.Now conventional Tninder Color Appearance System: peroxidase, 4-AA and phenol three are collectively referred to as (PAP) to detect H
20
2.Reaction generates red quinonimine dye, and measure under 500nm condition, the light absorption value of its gained and the cholesterol concentration in sample have a corresponding linear relationship, and the typical curve by obtaining in advance obtains corresponding total cholesterol concentration.
Concrete operations: add 2mL in colorimetric cylinder and detect liquid A (4-amino-quinizine, 1.5mmol/L; Phenol, 22mmol/L; Sodium azide, 0.2g/L; 0.33% (wt/vol) TritonX-100; Peroxidase, 5U/mL; RCO, 0.6U/mL; Potassium phosphate buffer, 0.11mol/L, pH7.0)+100uL enzyme liquid+1mL cholesteryl ester substrate (Virahol is solvent), after three kinds of component vibration mixings, 37 DEG C of water-bath 10min, use boiling water boiling 10min immediately, make enzyme deactivation, let cool in water and cool; 9000rpm, centrifugal 2min; Supernatant A500 place surveys light absorption value, and parallel laboratory test surveys three times, averages.Enzyme live typical curve mensuration see document (also old. rCO affinity purification and stability to β lactamase (D). Wuxi. Southern Yangtze University .2013).
The purifying of embodiment 3:CAL
Take agarose as matrix, 2-hydroxyl-1,3-propylene diamine connecting arm, 8-chlorine alloxazine is that the medium of part synthesis carries out affinity purification.
1. sample preparation: by loading crude enzyme liquid the conductivity adjustment of specific conductivity and 0.11M potassium phosphate buffer (pH7.0) to consistent.
2. fill post: 15mL plastics pillar is vertically fixed, and pillar lower end conduit is opened, load 3mL medium, staticly settle, ethanol in post is flowed out about to slightly exceeding medium interface.
3. balance: balance 10 column volumes with 0.11M potassium phosphate buffer (pH7.0).
4. loading: get 20mL crude enzyme liquid and be added in the affinity media balanced.
5. wash: wash 10 column volumes with 0.11M potassium phosphate buffer (pH7.0), wash away unconjugated albumen, then with containing 0.1molL
-1the potassium phosphate buffer (pH7.0) of NaCl washes away part with medium in conjunction with unstable foreign protein.
6. wash-out: to contain 0.5molL
-1the potassium phosphate buffer (pH7.0) of NaCl is elutriant, collects and measures molecular size range and the purity that cholesterol esterase activity SDS-PAGE detects albumen.Result as shown in Figure 2.
Although the present invention with preferred embodiment openly as above; but it is also not used to limit the present invention, any person skilled in the art, without departing from the spirit and scope of the present invention; all can do various changes and modification, what therefore protection scope of the present invention should define with claims is as the criterion.
Claims (10)
1. express a method for microorganism cholesterol esterase, it is characterized in that, described method is that Sterol esterase gene and Sterol esterase molecular chaperone are carried out series connection coexpression by artificial SD sequence of adding.
2. method according to claim 1, is characterized in that, described SD sequence is as shown in SEQIDNO.1.
3. method according to claim 1, is characterized in that, described microorganism cholesterol esterase is the Sterol esterase in Burkholderiacepacia. source; Described Sterol esterase molecular chaperones is the Sterol esterase molecular chaperones in Burkholderiacepacia. source.
4. method according to claim 1, is characterized in that, the nucleotide sequence expressed by described series connection coexpression is the sequence shown in SEQIDNO.2.
5. method according to claim 1, is characterized in that, described method, be with pET28a (+) be carrier, intestinal bacteria are the expression that host carries out microorganism cholesterol esterase.
6. an aminoacid sequence, described aminoacid sequence is on the basis of cholesteryl ester enzyme amino acid sequence, increases SD sequence and Sterol esterase molecular chaperones aminoacid sequence successively.
7. aminoacid sequence according to claim 6, is characterized in that, described cholesteryl ester enzyme amino acid sequence is as shown in GenBank:BAD13379.1 on NCBI; Described SD sequence is as shown in SEQIDNO.1; Described molecular chaperones aminoacid sequence is as shown in GenBank:BAD13380.1 on NCBI.
8. the nucleotide sequence of aminoacid sequence described in coding claim 6.
9. express carrier or the genetic engineering bacterium of aminoacid sequence described in claim 6.
10. aminoacid sequence described in method, claim 6 described in claim 1 or carrier according to claim 9, genetic engineering bacterium are in food, the application preparing the fields such as medicine, weaving, papermaking.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610021070.4A CN105543189B (en) | 2016-01-13 | 2016-01-13 | Genetically engineered bacterium for expressing microbial cholesterol esterase and construction method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610021070.4A CN105543189B (en) | 2016-01-13 | 2016-01-13 | Genetically engineered bacterium for expressing microbial cholesterol esterase and construction method thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105543189A true CN105543189A (en) | 2016-05-04 |
| CN105543189B CN105543189B (en) | 2020-02-07 |
Family
ID=55822747
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610021070.4A Active CN105543189B (en) | 2016-01-13 | 2016-01-13 | Genetically engineered bacterium for expressing microbial cholesterol esterase and construction method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105543189B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109971735A (en) * | 2019-04-03 | 2019-07-05 | 江南大学 | A kind of preparation method of cholesterol esterase |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2014008025A (en) * | 2012-06-29 | 2014-01-20 | Oriental Yeast Co Ltd | Method for solubilizing expression of cholesterol esterase |
| CN104232666A (en) * | 2014-09-01 | 2014-12-24 | 江苏海王生物制药有限公司 | Gene expressing recombinant exenatide and carrier thereof |
-
2016
- 2016-01-13 CN CN201610021070.4A patent/CN105543189B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2014008025A (en) * | 2012-06-29 | 2014-01-20 | Oriental Yeast Co Ltd | Method for solubilizing expression of cholesterol esterase |
| CN104232666A (en) * | 2014-09-01 | 2014-12-24 | 江苏海王生物制药有限公司 | Gene expressing recombinant exenatide and carrier thereof |
Non-Patent Citations (5)
| Title |
|---|
| STEEN J0RGENSEN ET AL: "Cloning, sequence, and expression of a lipase gene from Pseudomonas cepacia: lipase production in heterologous hosts requires two pseudomonas genes", 《JOURNAL OF BACTERIOLOGY》 * |
| TAKEDA Y ET AL: "Purification, characterization, and molecular cloning of organic-solvent-tolerant cholesterol esterase from cyclohexane-tolerant Burkholderia cepacia strain ST-200", 《EXTREMOPHILES》 * |
| 李红梅 等: "dhaBCE基因与yqhD基因串联表达载体的构建及其生物转化甘油", 《中国生物工程杂志》 * |
| 王晓花 等: "自洽聚类法识别大肠杆菌SD序列", 《内蒙古大学学报（自然科学版）》 * |
| 金明飞 等: "基因串联原核高效表达胸腺肽A1", 《中国生物工程杂志》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109971735A (en) * | 2019-04-03 | 2019-07-05 | 江南大学 | A kind of preparation method of cholesterol esterase |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105543189B (en) | 2020-02-07 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| O'Brien et al. | Insight into the mechanism of the B12-independent glycerol dehydratase from Clostridium butyricum: preliminary biochemical and structural characterization | |
| Norbeck et al. | Metabolic and regulatory changes associated with growth of Saccharomyces cerevisiae in 1.4 M NaCl: evidence for osmotic induction of glycerol dissimilation via the dihydroxyacetone pathway | |
| Kleff et al. | Identification of a Gene Encoding a Yeast Histone H4 Acetyltransferase (∗) | |
| Ulmer et al. | Characterization of glycosaminoglycan (GAG) sulfatases from the human gut symbiont Bacteroides thetaiotaomicron reveals the first GAG-specific bacterial endosulfatase | |
| Yano et al. | Expression and characterization of the 66-kilodalton (NQO3) iron-sulfur subunit of the proton-translocating NADH-quinone oxidoreductase of Paracoccus denitrificans | |
| Robbins et al. | Enzyme-mediated conversion of flavin adenine dinucleotide (FAD) to 8-formyl FAD in formate oxidase results in a modified cofactor with enhanced catalytic properties | |
| US20190136219A1 (en) | Genetically Engineered Arginine Deiminase Modified by Site-Directed Mutagenesis | |
| CN111662888B (en) | Diaphorase mutant with high thermal stability, gene and preparation method thereof | |
| CN112725319A (en) | Alginate lyase FaAly7 with polyG substrate specificity and application thereof | |
| Takano et al. | Structural studies of the proton-translocating NADH-quinone oxidoreductase (NDH-1) of Paracoccus denitrificans: identity, property, and stoichiometry of the peripheral subunits | |
| King et al. | Studies on the properties of highly purified cytochrome P-448 and its dependent activity benzo [a] pyrene hydroxylase, from Saccharomyces cerevisiae | |
| Kurki et al. | Mutagenesis of three conserved Glu residues in a bacterial homologue of the ND1 subunit of complex I affects ubiquinone reduction kinetics but not inhibition by dicyclohexylcarbodiimide | |
| Johansson et al. | Comparative sequence analysis and mutagenesis of ethylene forming enzyme (EFE) 2-oxoglutarate/Fe (II)-dependent dioxygenase homologs | |
| CN105543189A (en) | Genetically engineered bacterium expressing microorganism cholesterol esterase and construction method thereof | |
| CN102505023A (en) | Allos soluble expression method for aroF gene coded DAHP synthase of Actinosynenma pretiosum, as well as recombinant vector and gene expression engineering bacteria used in method | |
| Atta et al. | Heterologous biosynthesis and characterization of the [2Fe-2S]-containing N-terminal domain of Clostridium pasteurianum hydrogenase | |
| CN112225781B (en) | Method for expressing novel coronavirus N protein | |
| Whiting et al. | Metabolism of polysaccharides by the Streptococcus mutans dexB gene product | |
| CN104962534A (en) | Abyssal deposit-derived esterase EST22 as well as coding gene and application thereof | |
| Yang et al. | CmAim24 is essential for mitochondrial morphology, conidiogenesis, and mycoparasitism in Coniothyrium minitans | |
| WO2021083429A1 (en) | Codon-optimized glucose oxidase gene and application thereof | |
| CN111808836B (en) | Heat-resistant mutant enzyme of pullulanase I and preparation method and application thereof | |
| CN105274071B (en) | The cholesterol oxidation enzyme mutant and its application that a kind of substrate specificity improves | |
| Kasimova et al. | The Acinetobacter baumannii K70 and K9 capsular polysaccharides consist of related K-units linked by the same Wzy polymerase and cleaved by the same phage depolymerases | |
| CN105861456A (en) | Pyranose oxidase and expression and purification method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |