CN105524927A - Aptamer for hematopoietic stem cell separation and kit thereof - Google Patents
Aptamer for hematopoietic stem cell separation and kit thereof Download PDFInfo
- Publication number
- CN105524927A CN105524927A CN201610108499.7A CN201610108499A CN105524927A CN 105524927 A CN105524927 A CN 105524927A CN 201610108499 A CN201610108499 A CN 201610108499A CN 105524927 A CN105524927 A CN 105524927A
- Authority
- CN
- China
- Prior art keywords
- aptamer
- stem cell
- hematopoietic stem
- dna
- cell
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/115—Aptamers, i.e. nucleic acids binding a target molecule specifically and with high affinity without hybridising therewith ; Nucleic acids binding to non-nucleic acids, e.g. aptamers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/0634—Cells from the blood or the immune system
- C12N5/0647—Haematopoietic stem cells; Uncommitted or multipotent progenitors
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/16—Aptamers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2509/00—Methods for the dissociation of cells, e.g. specific use of enzymes
Abstract
The invention relates to an aptamer for hematopoietic stem cell separation and a kit thereof. The aptamer has strong combination characteristics and high stability. The aptamer is obtained by using a novel combinatorial chemistry technology SELEX, using hematopoietic stem cells as target objectives, and screening the DNA (Deoxyribonucleic Acid) aptamer capable of realizing specific binding with the hematopoietic stem cell from a random library. The invention also relates to the kit for separating hematopoietic stem cells. The kit can be used for fast separating the hematopoietic stem cells from blood, and has a very high application value.
Description
Technical field
The present invention relates to biological technical field, particularly a kind of aptamer for hemopoietic stem cell separation and test kit thereof.
Background technology
Hemopoietic stem cell refers to have self-renewal capacity and can be divided into various blood cell precursors cell, and the various blood cell composition of final generation, comprise red corpuscle, white corpuscle and thrombocyte, they also can be divided into other cell various.Near during the last ten years, along with to the function understanding of hemopoietic stem cell and deepening continuously of research, hematopoietic stem cell transplantation has become the effective ways for the treatment of hemopathy, malignant tumour, is also applied to some autoimmune disorder for the treatment of.
The places such as hemopoietic stem cell is mainly derived from peripheral blood hematopoietic stem cells, cord blood stem cell.But the content of hemopoietic stem cell is very low in normal human peripheral blood, CD34+ cell only accounts for peripheral blood mononuclear cell 0.01% ~ 0.1%, and existing method also cannot directly be separated and gather by trace hemopoietic stem cell in human peripheral blood.Therefore, realize the efficiently concentrating of hemopoietic stem cell in human peripheral blood, thus lay the foundation for inquiring into the effect of hemopoietic stem cell in disease treatment.Simultaneously, bleeding of the umbilicus isolation technique is the key link set up unbilical blood bank He carry out umbilical cord blood transplantation research, and it is directly connected to the stem cell rate of recovery after the frozen final volume of bleeding of the umbilicus sample, hematopoietic stem/progenitor separation rate, cryopreservation, the effective active of cell maintains and the success or failure of next step research.The object that bleeding of the umbilicus is separated mainly removes red corpuscle, thrombocyte and part blood plasma in bleeding of the umbilicus, collect the karyocyte (NC) being rich in bleeding of the umbilicus ancestral cells, making the concentrated and purifying of bleeding of the umbilicus by being separated, improving the concentration of bleeding of the umbilicus ancestral cells, with the needs of satisfied research and preservation.Current bleeding of the umbilicus isolation technique comprises hydroxyethylamyle (HES) precipitator method, Percoll solution density gradient centrifugation, monoclonal antibody add flow cytometry analysis, immunological magnetic bead sorting method or chloride leach method etc.Think after the separating effect to different bleeding of the umbilicus separation methods such as lymphocyte liquid (Ficoll) separation, density gradient centrifugation separation, NH4C1 dissolution method, methylcellulose gum method, gelatin partition method, hydroxyethylamyle (HES) settling process such as Denning-Kendall carries out detailed analysis and comparison, the separating effect of 3% gelatin sedimentation method is best, the rate of recovery of its CD34+ cell and colony (CFU-C) rate of recovery the highest, reach 86% and 92% respectively.Dissolution method is taken second place, but its final volume is comparatively large, and thus actual application value is little.Ficoll and Percoll density gradient centrifugation, although application is comparatively extensive, it is higher and expense is relatively expensive to the requirement of technology.And Ficoll method single divides still that bleeding of the umbilicus amount is less, when point sample that still blood volume is many, the still core barrel number of use is many, and workload is large, is easy to pollute, is therefore not suitable for the separation of bleeding of the umbilicus in enormous quantities.
Immunity magnetic separation technique is one of important component part of peripheral blood cells fast separating concentration technology, this technology can efficient capture, target cell in concentrated human peripheral sample, improve target cell detection sensitivity.In recent years, antibody is connected on magnetic bead by the immunomagnetic separation (ms) based on magnetic micro-beads, then the magnetic bead being connected with antibody is dropped in sample liquid target cell is caught, enrichment, Magneto separate.But, many limitation should be there is based on the isolation technique of micron order immunomagnetic beads at present: 1) specific surface area of micron magnetic bead is relatively little, reduces magnetic capture efficiency; 2) due to the particle properties of micron magnetic bead self, combined by heterogeneous reaction (multiphasereaction) between itself and cell, usually need the time more grown to go specificity to catch cell in food substrate; 3) micron magnetic bead monodispersity is poor, self assemble easily occurs in the heme of periphery or forms precipitation; 4) traditional immune magnetic separation technique, often antibody is directly coupled on immunomagnetic beads, this process usually can cause the activity of antibody to reduce widely and cause the direction in space of antibody to change the space steric effect increased between antibody, thus reduce the capture rate 5 of antibody) blood viscosity is high and hematocrite concentration that is wherein non-hematopoietic stem cell is large, micron magnetic bead easily produces non-specific adsorption, is difficult to realize hemopoietic stem cell specific isolation in blood; 6) excessive concentration of micron magnetic bead can cause the breakage of hemopoietic stem cell (magnetic field causes cell surface magnetic bead to be attracted each other, and cell is squeezed and even breaks), causes the failure be separated; 7), during magnetic bead coupled antibody, activated for tool antibody is connected in magnetic bead surfaces by general hydrophobic adsorbent or the chemical coupling mode of adopting.Too closely, the hydrophobic or strong hydrophilicity group of magnetic bead nature and remained on surface thereof easily causes antibody space conformation to change, and causes antibody bioactive to decline for antibody and magnetic bead surfaces distance.
But be no matter immune magnetic separation technique or hydroxyethylamyle (HES) precipitator method, Percoll solution density gradient centrifugation, monoclonal antibody add the methods such as flow cytometry analysis, immunological magnetic bead sorting method or chloride leach method, all there is separate mode complexity, cost is high, shortcoming of long duration.
SELEX technology is a kind of new combinatorial chemistry technique grown up early 1990s.Utilize this technology can screen specificity and the affine aptamer of target material height from random single chain oligonucleotide library.Its basic ideas are that iii vitro chemical synthesizes a single stranded oligonucleotide storehouse, mix with target material, form target material-nucleic acid complexes, the unconjugated nucleic acid of wash-out, be separated the nucleic acid molecule be combined with target material, and with this nucleic acid molecule for template carries out pcr amplification, then enter the screening of lower whorl.By screening and the amplification of repetition, some be not combined with target material or have low-affinity with target material, the nucleic acid molecule of middle avidity washed away, and have the nucleic acid molecule of strong avidity from very large with dividing still out hangar with leather G material, and purity carrying out and increase with SELEX process, finally occupy the great majority (about >90%) in storehouse.After first Tuerk and Ellington etc. use this technology screening to the specific nucleic acid aptamers of specific adsorption phage T4DNA polysaccharase and organic dye molecule, through the development of more than ten years, SELEX technology has become a kind of and important has ground the means of making internal disorder or usurp and instrument.Therefore, adopt selex technology, the aptamers of screening specific binding hematopoietic stem cells has the meaning of outbalance.
Summary of the invention
Technical scheme of the present invention is realized by following steps:
The object of this invention is to provide a kind of nucleic acid aptamer sequence of hemopoietic stem cell.
In the present invention, the aptamer (sequence 1-25) of described hemopoietic stem cell can specific combination hemopoietic stem cell.
In the present invention, described hemopoietic stem cell is selected from human peripheral hemopoietic stem cell.
Further object of the present invention is to provide the purposes of described nucleic acid aptamer sequence.According to applying this sequence in the present invention, the test kit preparing specific isolation human hematopoietic stem cell can be further used for.
From the random oligo DNA library of external synthesis, 5 '-TCCCTCAAAGCGCACTATTA (N35) ATCATGGACGTGCTAATGAT-3 '.In filter out the aptamer with hemopoietic stem cell specific combination; By the sequence primers F (5 filtered out,-FAM-tccctcaaagcgcactatta-3,) and R (5,-biotin-atcattagcacgtccatgat-3 ') carrying out increasing and carrying out TA is cloned into pMD19-T carrier (winning photo bio company purchased from Shanghai), transforms DH5a bacterium (purchased from Beijing Tian Gen biotech firm); Choosing white colony carries out after PCR determines positive colony, extracting plasmid sequencing reaction, upper sequencer.
The present invention adopts in-vitro screening (SELEX) technology of aptamer, with human peripheral hemopoietic stem cell for just to sieve target, be the anti-target that sieves with HRBC, the aptamer of screening and hemopoietic stem cell specific combination, the obtained sequence with specific combination hemopoietic stem cell, called after aptamers ZXST1-ZXST25 in the present invention.Sequence is as follows:
ZXST1：TCCCTCAAAGCGCACTATTATCCCTACCTTATAATCACCTTCCCTCACATTACAAATCATGGACGTGCTAATGAT
ZXST2：TCCCTCAAAGCGCACTATTACCTCTTCCTTTTTTCACATATTCCAAACAAAAACCATCATGGACGTGCTAATGAT
ZXST3：TCCCTCAAAGCGCACTATTATACACTAAAAAATTTCCTCCCACCCCCAATTCAACATCATGGACGTGCTAATGAT
ZXST4：TCCCTCAAAGCGCACTATTAACATAAATAACAAATCCTCCCACACACCCACTTATATCATGGACGTGCTAATGAT
ZXST5：TCCCTCAAAGCGCACTATTATAACCCAAACAACTCAAATAATCACTTTACAAAAAATCATGGACGTGCTAATGAT
ZXST6：TCCCTCAAAGCGCACTATTATATCATTAATCATACAATATATTATTCCCCTACATATCATGGACGTGCTAATGAT
ZXST7：TCCCTCAAAGCGCACTATTATTATTACATCCTAATTACATCCATCTCCCAAAAATATCATGGACGTGCTAATGAT
ZXST8：TCCCTCAAAGCGCACTATTATCCCTCTCACCTACCCCTATCTCTACTACCCTCTCATCATGGACGTGCTAATGAT
ZXST9：TCCCTCAAAGCGCACTATTAAATCTACATCCTCTTAATATTACCCTCCCCAAATTATCATGGACGTGCTAATGAT
ZXST10：TCCCTCAAAGCGCACTATTAAAAACACCCATCCCTACTCAATTAATACTAATACCATCATGGACGTGCTAATGAT
ZXST11：TCCCTCAAAGCGCACTATTAACCAACAATACCACCACAATCTAAAACTCTTCTTTATCATGGACGTGCTAATGAT
ZXST12：TCCCTCAAAGCGCACTATTACTATACCCTTCCTCTACTTACCTCTCCATCTCCCCATCATGGACGTGCTAATGAT
ZXST13：TCCCTCAAAGCGCACTATTATTACCACTTCTATCATACCATATACATAAAAACTAATCATGGACGTGCTAATGAT
ZXST14：TCCCTCAAAGCGCACTATTATACACCCCAACACCCCTAATATTATATCCCTTCTTATCATGGACGTGCTAATGAT
ZXST15：TCCCTCAAAGCGCACTATTATAATCAACCAATCTTCCTTTTACTAATACATTTTAATCATGGACGTGCTAATGAT
ZXST16：TCCCTCAAAGCGCACTATTAATAATACCATAATTCATTTCATTAACATTCCACATATCATGGACGTGCTAATGAT
ZXST17：TCCCTCAAAGCGCACTATTACCTTTCACATATCCCCACTTCCTTTATTTCTTCTCATCATGGACGTGCTAATGAT
ZXST18：TCCCTCAAAGCGCACTATTATACCACATACCATACACCCCTTTACTAATCCACTTATCATGGACGTGCTAATGAT
ZXST19：TCCCTCAAAGCGCACTATTACCTACCAATCATCCCACATCAAAATACCAAAACTTATCATGGACGTGCTAATGAT
ZXST20：TCCCTCAAAGCGCACTATTACCTCACCACTATACTTAATTTCACAACAAATCTAAATCATGGACGTGCTAATGAT
ZXST21：TCCCTCAAAGCGCACTATTACATCATCTTATCATAAACTTTACATACCAAACATAATCATGGACGTGCTAATGAT
ZXST22：TCCCTCAAAGCGCACTATTATTTCTTTTAATAAACAATACCTCCCATCCCTCTCCATCATGGACGTGCTAATGAT
ZXST23：TCCCTCAAAGCGCACTATTACCCTCTTTATTCCTTTACACCTACCCTTCCACTCCATCATGGACGTGCTAATGAT
ZXST24：TCCCTCAAAGCGCACTATTAATATCTCAACTCTATCCACTCTCTCAACTCTAACTATCATGGACGTGCTAATGAT
ZXST25：TCCCTCAAAGCGCACTATTAACTATTATCATTTACACCCCACAAAATCTTACTCCATCATGGACGTGCTAATGAT
Aptamer of the present invention may be used for building test kit, and this test kit may be used for specific isolating hematopoietic stem cells, and have separating effect fast, efficiency is high, saves time, cost-saving effect.There is extremely strong using value.
Beneficial effect of the present invention: (1) obtain a kind of can the aptamer of differential high efficient binding hematopoietic stem cells.This aptamer can manually be prepared in a large number, and method is simple, with low cost.(2) test kit becoming specificity screening and enrichment hemopoietic stem cell can be prepared based on nucleic acid aptamer.
Embodiment
Embodiment 1: aptamer screens
First run oligo DNA library sequence: 5 '-TCCCTCAAAGCGCACTATTA (N35) ATCATGGACGTGCTAATGAT-3 '.
Enrichment the primer:
F：5，-FAM-tccctcaaagcgcactatta-3
R：5，-biotin-atcattagcacgtccatgat-3
After oligo DNA library is measured OD260, centrifugal drying; Dissolve library with 300ul binding buffer liquid (containing 4.5g/L glucose in PBS, 5mMMgCl2,2mg/mLBSA, 0.2mg/mL yeast tRNA), get 250pmol (first round I0nmol), 95 DEG C of 5min, put rapidly on ice, centrifugal fast after a while.
Anti-sieve: the library of 250pmol is sucked growth coverage and reach in the HRBC diameter 6cm culture dish of 82%, supply ImL with binding buffer liquid; 4 DEG C of shaking table vibrations I.2h; Get supernatant liquor.
Just sieve: the anti-supernatant liquor that sieves is added peripheral blood hematopoietic stem cells growth coverage and reaches in the diameter 6cm culture dish of 85%, 4 DEG C of shaking tables vibration Ih; Abandon supernatant liquor; Peripheral blood hematopoietic stem cells cell is washed three times with lavation buffer solution (containing 4.5g/L glucose in PBS, 5mMMgC12); Scrape peripheral blood hematopoietic stem cells with cell, transfer in EP pipe with ImL lavation buffer solution by peripheral blood hematopoietic stem cells, 95 DEG C of 5min, put rapidly on ice.After turning cold, the centrifugal 5min of 10000rpm; Supernatant is transferred in a clean EP pipe.
Enrichment: configuration PCR system (cumulative volume 1000ul): H20740ul, 10XPCR damping fluid I00ul, dNTP80ul, primer mixture 25ul (F:I00uM, I00uM), DNA profiling (just sieving supernatant) 50ul, TaqHS enzyme 5ul.
Increase in PCR instrument by following condition: after 94 DEG C of heating denaturation 2min, 94 DEG C of sex change 30s, 58 DEG C of annealing 20s, 72.。Extend 20s, 20 circulations, 72 DEG C extend 4min, 4 DEG C of insulation <lh.
Purifying: purification column MilliQ washes one time, PBS washes twice, and after adding the StreptavidinSepharose of 150ulGE, PBS washes twice, adds PCR primer, shaking table vibration 20min, release liquid, after PBS washes twice, add after 0.5mLNaOH leaves standstill 2-3min and release liquid, desalting column on relief liquor, when liquid almost flows to end from desalting column, add ImLMilliQ water elution, start to meet elutriant lmL simultaneously, this elutriant is the oligo DNA library be enriched.The oligo DNA library be enriched is carried out conventional TA clone, then carry out bacterium colony PCR and order-checking.Sequencing result is for shown in SEQIDNO:1-25.
Embodiment 2 is affine performance verification
Get target cell hemopoietic stem cell respectively with different concns 0,25nM, 50nM, 100nM, 150nM, 200nM, 250nM, 300nM, 500nM, 800nM, 1000nM) aptamer ZXST1-25 hatch 20min, flow cytometry tests is carried out after washing, found that, along with the increase of aptamer concentration, it is stronger to the bonding force of target cell, and final combination is tending towards saturated.When aptamer and Cell binding rate reach 50%, the concentration of now required aptamer is exactly its equilibrium dissociation constant Kd, and we can obtain aptamer and distinguish as follows with the force constant of linkage of cell separately thus:
Aptamer specificity analyses described in embodiment 3
The aptamer ZXST1-25 that the FITC of 50nM is marked respectively with target cell hemopoietic stem cell or anti-sieve cell red corpuscle and mouth epithelial cells in conjunction with 20min, washing, Laser Scanning Confocal Microscope experiment is carried out after the paraformaldehyde of 4% is fixing, found that, for hemopoietic stem cell, aptamer ZXST1-25 all can well and its combination, and fluorescence clearly can be seen on cytolemma, and for red corpuscle and mouth epithelial cells, aptamer ZXST1-ZXST25 all less than significantly with its combination, so we can't see fluorescence substantially in fluorescence field.
Draw to draw a conclusion by above-mentioned experiment: adaptor sequence of the present invention all can well be combined with target cell, and targeting is also fine.
The analysis of embodiment 4 degrading activity
By described aptamer, get 0.2ug, be placed in the serum of normal temperature, the aqueous solution respectively, place surrounding.Detected by RT-PCR, find its Stability Analysis of Structures of placement of two weeks, be not degraded.Illustrate that aptamer of the present invention has satisfactory stability.
Embodiment 5 analysis of cells is tested
By aptamer of the present invention coupled bead respectively, join in sterile centrifugation tube by aseptic for healthy volunteer EDTA anticoagulation cirumferential blood sample, get 1mL peripheral blood through Flow cytometry hemopoietic stem cell number wherein, its quantity is 5.8 × 10
3.Coupling there is the aptamer of magnetic bead to mix with the peripheral blood of equivalent respectively and hatch 20 minutes, then Magneto separate, the corresponding cell be separated can be obtained, by calculating, obtain corresponding separation efficiency following (with the separation method of claim 1 in CN103289954B in contrast, blood sample is consistent).
Above-described embodiment is the present invention's preferably embodiment; but embodiments of the present invention are not restricted to the described embodiments; change, the modification done under other any does not deviate from spirit of the present invention and principle, substitute, combine, simplify; all should be the substitute mode of equivalence, be included within protection scope of the present invention.
Sequence table
< 110 > Wang Xiao is bright
The aptamer that < 120 > mono-kind is separated for hemopoietic stem cell and test kit thereof
〈210〉1
〈211〉75
〈212〉DNA
< 213 > artificial sequence
〈400〉ZXST1
TCCCTCAAAGCGCACTATTATCCCTACCTTATAATCACCTTCCCTCACATTACAAATCATGGACGTGCTAATGAT
〈210〉2
〈211〉75
〈212〉DNA
< 213 > artificial sequence
〈400〉ZXST2
TCCCTCAAAGCGCACTATTACCTCTTCCTTTTTTCACATATTCCAAACAAAAACCATCATGGACGTGCTAATGAT
〈210〉3
〈211〉75
〈212〉DNA
< 213 > artificial sequence
〈400〉ZXST3
TCCCTCAAAGCGCACTATTATACACTAAAAAATTTCCTCCCACCCCCAATTCAACATCATGGACGTGCTAATGAT
〈210〉4
〈211〉75
〈212〉DNA
< 213 > artificial sequence
〈400〉ZXST4
TCCCTCAAAGCGCACTATTAACATAAATAACAAATCCTCCCACACACCCACTTATATCATGGACGTGCTAATGAT
〈210〉5
〈211〉75
〈212〉DNA
< 213 > artificial sequence
〈400〉ZXST5
TCCCTCAAAGCGCACTATTATAACCCAAACAACTCAAATAATCACTTTACAAAAAATCATGGACGTGCTAATGAT
〈210〉6
〈211〉75
〈212〉DNA
< 213 > artificial sequence
〈400〉ZXST6
TCCCTCAAAGCGCACTATTATATCATTAATCATACAATATATTATTCCCCTACATATCATGGACGTGCTAATGAT
〈210〉7
〈211〉75
〈212〉DNA
< 213 > artificial sequence
〈400〉ZXST7
TCCCTCAAAGCGCACTATTATTATTACATCCTAATTACATCCATCTCCCAAAAATATCATGGACGTGCTAATGAT
〈210〉8
〈211〉75
〈212〉DNA
< 213 > artificial sequence
〈400〉ZXST8
TCCCTCAAAGCGCACTATTATCCCTCTCACCTACCCCTATCTCTACTACCCTCTCATCATGGACGTGCTAATGAT
〈210〉9
〈211〉75
〈212〉DNA
< 213 > artificial sequence
〈400〉ZXST9
TCCCTCAAAGCGCACTATTAAATCTACATCCTCTTAATATTACCCTCCCCAAATTATCATGGACGTGCTAATGAT
〈210〉10
〈211〉75
〈212〉DNA
< 213 > artificial sequence
〈400〉ZXST10
TCCCTCAAAGCGCACTATTAAAAACACCCATCCCTACTCAATTAATACTAATACCATCATGGACGTGCTAATGAT
〈210〉11
〈211〉75
〈212〉DNA
< 213 > artificial sequence
〈400〉ZXST11
TCCCTCAAAGCGCACTATTAACCAACAATACCACCACAATCTAAAACTCTTCTTTATCATGGACGTGCTAATGAT
〈210〉12
〈211〉75
〈212〉DNA
< 213 > artificial sequence
〈400〉ZXST12
TCCCTCAAAGCGCACTATTACTATACCCTTCCTCTACTTACCTCTCCATCTCCCCATCATGGACGTGCTAATGAT
〈210〉13
〈211〉75
〈212〉DNA
< 213 > artificial sequence
〈400〉ZXST13
TCCCTCAAAGCGCACTATTATTACCACTTCTATCATACCATATACATAAAAACTAATCATGGACGTGCTAATGAT
〈210〉14
〈211〉75
〈212〉DNA
< 213 > artificial sequence
〈400〉ZXST14
TCCCTCAAAGCGCACTATTATACACCCCAACACCCCTAATATTATATCCCTTCTTATCATGGACGTGCTAATGAT
〈210〉15
〈211〉75
〈212〉DNA
< 213 > artificial sequence
〈400〉ZXST15
TCCCTCAAAGCGCACTATTATAATCAACCAATCTTCCTTTTACTAATACATTTTAATCATGGACGTGCTAATGAT
〈210〉16
〈211〉75
〈212〉DNA
< 213 > artificial sequence
〈400〉ZXST16
TCCCTCAAAGCGCACTATTAATAATACCATAATTCATTTCATTAACATTCCACATATCATGGACGTGCTAATGAT
〈210〉17
〈211〉75
〈212〉DNA
< 213 > artificial sequence
〈400〉ZXST17
TCCCTCAAAGCGCACTATTACCTTTCACATATCCCCACTTCCTTTATTTCTTCTCATCATGGACGTGCTAATGAT
〈210〉18
〈211〉75
〈212〉DNA
< 213 > artificial sequence
〈400〉ZXST18
TCCCTCAAAGCGCACTATTATACCACATACCATACACCCCTTTACTAATCCACTTATCATGGACGTGCTAATGAT
〈210〉19
〈211〉75
〈212〉DNA
< 213 > artificial sequence
〈400〉ZXST19
TCCCTCAAAGCGCACTATTACCTACCAATCATCCCACATCAAAATACCAAAACTTATCATGGACGTGCTAATGAT
〈210〉20
〈211〉75
〈212〉DNA
< 213 > artificial sequence
〈400〉ZXST20
TCCCTCAAAGCGCACTATTACCTCACCACTATACTTAATTTCACAACAAATCTAAATCATGGACGTGCTAATGAT
〈210〉21
〈211〉75
〈212〉DNA
< 213 > artificial sequence
〈400〉ZXST21
TCCCTCAAAGCGCACTATTACATCATCTTATCATAAACTTTACATACCAAACATAATCATGGACGTGCTAATGAT
〈210〉22
〈211〉75
〈212〉DNA
< 213 > artificial sequence
〈400〉ZXST22
TCCCTCAAAGCGCACTATTATTTCTTTTAATAAACAATACCTCCCATCCCTCTCCATCATGGACGTGCTAATGAT
〈210〉23
〈211〉75
〈212〉DNA
< 213 > artificial sequence
〈400〉ZXST23
TCCCTCAAAGCGCACTATTACCCTCTTTATTCCTTTACACCTACCCTTCCACTCCATCATGGACGTGCTAATGAT
〈210〉24
〈211〉75
〈212〉DNA
< 213 > artificial sequence
〈400〉ZXST24
TCCCTCAAAGCGCACTATTAATATCTCAACTCTATCCACTCTCTCAACTCTAACTATCATGGACGTGCTAATGAT
〈210〉25
〈211〉75
〈212〉DNA
< 213 > artificial sequence
〈400〉ZXST25
TCCCTCAAAGCGCACTATTAACTATTATCATTTACACCCCACAAAATCTTACTCCATCATGGACGTGCTAATGAT
Claims (5)
1. a specific binding hemopoietic stem cell is fit, it is characterized in that for comprising shown in SEQIDNo.1-25 arbitrary sequence, or the replacement of one or several Nucleotide carried out on the basis of this sequence, and retains its activity.
2. the fit application at screening hemopoietic stem cell shown in claim 1.
3. the fit test kit for the preparation of isolating hematopoietic stem cells shown in claim 1 is applied.
4. the fit test kit application for the preparation of screening hemopoietic stem cell shown in claim 1.
5. the application as described in any one of claim 2-4, is characterized in that: described hemopoietic stem cell is peripheral blood hematopoietic stem cells.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610108499.7A CN105524927A (en) | 2016-02-28 | 2016-02-28 | Aptamer for hematopoietic stem cell separation and kit thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610108499.7A CN105524927A (en) | 2016-02-28 | 2016-02-28 | Aptamer for hematopoietic stem cell separation and kit thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN105524927A true CN105524927A (en) | 2016-04-27 |
Family
ID=55767455
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610108499.7A Pending CN105524927A (en) | 2016-02-28 | 2016-02-28 | Aptamer for hematopoietic stem cell separation and kit thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105524927A (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101144814A (en) * | 2007-10-22 | 2008-03-19 | 中国人民解放军第三军医大学第一附属医院 | Method for detecting, identifying and/ or quantifying compound using adapter type reagent |
| CN104837492A (en) * | 2012-12-07 | 2015-08-12 | 糖模拟物有限公司 | Compounds, compositions and methods using E-selectin antagonists for mobilization of hematopoietic cells |
| CN104830867A (en) * | 2015-06-07 | 2015-08-12 | 杨洋 | Aptamer capable of being specifically combined with DKK1 protein in cancer cells |
-
2016
- 2016-02-28 CN CN201610108499.7A patent/CN105524927A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101144814A (en) * | 2007-10-22 | 2008-03-19 | 中国人民解放军第三军医大学第一附属医院 | Method for detecting, identifying and/ or quantifying compound using adapter type reagent |
| CN104837492A (en) * | 2012-12-07 | 2015-08-12 | 糖模拟物有限公司 | Compounds, compositions and methods using E-selectin antagonists for mobilization of hematopoietic cells |
| CN104830867A (en) * | 2015-06-07 | 2015-08-12 | 杨洋 | Aptamer capable of being specifically combined with DKK1 protein in cancer cells |
Non-Patent Citations (3)
| Title |
|---|
| 丁为民等: "核素干细胞活体示踪", 《核技术》 * |
| 李慧等: "以完整细胞为靶子的SELEX技术研究进展", 《生物技术通讯》 * |
| 赵仲麟等: "Cell-SELEX技术研究进展", 《生物技术通报》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106940268B (en) | Chromatographic separation of cells and other complex biological materials | |
| JP6126619B2 (en) | Cell separation method | |
| Dainiak et al. | Methods in cell separations | |
| US8263404B2 (en) | Method for enriching rare cell subpopulations from blood | |
| CN105734043B (en) | Multi-sort cell separation method | |
| Wu et al. | A PLGA nanofiber microfluidic device for highly efficient isolation and release of different phenotypic circulating tumor cells based on dual aptamers | |
| US10758573B2 (en) | Compositions and methods for enrichment of cells | |
| CN112011434B (en) | Red blood cell bionic coating for enriching circulating tumor cells | |
| WO2011069117A1 (en) | Method of isolation of stem cell populations from peripheral blood using sized-based separation (elutriation) | |
| ES2897945T3 (en) | Procedure for the generation, identification and isolation of human pluripotent stem cell-derived cardiomyocytes and cardiomyocyte subpopulations | |
| CN101880650A (en) | Composition and kit for rapid extraction of circulating unrelated nucleated cell from peripheral blood and application thereof | |
| CN105755005A (en) | Aptamer for osteosarcoma detection and kit for osteosarcoma detection | |
| CN101144070A (en) | Marrow umbilical cord blood stem cell in vitro separating kit and application method thereof | |
| CN104762262A (en) | Volume centrifugal separation method of umbilical cord blood stem cells | |
| CN101469321A (en) | Method for rapidly filtering and screening medulla ossium substrate stem cell | |
| CN105524927A (en) | Aptamer for hematopoietic stem cell separation and kit thereof | |
| CN115925965A (en) | Nucleated cell treatment kit and application thereof | |
| CN112159790A (en) | Method for purifying pluripotent vascular progenitor cells from perinatal tissue | |
| CN102229910B (en) | Method for sorting human marrow very small embryonic-like stem cells | |
| JP7413692B2 (en) | Pretreatment method for samples containing cells | |
| JP6517190B2 (en) | Method for producing human hematopoietic stem cell enriched fraction | |
| CN106834227B (en) | In vitro purification method of natural killer cells | |
| KR101637895B1 (en) | The specific binding molecules-nanofibers complex for B cells separation and separation method therefor | |
| Jazayeri et al. | Capillary network formation by endothelial cells differentiated from human bone marrow mesenchymal stem cells | |
| US20100081121A1 (en) | Media and method for cell separation |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20160427 |
|
| RJ01 | Rejection of invention patent application after publication |