CN105505882A - Reconstituted cells and application thereof to preparation of therapeutic drug resisting human epidermal growth factor receptors - Google Patents
Reconstituted cells and application thereof to preparation of therapeutic drug resisting human epidermal growth factor receptors Download PDFInfo
- Publication number
- CN105505882A CN105505882A CN201610021187.2A CN201610021187A CN105505882A CN 105505882 A CN105505882 A CN 105505882A CN 201610021187 A CN201610021187 A CN 201610021187A CN 105505882 A CN105505882 A CN 105505882A
- Authority
- CN
- China
- Prior art keywords
- cell
- sequence
- cho
- egfr
- dna molecular
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/32—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against translation products of oncogenes
Abstract
The invention discloses reconstituted cells and application thereof to preparation of a therapeutic drug resisting human epidermal growth factor receptors. The reconstituted cells CHO-K1-EGFR-7gRNA are obtained by substituting DNA molecules shown as the sequence 6 in a sequence table of genomes of CHO-K1-EGFR cells with DNA molecules shown as the sequence 7 in the sequence table. A preparation method of the CHO-K1-EGFR cells comprises the steps that products A and products B are jointly guided into CHO-K1 cells; the products A are (a): DNA molecules A or (b) recombinant expression vectors A containing the DNA molecules A; the DNA molecules A are DNA molecules of the light chain L4 shown as the sequence 1 in the coded sequence table; the products B are (c) DNA molecules B or (d) recombinant expression vectors B containing the DNA molecules B; the DNA molecules B are DNA molecules of the heavy chain H3 shown as the sequence 3 in the coded sequence table. The reconstituted cells have significant application value for treatment of cancers.
Description
Technical field
The present invention relates to a strain reconstitution cell and the application in the anti-human EGF-R ELISA medicine of preparation thereof.
Background technology
In recent years, therapeutic antibodies application is clinically more and more extensive.2000-2010, antibody drug portion in global bio-pharmaceuticals is expanded to 56.41% from 10.5%, estimates that global antibody drug market scale in 2015 is expected to reach 68,000,000,000 dollars.The therapeutic antibodies that antibody constant region lacks core fucosylation is in clinical study at present, they in vitro and in vivo can enhancing antibody dependent cell mediation cytotoxicity (antibodydependentcellularcytotoxicity, ADCC), this physiologically active causes people's extensive concern, and one of focus becoming this type of drug research.
In recent years there is several genes group editing technique, mainly contain: zinc fat nuclease technology (zincfingernuclease, ZFNs), the CRISPR-Cas9 nuclease system that leads of transcriptional activation sample effect nuclease technology (transcriptionactivator-likeeffectornucleases, TALEN) and RNA.CRISPR-Cas9 nuclease system is discovered in recent years and is widely used in a kind of technology of gene of eucaryote cell group editor.This technology utilizes Cas9 to cut target sequence and forms double-strand break (DSB), subsequently by non-homologous end joining (NHEJ) or with source orientation reparation (HDR) and then the object that reaches target-gene sequence editor.
Summary of the invention
The object of this invention is to provide a strain reconstitution cell and the application in the anti-human EGF-R ELISA medicine of preparation thereof.
First the present invention protects a strain reconstitution cell, i.e. reconstitution cell CHO-K1-EGFR-7gRNA.Reconstitution cell CHO-K1-EGFR-7gRNA is the reconstitution cell that the DNA molecular shown in sequence 7 DNA molecular shown in the sequence 6 of sequence table in the genome of CHO-K1-EGFR cell being substituted by sequence table obtains; The preparation method of described CHO-K1-EGFR cell is as follows: product first and product second are imported CHO-K1 cell jointly, obtains CHO-K1-EGFR cell; Described product first is following (a) or (b): DNA molecular first; (b) recombinant expression vector first containing described DNA molecular first; The DNA molecular of the light chain L4 shown in sequence 1 that described DNA molecular first is polynucleotide.Described DNA molecular first specifically can be the DNA molecular shown in sequence 2 of sequence table or the sequence 2 of the sequence table sequence 2 from the DNA molecular shown in 5 ' end 9-729 position Nucleotide or sequence table from the DNA molecular shown in 5 ' end 85-726 position Nucleotide.Described recombinant expression vector first specifically can be inserts in the multiple clone site (such as between Hind III and NotI restriction enzyme site) of pcDNA-3.3 carrier the recombinant plasmid that described DNA molecular first obtains.Described product second is following (c) or (d): DNA molecular second; (b) recombinant expression vector second containing described DNA molecular second; The DNA molecular of the heavy chain H3 shown in sequence 3 that described DNA molecular second is polynucleotide.Described DNA molecular second specifically can be the DNA molecular shown in sequence 4 of sequence table.Described recombinant expression vector second specifically can be inserts in the multiple clone site (such as between Hind III and NotI restriction enzyme site) of pOptiVEC carrier the recombinant plasmid that described DNA molecular second obtains.
The antibody (IgG) that arbitrary described reconstitution cell CHO-K1-EGFR-7gRNA secretes above also belongs to protection scope of the present invention.
The present invention also protects described antibody for the preparation of the application in the medicine of killing tumor cell.Described tumour cell can be epidermal carcinoma cell.Described tumour cell specifically can be A431 cell.
The present invention also protects a kind of medicine for killing tumor cell, and its activeconstituents is described antibody.Described tumour cell can be epidermal carcinoma cell.Described tumour cell specifically can be A431 cell.
The present invention also protects described antibody for the preparation of the application in the medicine of Therapeutic cancer.Described cancer can be epidermal carcinoma.Described cancer in particular can be the epidermal carcinoma that A431 cell causes.
The present invention also protects a kind of medicine being used for the treatment of cancer, and its activeconstituents is described antibody.Described cancer can be epidermal carcinoma.Described cancer in particular can be the epidermal carcinoma that A431 cell causes.
The present invention has great using value for the treatment of cancer.
Accompanying drawing explanation
Fig. 1 is 7 kinds of gRNA target position in Fut8.
Fig. 2 is the result of WesternBlot.
Fig. 3 is the result that mispairing enzyme T7E1 detects cutting efficiency.
Fig. 4 is the result that cell growth status detects.
Embodiment
Following embodiment is convenient to understand the present invention better, but does not limit the present invention.Experimental technique in following embodiment, if no special instructions, is ordinary method.Test materials used in following embodiment, if no special instructions, is and purchases available from routine biochemistry reagent shop.Quantitative test in following examples, all arranges and repeats experiment for three times, results averaged.
PSpCas9 (BB)-2A-Puro carrier: purchased from addgene, catalog number (Cat.No.) PX459.CHO-K1 cell: ATCC, CCL-61.CDCHOMedium:Gibco product, catalog number (Cat.No.) 10743-029.OptiMEMIMedium:Gibco product, catalog number (Cat.No.) 31985-070.Liposome (FugeneHD): be purchased from Promega company, catalog number (Cat.No.) E2311.Tetracycline: be purchased from GeneOperation company, catalog number (Cat.No.) ISY1130-0025MG.Cetuximab (solution form: 100mg/50ml, colourless transparent liquid, IgG antibody): German Merck company, import drugs card number: S20050095, lot identification mark 7667201.A431 cell (people's epidermal carcinoma cell): ATCC, CRL-1555.PcDNA-3.3 carrier: Invitrogen company, catalog number (Cat.No.) K8300-01.POptiVEC carrier: Invitrogen company, catalog number (Cat.No.) 12744-017.
The aminoacid sequence of light chain L4 is as shown in the sequence 1 of sequence table, and its encoding gene is if the sequence 2 of sequence table is from shown in 5 ' end 85-726 position Nucleotide.
Heavy chain H3 is made up of (H3=VH+CH1+hinge+CH2+CH3) variable region of heavy chain (VH), CH1 (CH1), hinge area, CH2 (CH2) and CH3 (CH3).The aminoacid sequence of heavy chain H3 is as shown in the sequence 3 of sequence table, and its encoding gene is as shown in the sequence 4 of sequence table.In the sequence 3 of sequence table, 1-145 amino acids is variable region of heavy chain (VH), 146-243 amino acids is CH1 (CH1), 244-258 amino acids is hinge area (hinge), 259-369 amino acids is CH2 (CH2), and 370-475 amino acids is CH3 (CH3).
The preparation of embodiment 1, CHO-K1-EGFR cell
Namely CHO-K1-EGFR cell expresses the CHO-K1 cell of anti-EGFR humanized antibody L4H3, and its building process is as follows:
1, between the Hind III sequence 2 of sequence table being inserted pcDNA-3.3 carrier from the double chain DNA molecule shown in 5 ' end 9-729 position Nucleotide and NotI restriction enzyme site, recombinant plasmid pcDNA-3.3-L4 is obtained.
2, between the Hind III double chain DNA molecule shown in the sequence 4 of sequence table being inserted pOptiVEC carrier and NotI restriction enzyme site, recombinant plasmid pOptiVEC-H3 is obtained.
3, recombinant plasmid pcDNA-3.3-L4 and recombinant plasmid pOptiVEC-H3 is imported CHO-K1 cell jointly by the mode of cotransfection, obtain reconstitution cell, by its called after CHO-K1-EGFR cell.
The discovery of embodiment 2, reconstitution cell
One, the design of RNA
In CHO-K1-EGFR cell, the open reading frame of Fut8 gene is as shown in the sequence 5 of sequence table, comprise 9 exons, wherein 1-203 position Nucleotide is exons 1 sequence, 204-319 position Nucleotide is exon 2 sequence, 320-482 position Nucleotide is exon 3 sequence, 483-597 position Nucleotide is exon 4 sequence, 598-835 position Nucleotide is exon 5 sequence, 836-1082 position Nucleotide is exon 6 sequence, 1083-1259 position Nucleotide is exon 7 sequence, 1260-1410 position Nucleotide is exon 8 sequence, 1411-1728 position Nucleotide is exon 9 sequence.
By preliminary experiment, inventor has devised 7 kinds of gRNA following (7 kinds gRNA in Fut8 target position as shown in Figure 1): 1gRNA1,1gRNA2,2gRNA, 5gRNA, 6gRNA, 7gRNA and 8gRNA.1gRNA1,1gRNA2,2gRNA, 5gRNA, 6gRNA, 7gRNA and 8gRNA act on the 1st exon of Fut8 gene, the 1st exon, the 2nd exon, the 5th exon, the 6th exon, the 7th exon and the 8th exon respectively.66-85 position Nucleotide in the sequence 5 of 1gRNA1 target sequence table, 182-201 position Nucleotide in the sequence 5 of 1gRNA2 target sequence table, 278-297 position Nucleotide in the sequence 5 of 2gRNA target sequence table, 736-755 position Nucleotide in the sequence 5 of 5gRNA target sequence table, 1005-1024 position Nucleotide in the sequence 5 of 6gRNA target sequence table, 1090-1109 position Nucleotide in the sequence 5 of 7gRNA target sequence table, 1335-1354 position Nucleotide in the sequence 5 of 8gRNA target sequence table.The target sequence of 7 kinds of gRNA is as shown in table 1.
The target sequence of table 17 kind of gRNA
Two, construction recombination plasmid
Synthesizing single-stranded DNA molecular OligoI and single strand dna OligoII respectively, then above-mentioned two single strand dnas are annealed, form the double chain DNA molecule that two ends all have sticky end, BbsI restriction enzyme site double chain DNA molecule being inserted pSpCas9 (BB)-2A-Puro carrier obtains recombinant plasmid.
Express recombinant plasmid called after recombinant plasmid pSpCas9 (the BB)-2A-Puro-1gRNA1 of 1gRNA1.Express recombinant plasmid called after recombinant plasmid pSpCas9 (the BB)-2A-Puro-1gRNA2 of 1gRNA2.Express recombinant plasmid called after recombinant plasmid pSpCas9 (the BB)-2A-Puro-2gRNA of 2gRNA.Express recombinant plasmid called after recombinant plasmid pSpCas9 (the BB)-2A-Puro-5gRNA of 5gRNA.Express recombinant plasmid called after recombinant plasmid pSpCas9 (the BB)-2A-Puro-6gRNA of 6gRNA.Express recombinant plasmid called after recombinant plasmid pSpCas9 (the BB)-2A-Puro-7gRNA of 7gRNA.Express recombinant plasmid called after recombinant plasmid pSpCas9 (the BB)-2A-Puro-8gRNA of 8gRNA.
For building OligoI and OligoII of each recombinant plasmid in table 2.
Table 2 is for building OligoI and OligoII of each recombinant plasmid
| Oligo I(5’-3’) | Oligo II(5’-3’) | |
| Express the recombinant plasmid of 1gRNA1 | CACCGTTTTATATAGGTGGTCATT | AAACAATGACCACCTATATAAAAC |
| Express the recombinant plasmid of 1gRNA2 | CACCGGAGAATGGCTGAGTCTCTC | AAACGAGAGACTCAGCCATTCTCC |
| Express the recombinant plasmid of 2gRNA | CACCGTAATTTTCAATCTGTTCTT | AAACAAGAACAGATTGAAAATTAC |
| Express the recombinant plasmid of 5gRNA | CACCGCAGAATTGGCGCTATGCTAC | AAACGTAGCATAGCGCCAATTCTGC |
| Express the recombinant plasmid of 6gRNA | CACCGATCCGTCCACAACCTTGGC | AAACGCCAAGGTTGTGGACGGATC |
| Express the recombinant plasmid of 7gRNA | CACCGTCAGACGCACTGACAAAGT | AAACACTTTGTCAGTGCGTCTGAC |
| Express the recombinant plasmid of 8gRNA | CACCGTTCACTTCGGGGCGTGATCC | AAACGGATCACGCCCCGAAGTGAAC |
Three, cell transfecting and transfection efficiency are identified
Recombinant plasmid pSpCas9 (BB)-2A-Puro-1gRNA1, recombinant plasmid pSpCas9 (BB)-2A-Puro-1gRNA2, recombinant plasmid pSpCas9 (BB)-2A-Puro-2gRNA, recombinant plasmid pSpCas9 (BB)-2A-Puro-5gRNA, recombinant plasmid pSpCas9 (BB)-2A-Puro-6gRNA, recombinant plasmid pSpCas9 (BB)-2A-Puro-7gRNA and recombinant plasmid pSpCas9 (BB)-2A-Puro-8gRNA proceed as follows respectively:
1, day before transfection CDCHOMedium suspension CHO-K1-EGFR cell (cell viability is greater than 95%) is (6-7) × 10 to make cell concn
5it is 1 × 10 that/ml, transfection CDCHOMedium on the same day adjust cell concn
6/ ml.
2, transfection same day, dilute recombinant plasmid with OptiMEMIMedium, obtain the plasmid solution that cumulative volume is 155 μ l, final concentration is 0.02 μ g/ μ l.
3, add 9.9 μ lFugeneHD in the plasmid solution obtained to step 2, mix more than 15 times gently, incubated at room 5 minutes.
4, the dropwise that step 3 obtains is added in the cell suspension that step 1 obtains, containing 8%CO
2, under 37 DEG C of conditions 125rpm concussion cultivate 72h.
5, after completing steps 4, the centrifugal 3min of 300rpm, collecting cell precipitates, and use PBS buffer solution, then use 100 μ lPBS damping fluids resuspended, (primary antibodie is Flag antibody then to carry out WesternBlot; Due to Flag and Cas9 protein fusion expression, the transfection efficiency of Cas9 albumen therefore can be detected by Flag antibody expression situation), detect Cas9 expression.
The results are shown in Figure 2.Cas9 has expression in 7 kinds of transfectional cells, and higher in the cells amount of transfection recombinant plasmid pSpCas9 (BB)-2A-Puro-5gRNA, recombinant plasmid pSpCas9 (BB)-2A-Puro-6gRNA, recombinant plasmid pSpCas9 (BB)-2A-Puro-7gRNA and recombinant plasmid pSpCas9 (BB)-2A-Puro-8gRNA.
By a strain cell called after reconstitution cell CHO-K1-EGFR-1gRNA1 of transfection recombinant plasmid pSpCas9 (BB)-2A-Puro-1gRNA1.By a strain cell called after reconstitution cell CHO-K1-EGFR-1gRNA2 of transfection recombinant plasmid pSpCas9 (BB)-2A-Puro-1gRNA2.By a strain cell called after reconstitution cell CHO-K1-EGFR-2gRNA of transfection recombinant plasmid pSpCas9 (BB)-2A-Puro-2gRNA.By a strain cell called after reconstitution cell CHO-K1-EGFR-5gRNA of transfection recombinant plasmid pSpCas9 (BB)-2A-Puro-5gRNA.By a strain cell called after reconstitution cell CHO-K1-EGFR-6gRNA of transfection recombinant plasmid pSpCas9 (BB)-2A-Puro-6gRNA.By a strain cell called after reconstitution cell CHO-K1-EGFR-7gRNA of transfection recombinant plasmid pSpCas9 (BB)-2A-Puro-7gRNA.By a strain cell called after reconstitution cell CHO-K1-EGFR-8gRNA of transfection recombinant plasmid pSpCas9 (BB)-2A-Puro-8gRNA.
Four, CRISPR-Cas9 cuts the detection of target sequence
Reconstitution cell CHO-K1-EGFR-1gRNA1, reconstitution cell CHO-K1-EGFR-1gRNA2, reconstitution cell CHO-K1-EGFR-2gRNA, reconstitution cell CHO-K1-EGFR-5gRNA, reconstitution cell CHO-K1-EGFR-6gRNA, reconstitution cell CHO-K1-EGFR-7gRNA and reconstitution cell CHO-K1-EGFR-8gRNA proceed as follows respectively:
1, the genomic dna of reconstitution cell is extracted.
2, with the genomic dna of reconstitution cell CHO-K1-EGFR-1gRNA1 for template, the targeting regions of pcr amplification 1gRNA1; With the genomic dna of reconstitution cell CHO-K1-EGFR-1gRNA2 for template, the targeting regions of pcr amplification 1gRNA2; With the genomic dna of reconstitution cell CHO-K1-EGFR-2gRNA for template, the targeting regions of pcr amplification 2gRNA; With the genomic dna of reconstitution cell CHO-K1-EGFR-5gRNA for template, the targeting regions of pcr amplification 5gRNA; With the genomic dna of reconstitution cell CHO-K1-EGFR-6gRNA for template, the targeting regions of pcr amplification 6gRNA; With the genomic dna of reconstitution cell CHO-K1-EGFR-7gRNA for template, the targeting regions of pcr amplification 7gRNA; With the genomic dna of reconstitution cell CHO-K1-EGFR-8gRNA for template, the targeting regions of pcr amplification 8gRNA.
For the primer of the targeting regions of each gRNA that increases in table 3.
Table 3 is for the primer of the targeting regions of each gRNA that increases
| Upstream primer (5 '-3 ') | Downstream primer (5 '-3 ') | |
| The targeting regions of amplification 1gRNA1 | GAGACTAATTTTGTCTGA | GCAACTATGTAAACCTAT |
| The targeting regions of amplification 1gRNA2 | GGGAGTTGAAACTCTGAA | ATGAGCACTAATCCAAAT |
| The targeting regions of amplification 2gRNA | AACCCTTTTTGGTATGCT | GGACACAGTACCTTTCAT |
| The targeting regions of amplification 5gRNA | TACCTGTGACCAAAATGAGA | CAATCCTCCCAAATCAGA |
| The targeting regions of amplification 6gRNA | GTAGTGATGATGTGTTTTGA | TAAAACCAAGGAGCTTCATA |
| The targeting regions of amplification 7gRNA | TAACTTTCATATTGACCTGT | AGGTATGACTTGATTAGATT |
| The targeting regions of amplification 8gRNA | TGTTGATTTGAGAGATGCTT | ACTAAAAACACAGACTAATG |
3, get the pcr amplification product of step 2, utilize mispairing enzyme T7E1 to detect cutting efficiency.The results are shown in Figure 3.In Fig. 3, the mispairing enzyme T7E1 enzyme that swimming lane 1 to 7 represents the pcr amplification product of reconstitution cell CHO-K1-EGFR-1gRNA1, reconstitution cell CHO-K1-EGFR-1gRNA2, reconstitution cell CHO-K1-EGFR-2gRNA, reconstitution cell CHO-K1-EGFR-5gRNA, reconstitution cell CHO-K1-EGFR-6gRNA, reconstitution cell CHO-K1-EGFR-7gRNA and reconstitution cell CHO-K1-EGFR-8gRNA successively cuts result.Result shows, and the pcr amplification product of reconstitution cell CHO-K1-EGFR-1gRNA2, reconstitution cell CHO-K1-EGFR-5gRNA, reconstitution cell CHO-K1-EGFR-6gRNA and reconstitution cell CHO-K1-EGFR-7gRNA can detect cutting band.
According to formula f
cut=(b+c)/(a+b+c), indel (%)=100 × (1-∫ (1-f
cut)) calculate the gray scale of each band in each swimming lane, the results are shown in Table 4.
The gray scale of each band in each swimming lane of table 4
| Band 1 | Band 2 | Band 3 | |
| The targeting regions of 1gRNA1 | 4377.33 | 0 | 0 |
| The targeting regions of 1gRNA2 | 5475.83 | 1044.52 | 945.9 |
| The targeting regions of 2gRNA | 5552.25 | 0 | 0 |
| The targeting regions of 5gRNA | 2579.65 | 1280.42 | 1030.6 |
| The targeting regions of 6gRNA | 2475.54 | 1372.71 | 1296.86 |
| The targeting regions of 7gRNA | 2380.72 | 1613.79 | 1156.6 |
| The targeting regions of 8gRNA | 2461.24 | 0 | 0 |
Five, the discovery of reconstitution cell
T7E1 in step 4 is selected to detect 3 higher reconstitution cells (CHO-K1-EGFR-5gRNA, CHO-K1-EGFR-6gRNA and CHO-K1-EGFR-7gRNA) of indel (%) efficiency, adopt the LcA (Lensculinarisagglutinin of 10 μ g/ml, LCA) screen, after one week, the survival rate of CHO-K1-EGFR-6gRNA is the survival rate of 0%, CHO-K1-EGFR-5gRNA and CHO-K1-EGFR-7gRNA is 95% and 97%.
Get reconstitution cell (CHO-K1-EGFR-5gRNA or CHO-K1-EGFR-7gRNA), extract total serum IgE reverse transcription is cDNA, be template amplification Fut8 gene with cDNA and check order.
Sequencing result shows, in reconstitution cell CHO-K1-EGFR-5gRNA, Fut8 gene there occurs following sudden change: the Fut8 gene in the item chromosome in homologous chromosomes increases by 32 bases (in the sequence 5 of sequence table, between the 753rd Nucleotide and the 754th Nucleotide, place adds following 32 Nucleotide: ATAGCGCCATCCTATATAGCGCCTCCAGTATA), 8 bases of the Fut8 genetically deficient in the another item chromosome in homologous chromosomes (having lacked the 747 to 754 Nucleotide in the sequence 5 of sequence table).
Sequencing result shows, in reconstitution cell CHO-K1-EGFR-7gRNA, Fut8 gene there occurs following sudden change: the Fut8 gene in two karyomit(e)s in homologous chromosomes there occurs identical sudden change, on the one hand increase by 5 bases (adding TCTGT between the 1109th and 1110 Nucleotide in the sequence 5 of sequence table), there occurs the sudden change (to make in the sequence 5 of sequence table the 1106th and 1107 Nucleotide be mutated into GT by AA) of two bases on the other hand.
Six, genome sequencing
CHO-K1-EGFR cell and reconstitution cell CHO-K1-EGFR-7gRNA are carried out genome sequencing respectively.
Genome sequencing result shows, compared with CHO-K1-EGFR cell, the difference of reconstitution cell CHO-K1-EGFR-7gRNA is only the DNA molecular shown in the sequence 6 of sequence table in genome to replace in order to the DNA molecular shown in the sequence 7 of sequence table.
The preparation and purification of embodiment 3, antibody
Respectively cell to be measured (CHO-K1-EGFR cell, reconstitution cell CHO-K1-EGFR-5gRNA or reconstitution cell CHO-K1-EGFR-7gRNA) is proceeded as follows:
1, reconstitution cell is seeded to 125ml Tissue Culture Flask (30mlCDCHOMedium is housed), at incubator (containing 8%CO
2, 37 DEG C) in 125rpm shaking culture to cell viability lower than 50%, the then centrifugal 15min of 12000rpm, collects supernatant liquor.
2, get the supernatant liquor that step 1 obtains, adjust pH to 6.0-7.0, then use 0.45 μm of membrane filtration, collect filtrate.
3, get the filtrate that step 2 obtains, adopt rProteinA affinity column to carry out purifying.
RProteinA affinity column (Biorad company, Bio-ScaleMiniAffi-PrepproteinAcartridges): column volume is 5ml, article No. is 732-4202.
Binding buffer liquid (pH7.0): containing the 20mM phosphate buffered saline buffer of 3MNaCl.
Elution buffer (pH3.0): 0.1M citrate buffer solution.
Flow velocity: 2ml/min.
Purge process: (1) balances rProteinA affinity column with 50ml binding buffer liquid; (2) loading; (3) with 50ml binding buffer liquid washing pillar; (4) with 25ml elution buffer wash-out target protein, solution after post was collected.
That 4, gets that step 3 obtains crosses solution after post, adjusts pH to 7.0, then use the super filter tube (Millipore company) that molecular weight cut-off is 10kd to concentrate, the antibody-solutions obtained with Tris-HCl (pH9.0).
Reconstitution cell CHO-K1-EGFR-5gRNA carries out the antibody-solutions called after hErbitux1 that above-mentioned steps obtains.
Reconstitution cell CHO-K1-EGFR-7gRNA carries out the antibody-solutions called after hErbitux2 that above-mentioned steps obtains.
The antibody-solutions called after hErbitux that CHO-K1-EGFR cell obtains.
The cytotoxicity (ADCC) of embodiment 4, antibody-dependant
ADCC (antibody-dependentcell-mediatedcytotoxicity, the cell-mediated cytotoxic effect of antibody-dependant) is the vital role mode that antibody drug plays that targeting eliminates target cell.ADCC refers to that the effector cell that expresses IgGFc acceptor is by being combined with the Fc section of the IgG antibody being combined in tumor cell surface, and kills and wounds the effect of these target cells.Target cell and A431 cell.The culture condition of A431 cell: 37 DEG C, 5%CO
2incubator.Effector cell NK92/FcR γ 3a (158V/V): Jin Sirui biotechnology company.
Test antibodies solution is hErbitux, hErbitux1, hErbitux2 or Cetuximab.
1, get A431 cell, suspend with the DMEM substratum containing 10%FBS, obtain 2 × 10
5the enchylema of/ml.
2, get the enchylema that step 1 obtains, be taped against in 96 orifice plates by every hole 50 μ l (i.e. 10000 cells/well).
3, get test antibodies solution, carry out 10 times of gradient dilutions with PBS damping fluid (pH7.4,0.01M), obtain each antibody diluent.The concentration of test antibodies solution is 40 μ g/ml (in total protein), and the concentration of the antibody diluent of greatest dilution is 0.000004 μ g/ml (in total protein).
4, the antibody diluent that step 3 obtains is added (every hole 50 μ l microlitre) in 96 orifice plates of completing steps 2, stationary incubation 30min.The blank replacing antibody diluent with equal-volume PBS damping fluid is set.
5, the effector cell NK92/FcR γ 3a suspended with RPMI1640 substratum is added (every hole 100 μ l microlitre) in 96 orifice plates of completing steps 4, stationary incubation 6 hours.In system, the concentration of test antibodies is 0.000001 μ g/ml-10 μ g/ml (in protein concentration).Target cell in every hole is 10000, and effector cell is 50000, and namely target effect is than being 1:5.
6, after completing steps 5, the centrifugal 3min of 800rpm, collects supernatant liquor.
7, the supernatant liquor that 50 μ l steps 6 obtain is added in 96 new orifice plates, add 50 μ lLDH and detect liquid (Roche, cat#11644793001) incubated at room 30min again after, on microplate reader Flexstation3, then detect the OD value of LDH reaction, determined wavelength is OD
492nm, background wavelength is OD
650nm.
Each process arranges three repeated sample, results averaged.
Target cell lysis rate (%)=(OD
experimental data-OD
blank)/(OD
maximumrelease-OD
minimumrelease) × 100%.
OD
maximumreleaseoD value measured during the expression complete cracking of target cell; OD
minimumreleaseoD value measured when representing that target cell is uncracked.
Protein concentration in antibody diluent corresponding when target cell lysis rate is 50%, is EC
50value.
The EC of Erbitux
50value=0.01086.The EC of hErbitux
50value=0.003979.The EC of hErbitux1
50the EC of value=0.002224, hErbitux2
50value=0.0003266.
Result shows, the ADCC effect of hErbitux2 is more remarkable, is significantly better than Erbitux, hErbitux and hErbitux1 to the lethal effect of target cell (A431 cell).
Embodiment 5, cell growth status detect
Cell to be measured is CHO-K1-EGFR cell or reconstitution cell CHO-K1-EGFR-7gRNA.
Cell to be measured is inoculated in 125ml shaking flask (including 30mlCDCHOMedium), 37 DEG C, 8%CO
2125rpm shaking culture under condition, samples respectively when cell cultures 0,3,6,9 and 12 days and detects cell count, cell viability, and by ELISA testing inspection antibody production.In ELISA test, primary antibodie is goat anti-human igg (purchased from Beijing ancient cooking vessel state, article No. AB-0011), and ELIAS secondary antibody is purchased from Zhong Shan Golden Bridge (article No. ZB-2304).
The results are shown in Figure 4, A is cell count result, and B is cell viability result, and C is antibody concentration result.CHO-K1-EGFR cell and reconstitution cell CHO-K1-EGFR-7gRNA carry out above-mentioned cultivation, and cell count, the cell viability of each time point are basically identical, and the antibody production of reconstitution cell CHO-K1-EGFR-7gRNA is compared CHO-K1-EGFR cell and improved.
Claims (10)
1. reconstitution cell CHO-K1-EGFR-7gRNA is the reconstitution cell that the DNA molecular shown in sequence 7 DNA molecular shown in the sequence 6 of sequence table in the genome of CHO-K1-EGFR cell being substituted by sequence table obtains;
The preparation method of described CHO-K1-EGFR cell is as follows: product first and product second are imported CHO-K1 cell jointly, obtains CHO-K1-EGFR cell; Described product first is following (a) or (b): DNA molecular first; (b) recombinant expression vector first containing described DNA molecular first; The DNA molecular of the light chain L4 shown in sequence 1 that described DNA molecular first is polynucleotide; Described product second is following (c) or (d): DNA molecular second; (b) recombinant expression vector second containing described DNA molecular second; The DNA molecular of the heavy chain H3 shown in sequence 3 that described DNA molecular second is polynucleotide.
2. reconstitution cell CHO-K1-EGFR-7gRNA as claimed in claim 1, is characterized in that:
Described DNA molecular first is following (f1) or (f2) or (f3):
(f1) sequence 2 of sequence table is from the DNA molecular shown in 5 ' end 85-726 position Nucleotide;
(f2) sequence 2 of sequence table is from the DNA molecular shown in 5 ' end 9-729 position Nucleotide;
(f3) DNA molecular shown in sequence 2 of sequence table;
Described DNA molecular second is as shown in the sequence 4 of sequence table.
3. reconstitution cell CHO-K1-EGFR-7gRNA as claimed in claim 1, is characterized in that:
Described recombinant expression vector first is the recombinant plasmid multiple clone site that described DNA molecular first inserts pcDNA-3.3 carrier obtained; Described recombinant expression vector second is the recombinant plasmid multiple clone site that described DNA molecular second inserts pOptiVEC carrier obtained.
4. the antibody that in claims 1 to 3, arbitrary described reconstitution cell CHO-K1-EGFR-7gRNA secretes.
5. the application of antibody described in claim 4, is following (e1) or (e2):
(e1) for the preparation of the medicine of killing tumor cell;
(e2) for the preparation of the medicine of Therapeutic cancer.
6. apply as claimed in claim 5, it is characterized in that:
In described (e1), described tumour cell is epidermal carcinoma cell;
In described (e2), described cancer is epidermal carcinoma.
7., for a medicine for killing tumor cell, its activeconstituents is antibody described in claim 2.
8. medicine as claimed in claim 7, is characterized in that: described tumour cell is epidermal carcinoma cell.
9. be used for the treatment of a medicine for cancer, its activeconstituents is antibody described in claim 2.
10. medicine as claimed in claim 9, is characterized in that: described cancer is epidermal carcinoma.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610021187.2A CN105505882B (en) | 2016-01-11 | 2016-01-11 | One plant of recombinant cell and its preparing the application in anti-human EGF-R ELISA therapeutic agent |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610021187.2A CN105505882B (en) | 2016-01-11 | 2016-01-11 | One plant of recombinant cell and its preparing the application in anti-human EGF-R ELISA therapeutic agent |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105505882A true CN105505882A (en) | 2016-04-20 |
| CN105505882B CN105505882B (en) | 2019-07-19 |
Family
ID=55714178
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610021187.2A Active CN105505882B (en) | 2016-01-11 | 2016-01-11 | One plant of recombinant cell and its preparing the application in anti-human EGF-R ELISA therapeutic agent |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105505882B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110804625A (en) * | 2019-11-21 | 2020-02-18 | 安徽大学 | Method for increasing production of therapeutic antibody by over-expressing PTEN C124S in CHO (Chinese hamster ovary) cells |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101238148A (en) * | 2005-06-03 | 2008-08-06 | 健泰科生物技术公司 | Method of producing antibodies with modified fucosylation level |
| CN102153648A (en) * | 2011-01-27 | 2011-08-17 | 中国人民解放军军事医学科学院生物工程研究所 | EGFR (epidermal growth factor receptor)-inhibiting humanized antibody L4-H3 and encoding genes and application thereof |
| WO2015010114A1 (en) * | 2013-07-19 | 2015-01-22 | Larix Bioscience, Llc | Methods and compositions for producing double allele knock outs |
-
2016
- 2016-01-11 CN CN201610021187.2A patent/CN105505882B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101238148A (en) * | 2005-06-03 | 2008-08-06 | 健泰科生物技术公司 | Method of producing antibodies with modified fucosylation level |
| CN102153648A (en) * | 2011-01-27 | 2011-08-17 | 中国人民解放军军事医学科学院生物工程研究所 | EGFR (epidermal growth factor receptor)-inhibiting humanized antibody L4-H3 and encoding genes and application thereof |
| WO2015010114A1 (en) * | 2013-07-19 | 2015-01-22 | Larix Bioscience, Llc | Methods and compositions for producing double allele knock outs |
Non-Patent Citations (3)
| Title |
|---|
| RONDA CARLOTTA等: "Accelerating genome editing in CHO cells using CRISPR Cas9 and CRISPy，a web-based target finding tool", 《BIOTECHNOLOGY AND BIOENGINEERING》 * |
| SUZUKI EIJI等: "A nonfucosylated anti-HER2 antibody augments antibody-dependent cellular cytotoxicity in breast cancer patients", 《CLIN CANCER RES》 * |
| 高慧萍 等: "抗EGFRvⅢ/EGFR单抗9B9的制备和鉴定", 《中国肿瘤生物治疗杂志》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110804625A (en) * | 2019-11-21 | 2020-02-18 | 安徽大学 | Method for increasing production of therapeutic antibody by over-expressing PTEN C124S in CHO (Chinese hamster ovary) cells |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105505882B (en) | 2019-07-19 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Mathewson et al. | Inhibitory CD161 receptor identified in glioma-infiltrating T cells by single-cell analysis | |
| AU2018202976B2 (en) | Polyclonal gamma delta t cells for immunotherapy | |
| US20190314418A1 (en) | Compositions and methods for inhibition of lineage specific antigens | |
| US10604740B2 (en) | Nucleic acids encoding chimeric antigen receptor proteins which bind epidermal growth factor receptor and T lymphocyte expressing the protein | |
| CN107949641A (en) | CRISPR/CAS9 compounds for genome editor | |
| JP7190096B2 (en) | Gene-edited T cells and uses thereof | |
| EP3692057B1 (en) | Modified epidermal growth factor receptor peptides for use in genetically-modified cells | |
| CN108463227A (en) | The method and composition of gene editing in candidate stem cell | |
| CN105296431B (en) | The α β T cells and its suppression cancer purposes of tumor combination specificity gamma delta T CR genetic modifications | |
| TW202042824A (en) | Tn-muc1 chimeric antigen receptor (car) t cell therapy | |
| TW200907059A (en) | Recombinant expression vector elements (rEVEs) for enhancing expression of recombinant proteins in host cells | |
| CN109055380A (en) | A kind of preparation method of universal CAR-T cell | |
| CN109563139A (en) | Stable pseudotyping lentiviral particle and application thereof | |
| CN109776671A (en) | Cell, code nucleic acid, expression vector, preparation method, pharmaceutical composition and the application of isolated T cell receptor, its modification | |
| CN107236762A (en) | A kind of method that minicircle dna transfecting T cells prepare clinical grade CAR T cell preparations | |
| CN107760650A (en) | A kind of Chinese hamster ovary celI of transformation and application thereof | |
| CA3225985A1 (en) | Engineered natural killer (nk) cells and related methods | |
| CN110358735A (en) | A kind of preparation method and application of CTL cell | |
| CN112442118A (en) | TCR and application thereof | |
| CN105505882A (en) | Reconstituted cells and application thereof to preparation of therapeutic drug resisting human epidermal growth factor receptors | |
| CN111205361B (en) | Interleukin 21 protein (IL21) mutant and application thereof | |
| CN113226336A (en) | Method for delivering gene in cell | |
| EP4303233A1 (en) | Targeted protein degradation system and use thereof | |
| CN112105650A (en) | Chimeric single-chain molecule and application thereof | |
| US20230054266A1 (en) | Method for purifying ucart cell and use thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |