CN105492014A - Freeze-dried polyelectrolyte complexes that maintain size and biological activity - Google Patents

Freeze-dried polyelectrolyte complexes that maintain size and biological activity Download PDF

Info

Publication number
CN105492014A
CN105492014A CN201480042301.9A CN201480042301A CN105492014A CN 105492014 A CN105492014 A CN 105492014A CN 201480042301 A CN201480042301 A CN 201480042301A CN 105492014 A CN105492014 A CN 105492014A
Authority
CN
China
Prior art keywords
polyelectrolyte complex
compositions
chitosan
concentration
rehydration
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201480042301.9A
Other languages
Chinese (zh)
Inventor
迈克尔·D·布施曼
马尔科·拉韦尔图
丹尼尔·韦耶
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Polyvalor SC
Original Assignee
Polyvalor SC
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Polyvalor SC filed Critical Polyvalor SC
Publication of CN105492014A publication Critical patent/CN105492014A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/711—Natural deoxyribonucleic acids, i.e. containing only 2'-deoxyriboses attached to adenine, guanine, cytosine or thymine and having 3'-5' phosphodiester links
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/713—Double-stranded nucleic acids or oligonucleotides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/0008—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'non-active' part of the composition delivered, e.g. wherein such 'non-active' part is not delivered simultaneously with the 'active' part of the composition
    • A61K48/0025—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'non-active' part of the composition delivered, e.g. wherein such 'non-active' part is not delivered simultaneously with the 'active' part of the composition wherein the non-active part clearly interacts with the delivered nucleic acid
    • A61K48/0041—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'non-active' part of the composition delivered, e.g. wherein such 'non-active' part is not delivered simultaneously with the 'active' part of the composition wherein the non-active part clearly interacts with the delivered nucleic acid the non-active part being polymeric
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/06—Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite
    • A61K47/26—Carbohydrates, e.g. sugar alcohols, amino sugars, nucleic acids, mono-, di- or oligo-saccharides; Derivatives thereof, e.g. polysorbates, sorbitan fatty acid esters or glycyrrhizin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/30—Macromolecular organic or inorganic compounds, e.g. inorganic polyphosphates
    • A61K47/36—Polysaccharides; Derivatives thereof, e.g. gums, starch, alginate, dextrin, hyaluronic acid, chitosan, inulin, agar or pectin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/30—Macromolecular organic or inorganic compounds, e.g. inorganic polyphosphates
    • A61K47/36—Polysaccharides; Derivatives thereof, e.g. gums, starch, alginate, dextrin, hyaluronic acid, chitosan, inulin, agar or pectin
    • A61K47/38—Cellulose; Derivatives thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/0091—Purification or manufacturing processes for gene therapy compositions
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/14—Particulate form, e.g. powders, Processes for size reducing of pure drugs or the resulting products, Pure drug nanoparticles
    • A61K9/19—Particulate form, e.g. powders, Processes for size reducing of pure drugs or the resulting products, Pure drug nanoparticles lyophilised, i.e. freeze-dried, solutions or dispersions

Abstract

The present invention relates to a polyelectrolyte complex composition comprising a polymer, a nucleic acid molecule, a lyoprotectant, and a buffer. The polyelectrolyte complex composition preserving the biological activities of the polyelectrolyte complex following freeze-drying and rehydration.

Description

Maintain the cryodesiccated compound polyelectrolyte of size and biologic activity
The reference of related application
This application claims rights and interests and the priority of the U.S. Provisional Patent Application number 61/833,010 requiring to submit on June 10th, 2013, its content is incorporated herein by reference with its full content.
Technical field
The present invention relates to have in the solution and improve stability and the polyelectrolyte complex composition physics in longer-term storage or chemical degradation to the resistance of improvement; For obtaining the method for this polyelectrolyte complex composition and these polyelectrolyte complex compositions purposes for nucleic acid delivery.
Background technology
Be put to a large amount of effort in recent years with exploitation for the Nanoparticulate compositions of delivering therapeutic agents, medicine as but be not limited to protein, peptide, DNA (deoxyribonucleic acid) (DNA), if plasmid (pDNA) and oligodeoxynucleotide (ODN) and ribonucleic acid are as small interference ribonucleic acid (siRNA) and bobby pin ribonucleic acid (shRNA).But, show these colloidal compositions and there is limited stability in the solution, and easily there is physics or chemical degradation [1] in long term storage.
By lyophilization (freeze-drying), also referred to as lyophilizing (lyophilization), the dehydration of these compositionss is used to the long-time stability [2-4] improving them.This process is made up of 3 key steps: freezing, elementary drying and secondary drying.It provide in the volume reduced, to make dry compositions rehydration to increase the concentration of activating agent and to reach the probability of therapeutic dose.Be make us interested especially when this polyelectrolyte complex composition between self assembly polycation and nucleic acid (NA), above-mentioned self assembly needs to prepare under diluting condition to produce the little and nano-particle of size uniform [1].
The loss [4,5] of the degree of functionality of nano-particle in irreversible coalescent and solution when general needs add freeze drying protectant to prevent lyophilizing in compositions.Freeze thawing research allows to identify the potential freeze drying protectant [6,7] being ready to use in given compositions.Disaccharide (as sucrose, trehalose, lactose etc.), oligosaccharide/polysaccharide (as cellulose, glucosan etc.), polymer (as PEG, PVP etc.) etc. have been used as freeze drying protectant with the compositions of stable longer-term storage [3,4].Trehalose also will be a fabulous nano-particle freeze drying protectant [4,11-13].But it is found that when at high temperature storing, cryodesiccated amorphous disaccharide can crystallization easier than polysaccharide, increase the risk [14] that complex is coalescent, but polysaccharide is but found to be inefficient freeze drying protectant [15,16] because it is fluffy.Oligosaccharide may be superior stabilizing agent, because they have the favourable character [17] that disaccharide and polysaccharide all have for complex best stabilized.Proved that LMD retains cationic polymer (polyplex) physicochemical properties when lyophilizing and rehydration and function aspects is effective, simultaneously in vivo with maintain higher cell viability [15] in vitro study compared with sucrose.
Nano-particle acidolysis [2] during buffer agent may be used for stable pH and prevents the cryoconcentration of the solute occurred when the freezing stage by freeze-drying process.The buffer agent that must use during careful selection lyophilizing, because some can crystallization or precipitation (phosphate, succinate or tartrate) between pool period, causes pH value to change and is up to 4 units [2,20-23].Tg', refers to the glass transition temperature of the solution of maximum cryoconcentration, is to select the important parameter for considering during cryodesiccated excipient; It is the good estimation can implemented elementary drying and can not affect the maximum temperature of final products.Sodium citrate is amorphism buffer agent, because it is at the higher Tg'[22 of different pH value] and close to neutral pK a(pK a3=6.4) [24], it is applicable to the Injectable composition of lyophilizing.L-Histidine also can be applicable, because one of its three pKa values are 6.1, it shows crystallization when lyophilization hardly at pH5.5 to 6.5 time, and it has high Tg'(-33 DEG C) [12,25].Use excipient; mainly freeze drying protectant and some buffer agents; for with poly-(D; Pfansteihl-altogether-glycolic) (PLGA) (U.S.2011/262490) [26-28], poly-(l-lysine) (PLL) [29], polylactic acid (PLA) (U.S.2011/0275704) [30], gelatin [31], polymine (PEI) [7; 15; 17; 32-37] exploitation of cryodesiccated polyelectrolyte complex composition that formed, characterized.
Nano-granular system based on PEI is most characterization in lyophilization.Verified several disaccharide is effective for frozen-dried protective PEI/NA nano-particle during lyophilization.Existing freeze drying protectant screening study shows, needs the sucrose of rather high concentration (being equivalent to 37.5% (wt/v) for the compositions comprising 50 μ gDNA/mL) to keep 70kDa (weight average molecular weight (M when freeze thawing w)) particle diameter of branching PEI/DNA, although meeting causes the sharply decline [32] in ζ (zeta) current potential and transfection efficiency.More recent work shows, can in much lower sucrose, lactose or the trehalose (1.25% (wt/v) is equivalent to for the compositions comprising 50 μ gDNA/mL) of concentration lyophilization 25kDa (M w) branching PEI/DNA complex and without particles coalesce or in-vitro transfection loss, acceptable zeta potential increases (10 ~ 20mV), and with transfection efficiency [33] in the highest body of lactose composition.Mannitol, and sucrose or trehalose, the loss of the coalescent and freezing efficiency of PEI/DNA complex when also may be used for preventing drying, but drying protectant to be frozen [34] is not needed for PEI/ODN or ribozyme complex.
Previous research confirms, need high-sucrose/DNA weight ratio with the stable nanoparticles when lyophilization, cause compositions to be injected inconsistent osmolality (osmolality) [32] with for subcutaneous (SC) of typical plasmid DNA dosage or intramuscular (IM).
Have studied and use glucosan (polysaccharide) to carry out stable freeze-dried 70kDa (M as the substitute of disaccharide w) probability of branching PEI/DNA complex.Glucosan 3kDa is equally effective with sucrose in maintenance complex integrity, reduces the osmolality about 40% [15] of reconstituted solutions simultaneously.Glucosan 3kDa/sucrose composition can concentrate up to 10 times of rehydration to concentration during nearly osmolality, there is provided and be more suitable for the interior dosage injected of body (such as, 1mg/mL), the change as there is not turbidity during by measuring is determined, can not change particle diameter when concentrated.But; in order to reach that ultimate density after ten times of concentration; before adding freeze drying protectant; granule [15] must be prepared with the initial DNA concentration of 200 μ g/mL; this exceedes guarantees to produce the little and typical Cmax of the nano-particle of size uniform (100 μ gDNA/mL) [1], points out the particle size in these compositionss and polydispersity can be always higher.
In addition, use the major defect of glucosan to be their incompatibilities that is known and PEG, its stablizing effect reduces [17] along with the degree increase of the PEGization of lipid complex (lipoplexes).Glucosan 5kDa prevents the PEI/DNA complex of Pegylation completely coalescent, but particle diameter still can increase by 170% to 240% [7].Inulin, another kind of oligosaccharide is the effective freeze drying protectant [7] of lipid complex for Pegylation or cationic polymer.
Recently, buffer agent (10mML-histidine pH6) is added in linear PEI/DNA complex, amino/phosphate ester (N/P) with 6 is than preparation, particle hydrodynamic diameter can be caused to reduce (from 176 to 118nm) and polydispersity index (PDI) reduction (from 0.18 to 0.13), cause zeta potential to increase (from 29.6 to 36.3mV), but [36] are not made significant difference to its In vitro metabolism activity and gene expression.It is found that glucosan is a kind of very poor freeze drying protectant for these complex; and sucrose; under freeze drying protectant at least 2000/DNA weight ratio (10% (w/v) is equivalent to for the compositions containing 50 μ gDNA/mL), Stabilization can be produced to it when lyophilization.It is stable that the isotonic compositions of the lactulose (lactosucrose) containing 14%, 10% hydroxypropyl beta cyclodextrin/6.5% sucrose or 10% polyvidone/6.3% sucrose stores 6 all times at 40 DEG C, and wherein granule is less than 170nm.External the most effective [36] of lactulose or hydroxypropyl beta cyclodextrin/sucrose composition.Another kind of buffer agent, the triethanolamine of pH7, it is found that for maintenance PEI-mannobiose (PEIm)/pDNA complex when lyophilization and 50% glycerol to combine be effective.Cryodesiccated compositions reaches 30 days at can being stored in-20 DEG C or 4 DEG C, and still keeps particle diameter (WO2010/125544) [37] of 200nm.
PEI is used to be covalently bond to Polyethylene Glycol (PEG) and cholesterol (Chol), PEG-PEI-Chol (0.554mg/mL)/pDNA (0.15mg/mL), in lactose or sucrose (0.3,1.5 or 3% (w/v)), the lipid cationic polymer (lipopolyplexes) of preparation can be frozen the dry final DNA concentration becoming 5,1 or 0.5mg/mL with rehydration, and without the need to adding buffer agent in compositions.-20 or-80 DEG C, 60%RH stores cryodesiccated sample after 2 years or in reconstruct with store (WO2009/021017) after sample reaches 3 months at 4 DEG C, and particle diameter or biologic activity (in external, body, in cancer patient) almost do not see change [35] between these compositionss.In fact, previously reported, lipid cationic polymer is just not too easy to degraded under low cane sugar content (compositions comprising 50gDNA/mL being equivalent to 0.0625% (w/v)) after freeze thawing, and without the need to modifying and the transfection efficiency at least 50% [32] of tester its physicochemical properties.
In view of the current techniques state of this area, still a kind of polyelectrolyte complex composition is needed, its stability providing compound polyelectrolyte to increase in the solution, and improve compound polyelectrolyte and in long-time storage, physics or chemical degradation (are related to, such as, lyophilization) resistance, and can representative close to the concentration of isotonic effective dose under rehydration.
Summary of the invention
Various aspects of the present invention relate to a kind of polyelectrolyte complex composition, comprise polymer, nucleic acid molecules, freeze drying protectant and buffer agent, and described compositions keeps the biologic activity of compound polyelectrolyte after lyophilization and rehydration.
Various aspects of the present invention relate to a kind of polyelectrolyte complex composition, comprise chitosan, trehalose that DNA (deoxyribonucleic acid) that content is about 50 μ g/mL, content are about 0.5% (w/v) to about 1% (w/v) and content is that about 3mM is to the histidine about between 4mM.
Various aspects of the present invention relate to a kind of polyelectrolyte complex composition, comprise chitosan, trehalose that DNA (deoxyribonucleic acid) that content is about 100 μ g/mL, content are about 1% (w/v) to 2% (w/v) and content is that about 6mM is to the histidine about between 8mM.
Various aspects of the present invention relate to a kind of method preparing polyelectrolyte complex composition, this polyelectrolyte complex composition keeps its biologic activity after lyophilization and rehydration, and method comprises the following steps: chitosan is mixed to form chitosan composite with freeze drying protectant and buffer agent; Independently nucleic acid is mixed to form nucleic acid compositions with freeze drying protectant and buffer agent; Mix to form polyelectrolyte complex composition with nucleic acid compositions with by chitosan composite.
Various aspects of the present invention relate to a kind of test kit, comprise the polyelectrolyte complex composition as limited herein; With the description of restructuring compositions.
Various aspects of the present invention relate to polyelectrolyte complex composition as limited herein for its purposes of experimenter's nucleic acid delivery of needs.
Accompanying drawing explanation
Referring now to accompanying drawing.
Figure 1A, B and C.Figure 1A illustrate be presented at there is no freeze drying protectant under the curve chart of nano-particle coalescent (size 5 times increase) seen after freeze thawing (F/T), and when adding mannitol, 0.5% (w/v) sucrose, 0.5% (w/v) glucosan 5kDa or 0.1% (w/v) trehalose dihydrate compound of at least 1%w/v to compositions, prevent coalescent (diameter <150nm); Figure 1B illustrates the curve chart that display uses the transfection efficiency of minimum indicated frozen-dried protective agent content; After Fig. 1 C illustrates and is presented at freeze thawing, nano-particle maintains the curve chart of luciferase expression, and without observing remarkable reduction during freeze drying protectant.Transfection efficiency and luciferase expression are all expressed as the percentage ratio of the fresh control thing without excipient (0FT), and tester has the transfection efficiency of total cell of 43% and the luciferase expression of 8.03E10RLU/minmg albumen.
Fig. 2 A-H.The nano-particle that Fig. 2 illustrates freeze thawing under the existence being presented at 1 or 10% (w/v) mannitol (Fig. 2 A-2B), sucrose (Fig. 2 C-2D) or glucosan 5kDa (Fig. 2 E-2F) is than containing the image that the particulate composition of the fresh preparation of freeze drying protectant (Fig. 2 G) is more spherical in shape.Occur seriously coalescent (Fig. 2 H) at the nano-particle without freeze thawing under freeze drying protectant.
Fig. 3 A-D.Fig. 3 A illustrates the curve chart that display lyophilization causes nano-particle coalescent with the equal-volume compositions that rehydration becomes to comprise 0.5% (w/v) sucrose, glucosan 5kDa or trehalose dihydrate compound; The granule of rehydration has that larger than the complex of fresh preparation to be up to the Z-of 24 times average; Fig. 3 B illustrates the average-size shown in its intensity curve chart that be up to 9.5 times larger than the granule of fresh preparation; Fig. 3 C illustrates display polydispersity index (PDI) curve chart more than 0.35; The curve chart that display zeta potential is 0 or negative value is illustrated with Fig. 3 D.
Fig. 4 A-C.Fig. 4 A-C illustrate citric acid/trisodium citrate buffer agent that display adds pH4.5 or pH6.5 in the compositions comprising 0.5% freeze drying protectant cause in fresh sample form microscopic aggregates and freeze thawing after completely coalescent curve chart.
Fig. 5 A-B.Fig. 5 A illustrates the image that the chitosan/DNA complex showing fresh preparation has different shape; Fig. 5 B illustrates the ultimate density that L-Histidine that display adds pH6.5 reaches 13.75mM, cause formation slightly large, closer to the image of spherical nano-particle.
Fig. 6 A-C.Fig. 6 A-B illustrates curve chart, shows and does not cause to containing adding L-Histidine in the compositions of 0.5% freeze drying protectant coalescent curve chart occurs: in the compositions of fresh and freeze thawing, observe particle diameter have increased slightly; Fig. 6 C illustrate display PDI still lower than 0.35 curve chart.
Fig. 7 A-I.The illustrating of Fig. 7 A-C be presented at 0.5 or 1% (w/v) excipient and 13.75mM histidine existence under cryodesiccated nano-particle can not affect particle diameter by 10% rehydration being low to moderate its initial volume, but the curve chart that its PDI declines; Fig. 7 D-F illustrates display and comprises 0.5% (w/v) sucrose or trehalose dihydrate compound and the compositions of 13.75mM histidine and can be frozen and dryly become initial volume (Rh1X) or 20 times of (Rh20X) its initial concentrations with rehydration and without the curve chart of particles coalesce; Fig. 7 G-I illustrates display 0.5% (w/v) sucrose or trehalose dihydrate polymer composition can carry out lyophilization and without the curve chart of its particle diameter or PDI change with the least possible 3.44mML-histidine.
Fig. 8 A-GH.Before Fig. 8 A-C illustrates and is presented at complex formation, almost do not affect with excipient dilution chitosan and the nano particle diameter of DNA on fresh preparation, but the granule produced under the existence of L-Histidine has the curve chart of lower PDI, Fig. 8 D-H illustrates to show after the compositions containing 0.5% (w/v) sucrose or trehalose and 3.44mM histidine carries out Rh1X or Rh20X and does not observe change of size (mean diameter of Z-on average or in intensity), but the curve chart that PDI slightly reduces when Rh20X.With 0.5% (w/v) glucosan, granule is larger, but still keeps about 300nm, and PDI reduces 0.18 when being reduced to Rh20X from 0.4 when Rh1X.
Fig. 9 A-D.Fig. 9 A-B illustrates the curve chart represented according to the percentage ratio of the fresh control thing (without Lyo-His (0)-fresh) without excipient of display transfection efficiency and Luciferase expression levels, and tester has transfection efficiency and the 6.76E-5 μ Μ luciferase/mg protein expression level of total cell of 53%.Compositions containing 0.5% (w/v) freeze drying protectant had before lyophilization close to tester 100% transfection efficiency; and after freeze lower than 45% of tester, and simultaneously after lyophilization its luciferase expression lower than 25% of tester.Fig. 9 C-D illustrate compositions that display comprises the L-Histidine of 0.5% freeze drying protectant and 3.44mM simultaneously had before lyophilization close to tester 110% transfection efficiency; after equal-volume (Rh1X), exceed tester 80% in rehydration, and for the compositions comprising trehalose according to reach after 20X rehydration up to tester 77%.Compositions containing L-Histidine and sucrose or trehalose dihydrate compound has the Luciferase expression levels (116% to 66% of tester) being similar to tester, is then expressed as 57% to 12% of tester for those comprising glucosan 5kDa.
Figure 10 A-F.Figure 10 A-D illustrates display and contains the concentrated Nanoparticulate compositions of 0.5% trehalose dihydrate compound and 3.5mML-histidine by causing a small amount of increase of size and PDI after 20X multiplying factor rehydration, but the zeta potential of complex does not change; One or two continuous print lyophilization/rehydration circulation is used not have influential curve chart to reach final 20X concentration factor to nano-particle physical chemistry character; The compositions of Figure 10 E-F concentrated 20X after illustrating and being presented at single lyophilization (FD/Rh20x) has the transfection efficiency of tester 100%, and after two continuous print lyophilization cycle [Rh (10X+2X) and Rh (5X+4X)], they have the curve chart of the transfection efficiency of at least 85% of tester.All compositionss with 20X final concentration coefficient their lyophilizations once or twice time there is the Luciferase expression levels of tester 64% to 69%.
Figure 11 A-C.Illustrate in Figure 11 A-B be presented at comprise 1% or 2% (w/v) trehalose and 7 or 3.5mM histidine CS/siRNA compositions Rh1X or Rh20X after, for the siRNA concentration of 100 μ g/mL after granule formation, observe the curve chart of minimum particle size change (Z-is average).The PDI of these compositionss is less than 0.20 lower than 0.25 after Rh1X after Rh20X; Figure 11 C illustrate show comprise 1% trehalose and 7mML-histidine compositions after FD, retain silence efficiency, and remaining eGFP expression be untreated cell 52 to 47% between, no matter compositions is fresh, Rh1X or Rh10X.
Detailed description of the invention
The present invention comes from the following discovery of the present inventor: chitosan nucleic acid nano granule can be frozen dry and concentrated; without the generation of change of size or loss of biological activity or hyperosmotic solution after rehydration; condition is in the particle suspension liquid treating lyophilizing, there is suitable freeze drying protectant type and concentration, and Buffer types and concentration.
Therefore, one embodiment of the present invention provides such polyelectrolyte complex composition, which provides stability that compound polyelectrolyte increases in the solution and/or the compound polyelectrolyte resistance to the improvement of the physics in long term storage or chemical degradation.
Another embodiment of the invention provides so cryodesiccated polyelectrolyte complex composition, which provides compound polyelectrolyte stability in the solution and/or the compound polyelectrolyte resistance to the improvement of the physics in long term storage or chemical degradation.
In some these embodiments, compound polyelectrolyte is the compound polyelectrolyte based on polysaccharide.In some cases, compound polyelectrolyte is the compound polyelectrolyte between polysaccharide and nucleic acid.
As used herein, term " polyelectrolyte " refers to the polymer of its repetitive with electrolyte group.Therefore, polyelectrolyte comprises polycation and polyanion.These groups dissociation in aqueous, makes polymer belt electric charge.Therefore polyelectrolyte character be not only similar to electrolyte but also be similar to polymer.
As used herein, term " polysaccharide " refers to that be made up of the long-chain of the monosaccharide unit combined by glycosidic bond, obtain forming monosaccharide or oligosaccharide when being hydrolyzed molecule.
In some cases, polysaccharide is chitosan.As used herein, term " chitosan " refer to a kind of by random distribution-linear polysaccharide that forms of the GLUCOSAMINE (de-acetyl unit) of (1-4)-connect and N-acetyl group-GLUCOSAMINE (acetylated unit).It is usually by making with alkali sodium hydroxide process shrimp and other crustacean shells.Chitosan has beneficial property widely, comprises biocompatibility, biodegradability, mucoadhesive (mucoaadhesive) performance, antimicrobial/antifungal activity and unusual hypotoxicity.
The amount (degree of de-acetyl or DDA) of the amine groups on the molecular weight of chitosan and chain is to its biology and physiology characteristic having significant impact.Such as, the Content and distribution of acetyl group affects biodegradability, because there is not acetyl group or it is uniformly distributed (random instead of block) speed of enzymatic degradation can be caused very low.
In some practices of these embodiments, chitosan can comprise chemical modification.The example comprising the chitosan of chemical modification comprises, but be not limited to: there is following chitosan compounds: (i) can be covalently attached to chitin and/or chitosan or ion ground or hydrophobic to adhere to and the specificity of the chitosan compounds of nucleic acid or oligonucleotide compound or nonspecific cell-targeting part, (ii) the various derivant of chitin and chitosan or modification, it is for changing their physics, chemistry or physiological characteristics.The example of the chitosan of this modification is the chitosan compounds with the following: the reagent of long circulating half-life and chemical derivative (as salt, O-acetylation and N-acetyl derivatives) in specificity or non-specific targeting part, membrane permeablizer, Subcellular Localization assembly, molten endocytosis body (endosomolytic) (born of the same parents are molten) agent, nuclear localization signal, deflocculant, promotion blood.Some sites for the chemical modification of chitosan comprise: C 2(NH-CO-CH 3or NH 2), C 3or C (OH) 6(CH 2oH).
In some practice of these embodiments limited in this article, the specific mean molecule quantity (Mn) that chitosan has, it is that about 4kDa is to about between 200kDa, preferably about 5kDa is to about between 200kDa, more preferably from about 5kDa is to about between 100kDa, and more preferably from about 10kDa is to about between 80kDa.The concrete deacetylation (DDA) that chitosan has further for preferably about 70% to about between 100%, more preferably from about between 80% to 95%.
In some practice of these embodiments, nucleic acid is one or more in DNA (deoxyribonucleic acid) (DNA) and ribonucleic acid (RNA).Nucleic acid is such as one or more in plasmid (pDNA), micro-ring or oligodeoxynucleotide (ODN).Nucleic acid can also be one or more in small interference ribonucleic acid (siRNA) and bobby pin ribonucleic acid (shRNA) or Messenger RNA (mRNA).
Mol ratio (N/P ratio) according to the amine groups of polymer and the bound phosphate groups of nucleic acid is determined to enter the polymer of compositions as defined herein and the ratio of nucleic acid.In some embodiments, the N/P ratio of compositions as defined herein is for about 1.2 to about between 30, and preferred N/P ratio is for about 2 to about between 10, and more preferably N/P ratio is about 5.
Carry out the research [38-45] with chitosan/nucleic acid compound polyelectrolyte.These research relate to comprise nucleic acid (as, such as, DNA (deoxyribonucleic acid) or ribonucleic acid) and the chitosan of the number-average molecular weight (Mn) that has between 8 to 200kDa and the deacetylation between 72% to 95% (DDA) carry out the compositions (WO2009/0075383 and WO2012/159215) of high efficiency transfection.But these researchs had not both been considered not solve the multiple challenges relevant to these compositions long term stabilization effects yet.
Work on hand does not also solve the probability of being produced isotonic chitosan/nucleic acid compositions according to treatment concentration by the cryodesiccated compositions of rehydration in the volume reduced.Disaccharide (as sucrose or mannitol) will prevent coalescent and degree of functionality loss [8-10] of chitosan class polymer when lyophilization and short term stored (< 2 months).The pH of initial composition is very crucial for the state of chitosan hydrolyzate during lyophilization, once pH value of solution is down to 4.1 from 6, degradation rate increases by 30 times [2].In order to ensure enough cushioning effects of compositions, the molar concentration of buffer agent at least must equal the molar concentration of chitosan monomer, but will lower than 0.1M to prevent from competing with physiologic buffer in the final composition of injection, and other harmful effects.Chitosan hydrolyzate rate can increase along with HCl concentration and increase [18], and can reduce in the presence of the solvent, promotes that the center that compacter chitosan chain conformation, glycosidic bond are positioned at structure is not too easy to close to [19] for hydrolysis.
Retinol is packaged in the spherical nanoparticle formed in the chitosan (18kDa, 96%DDA) of water dissolvable, its lyophilizing subsequently 3 days, and is easy to rehydration under without any freeze drying protectant.Although these rehydration granules have slightly little average-size and Distribution Breadth, the zeta potential of lyophilizing on them does not affect, the retinol [46] of encapsulation of also not degrading.For the cryodesiccated chitosan (80kDa of oral insulin delivery, 85%DDA)/poly-(Y-glutamic acid) nano-particle is frozen dry in 1.5% trehalose, although and dry cake occurs to cave in by force, but the form (mean diameter < 245nm, PDI < 0.3) of size or rehydration complex or the reduction [47] of insulin content is not changed.Prove that chitosan nano particle is at acidic phs to hydrolysis-susceptible: pH=1.2, pellet degradation; When pH=2.0, they are 28% larger.With N-trimethyl chitosan TMC (TMC; 200kDa, 85%DDA, quaternization degree (DQ) 15% or 30%) or the compound polyelectrolyte that formed of TMC-cysteine conjugate (TMC-Cys) and insulin with 20 sucrose/insulin w/w ratio lyophilizing in sucrose, and after rehydration, do not change particle diameter, zeta potential or insulin packaging efficiency [48].Alginate (75-100kDa)/chitosan (65-90kDa, DDA > 80%) nano-particle for sending Gatifloxacin is formulated in 5%w/v mannitol, lyophilization room temperature for storage reaches 12 months.After initial volume rehydration, only observing particle diameter increases (from 345nm to 410nm) on a small quantity, and does not change its zeta potential or its external Gatifloxacin release profiles [49].Chitosan (the 10kDa of methoxyl group PEG-grafting; 97%DDA) polymer nano granules of the introducing methotrexate of co-polymer is through preparation; two days are being reached without lyophilizing under freeze drying protectant; rehydration in deionized water; and characterize subsequently: particle diameter is lower than 100nm; zeta potential value is between+20 to+40mV, and load efficiency is more than 65% [50].
As used herein, term " zeta potential " refers to the electrokinetic potential in colloidal dispersion.It uses the Zeta (ζ) of Greek alphabet to represent usually, is therefore Zeta-potential.Zeta potential be slip plane relative to bulk fluid away from the current potential in the interfacial bilayer (DL) of the position of the point at interface.Zeta potential is the potential difference between the Hydrostatic state layer of disperse medium and the granule being attached to dispersion.
The nano-particle producing chitosan and polyglycolic acid (PGA), α-PGA, the soluble-salt of PGA, the slaine of PGA or heparin is used for delivery of nucleic acids to be used for the treatment of osteoporosis to target site.Nano-particle has the average-size of 266nm, and can be frozen dry and rehydration in the trehalose being low to moderate 2.5%, size increase by 13%, or lyophilization and rehydration are in 2.5% mannitol, mean diameter increases by 57% (US7,901,711) [51].Chitosan (the 110kDa of PEGization, 87%DDA)/pDNA nano-particle lyophilizing is in 1% mannitol, and 4 DEG C or-20 DEG C store 1 month subsequently, or lyophilizing is in 40% sucrose, and at being stored in-20 DEG C subsequently, and do not change its size, zeta potential and transfection efficiency [8].Other nano-particle, DNA: chitosan (90kDa): cleavage of peptide (charge ratio 1:6:1-/+/-), lyophilization in 10% lactose after remain its size (300-350nm), and in rabbit, within 72 hours after oral giving, demonstrate report subbase because of expression in vivo (WO97/42975) [52] of CMV-CAT.
The research of the lyophilizing of chitosan (CS:170kDa, 84%DDA)/siRNA complex (N/P is than=50) shows, the sucrose of 10% is required for the particle diameter kept after rehydration.Complex particle diameter after adding sucrose of fresh preparation increases (126 to 169nm) a little, and after lyophilization and rehydration, be 142nm [9].When not having freeze drying protectant, the complex of rehydration is excessive for the particle size determination in dynamic light scattering (DLS).Sample gene is struck poor efficiency and is increased with the rising of siRNA concentration and the existence depending on sucrose: for lower siRNA concentration (< 25nm), the sucrose with 10% obtains the highest low rate (60%) of striking; For the highest siRNA concentration (50nM), 5% sucrose is enough to reach maximum and strikes poor efficiency (70%).When preparing chitosan/siRNA (50nm) complex in the sucrose of 5% or more, detect that the H1299 cell viability of 10% declines.The silencing activity that at room temperature storage reaches the sucrose composition of after 2 months 10% reaches 32% [9].
Illustrate, when in the solution of lyophilization at 0.05% (w/v) chitosan and 1% (w/v) polyvinyl alcohol (PVA), there are coalescent [10] in the PLGA complex for the chitosan coating of oligonucleotide delivery and siRNA.Be supplemented with the more concentrated composition of buffer agent in lyophilization: 0.25% (w/v) chitosan, also causing time in the acetic acid buffer of 10% (w/v) PVA and 0.5MpH4.4 and produce complex coalescent [53].Can pass through with the freeze drying protectant being greater than 5:1: nanosphere weight ratio adds coalescent [10] that produce after lyophilization avoided by mannitol.When there is not chitosan coat, by means of only coalescent [10] that use the freeze drying protectant nanosphere weight ratio being greater than 1:1 just can avoid the PLGA/ oligonucleotide granule after lyophilization.
Finally, chitosan/DNA complex pedological features is formed in Tris-HCl buffer agent, by centrifugal in aqueous medium and be separated, and is filled into (JP4354445) [54] in mould before without freeze drying protectant lyophilization.
In order to keep the physicochemical properties after polymer/nucleic acid polymer lyophilization of preparing according to dilution scheme and transfection efficiency, compositions needs the freeze drying protectant (disaccharide, trisaccharide or polyhydric alcohol) comprising the concentration becoming the isotonic injection of 0.5 to 1mgDNA/mL compatible with rehydration.The final dose of injection is therefore very limited, because cryodesiccated compositions rehydration can not become higher concentration and can not become highly high to ooze.Add buffer agent little to the nano-particle characteristics influence kept after lyophilization to high concentration freeze drying protectant.But, its existence may be needed to be the pH value of the compositions in order to control the rehydration before injection with lower frozen-dried protective agent concentration.Although glucosan/sucrose composition allows that 10 times of concentration rehydration of the compositions based on PEI of cryodesiccated branching are to nearly osmolality, but these compositionss are limited to glucosan and sucrose, and do not comprise any may for maintaining the particle diameter after lyophilizing and the necessary buffer agent of integrity.
In another embodiment, polyelectrolyte complex composition comprises polymer, nucleic acid molecules and freezing drying protective agent (freeze-dryingprotectant).As used herein, phrase " freezing drying protective agent " refers to the molecule of protection freeze-dried material.Freezing drying protective agent comprises, such as, and cryoprotective agent and freeze drying protectant (lyoprotectant).Known freeze drying protectant includes, but not limited to polyol, as sugar (monosaccharide, disaccharide and polysaccharide), polyhydric alcohol and derivant thereof.Trehalose and sucrose are natural freeze drying protectants.Trehalose is by various plants (such as Herba Selaginellae and arabidopsis), fungus and be in stagnant raw state (also referred to as anhydrobiosis) during a drought invertebrates in produce.In some practices of these embodiments, freeze drying protectant is one or more in disaccharide, trisaccharide, oligosaccharide/polysaccharide, polyhydric alcohol, polymer, high molecular weight excipients, amino acid molecular or their any combination.Disaccharide can be one or more in sucrose, trehalose, lactose, maltose, cellobiose and 6-(.alpha.-D-galactosido)-D-glucose..Disaccharide can be present in compositions of the present invention according to the concentration between about 0.1% (w/v) to about 10% (w/v), preferably between about 0.5% (w/v) to about 5% (w/v) more preferably from about between 0.5% (w/v) to about 2% (w/v).Trisaccharide can be one or more in maltotriose and Raffinose.Trisaccharide can exist according to the concentration between about 0.1% (w/v) to about 10% (w/v), preferably between about 0.5% (w/v) to about 5% (w/v) more preferably from about between 0.5% (w/v) to about 2% (w/v).Oligosaccharide/polysaccharide can be one or more in glucosan, cyclodextrin, maltodextrin, hetastarch, ficoll, cellulose, hydroxypropyl emthylcellulose and inulin.Oligosaccharide/polysaccharide can be present in compositions of the present invention according to the concentration between about 0.1% (w/v) to about 10% (w/v), preferably between about 0.5% (w/v) to about 5% (w/v) more preferably from about between 0.5% (w/v) to about 2% (w/v).Glucosan may be used for applying isotonic pressure to biomolecule.In some embodiments, glucosan has the mean molecule quantity (M between 1 to 70kDa, preferably between 1 to 5kDa n).Polyhydric alcohol can be one or more in mannitol and inositol.Polyhydric alcohol can be present in compositions of the present invention according to the concentration between about 0.1% (w/v) to about 10% (w/v), preferably between about 0.5% (w/v) to about 5% (w/v) more preferably from about between 2% (w/v) to about 3% (w/v).Amino acid molecular can be lysine, arginine, glycine, at least one in alanine and phenylalanine.Amino acid molecular can according to about 1mM to about between 100mM, preferably about 3mM to about between 14mM more preferably from about 3mM be present in compositions of the present invention to the concentration about between 4mM.High molecular weight excipients can be one or more in Polyethylene Glycol (PEG), gelatin, polydextrose and polyvinylpyrrolidone (PVP).
In some other embodiments, polyelectrolyte complex composition comprises polymer, nucleic acid molecules, freezing drying protective agent and buffer agent.Buffer agent for the present composition can comprise at least one in sodium citrate, histidine, natrium malicum, sodium tartrate and sodium bicarbonate.Buffer agent can according to about 1mM to about between 100mM, preferably about 3mM to about between 14mM, preferably about 3mM to about between 8mM more preferably from about 3mM be present in the compositions limited herein to the concentration about between 4mM.
Under the certain situation of these embodiments, polyelectrolyte complex composition comprises polymer, nucleic acid, trehalose and histidine.
Under the certain situation of these embodiments, polyelectrolyte complex composition comprises chitosan, nucleic acid, trehalose and histidine.
In other situations of these embodiments, polyelectrolyte complex composition comprises polymer, nucleic acid, content are about 0.5% (w/v) to about 2% (w/v) trehalose and content is the histidine of about 3mM to about 8mM.
In other situations of these embodiments, the trehalose that polyelectrolyte complex composition comprises chitosan, nucleic acid, content are about 0.5% (w/v) to about 2% (w/v) and content are the histidine of about 3mM to about 8mM.
In other situations of these embodiments, the DNA (deoxyribonucleic acid) that polyelectrolyte complex composition comprises chitosan, content is about 50 μ g/mL, content be about 0.5% (w/v) to the trehalose of about 1% (w/v) and content be the histidine of about 3mM to about 4mM.
In other situations of these embodiments, polyelectrolyte complex composition comprises chitosan, and the trehalose that content is the ribonucleic acid of about 100 μ g/mL, content is about 1% (w/v) to about 2% (w/v) and content are the histidine of about 6mM to about 8mM.
In other cases, polyelectrolyte complex composition comprises polymer, nucleic acid, sucrose and histidine.
In other cases, polyelectrolyte complex composition comprises chitosan, nucleic acid, sucrose and histidine.
In other cases, the sucrose that polyelectrolyte complex composition comprises polymer, nucleic acid, content are about 0.5 (w/v) to about 2% (w/v) and content are the histidine of about 3mM to about 4mM.
In other cases, the sucrose that polyelectrolyte complex composition comprises chitosan, nucleic acid, content are about 0.5 (w/v) to about 2% (w/v) and content are the histidine of about 3mM to about 4mM.
In some practice according to the present embodiment, polyelectrolyte complex composition is cryodesiccated.As being appreciated that, lyophilization (freeze-drying), also be known as lyophilizing (lyophilisation), cold dry (lyophilization) or lyophilizing (cryodesiccation), be used to preserve perishables or make transport of materials dehydrating process more easily.Lyophilization is by refrigeration material and reduce the pressure of surrounding subsequently and make the water that freezes in material directly be sublimate into gas phase from solid phase and play a role.
Cryodesiccated technical process may relate to the pre-treatment step being included in freezing any method for the treatment of product before.This step may relate to such as, but not limited to, add component and increase stability and/or improve processed, reduce high-vapor-pressure solvent or increase the operation of surface area.The method of pre-treatment comprises: freeze concentration, solution mutually concentrated, preparation to preserve product appearance, preparation to stablize reactive product, preparation to increase surface area and to reduce high vapor pressure solvent.
In small-scale, usually by be positioned over by material in lyophilization flask and rotary flask carries out freezing in bathing, cooling bath is called shell-type fridge, by mechanical refrigeration, dry ice and methanol or cooled with liquid nitrogen.On a larger scale, freezer dryer is usually used to complete freezing.In this step, it is very important for material being cooled to the minimum temperature that solid phase and liquid phase lower than its three phase point, namely material can coexist.Which ensure that generation distillation instead of fusing in step then.Larger crystal is easier to lyophilization.
At first drying stage, pressure reduces, and supplies enough heats to material and supply water sublimate.The distillation " latent heat " of distillation molecule can be used to calculate necessary heat.At this initial drying stage, the water in material about 95% distillation.In this stage, by applying portion vacuum control pressure.Vacuum accelerates sublimation, makes it can be used as well-designed drying process.In addition, cold condensation chamber and/or cold plate provide water vapour to solidify one or more surfaces thereon again.Second drying stage is intended to remove the hydrone do not frozen, because ice can be removed in first drying stage.This part of freezing dry process is by the adsorption isotherm line traffic control of material.At this stage, temperature raises higher than first drying stage, even more than 0 DEG C, can interact to break any physical chemistry formed between hydrone and frozen matter.
Suitable freezer dryer includes but not limited to manifold freezer dryer, spin refrigeration drying machine and disc type freezer dryer.
In another embodiment, present invention also offers the method preparing compound polyelectrolyte and the polyelectrolyte complex composition limited herein.In the one practice of this embodiment, method comprises prepares polymer composition and nucleic acid compositions; Polymer and nucleic acid compositions are mixed to form polyelectrolyte complex composition.The polyelectrolyte complex composition of gained can carry out lyophilization subsequently.
In some practices of these embodiments, the step that method comprises wherein dissolve polymer and the polymer wherein dissolved mix with suitable freezing drying protective agent and suitable buffer agent and make it to be formed the step of polymer composition.Method also comprises its nucleic acid molecule and mixes with suitable freezing drying protective agent and suitable buffer agent and make it to be formed the step of nucleic acid compositions.Polymer and nucleic acid compositions mix to form polyelectrolyte complex composition subsequently.The polyelectrolyte complex composition of gained can carry out lyophilization subsequently.
In another practice, the step that method comprises wherein chitosan dissolving and the chitosan wherein dissolved mix with suitable freeze drying protectant and suitable buffer agent and make it to be formed the step of chitosan composite.Method also comprises its nucleic acid molecule and mixes with suitable freeze drying protectant and suitable buffer agent and make it to be formed the step of nucleic acid compositions.Then chitosan and nucleic acid compositions mix to form polyelectrolyte complex composition.The polyelectrolyte complex composition obtained
Present invention also offers and manufacture goods or commercial packing or test kit, comprise the label on one or more container, container, as defined herein polyelectrolyte complex composition and operation instructions.Except polyelectrolyte composite combined beyond the region of objective existence as defined herein, manufacture goods or commercial packing or test kit and can also comprise the water reconstructing polyelectrolyte complex composition before the use.
Present invention also offers and manufacture goods or commercial packing or test kit, comprise the label on one or more container, container, cryodesiccated polyelectrolyte complex composition as defined herein and operation instructions.Except cryodesiccated polyelectrolyte composite combined beyond the region of objective existence as defined herein, manufacture goods or commercial packing or test kit and can also comprise the water reconstructing polyelectrolyte complex composition before the use.Suitable
In some practices of these embodiments, water is suitable for injecting to experimenter.Polyelectrolyte complex composition can reconstruct in water according to the concentration of 5 times, 6 times, 7 times, 8 times, 9 times, 10 times, 11 times, 12 times, 13 times, 14 times, 15 times, 16 times, 17 times, 18 times, 19 times or 20 times initial concentrations.Polyelectrolyte complex composition according to the concentration of 25 times, 30 times, 35 times, 40 times, 45 times, 50 times, 55 times or 60 times initial concentrations by performing more than one reconstruction cycle, as such as, can reconstruct in water by performing 2 reconstruction cycle.
Polyelectrolyte complex composition as defined herein can be prepared to produce the little and nano-particle of size uniform for delivery of nucleic acids under diluting condition (e.g., such as but not limited to, about 100 μ g nucleic acid/mL, are specific to often kind of compositions).Cryodesiccated and the compositions of rehydration can have little nanoparticle size and low polydispersity index.
As used herein, term " polydispersity " or " polydispersity index " (PDI) refer to measuring of the distribution of molecular mass in given polymer samples.The PDI calculated is that weight average molecular weight is divided by number-average molecular weight.It represents the distribution of each molecular mass in a collection of polymer.PDI has value and equals 1 or be greater than 1, but because polymer chain is close to uniform chain length, PDI is tending towards one (1).
In some practice of these embodiments, it is one or more that compositions as defined herein that is fresh preparation, cryodesiccated and/or rehydration has with in properties:
A) they have positive zeta potential and cellular uptake during promoting transfection.Zeta potential is enough high to guarantee that complex is formed and short-term stability between lyophilization and complex rehydration and injection.
B) they show the even lyophilizing of nano-particle and make detect minimum after lyophilization and rehydration in compositions or do not detect coalescent.
C) they maintain the biologic activity of compound polyelectrolyte after lyophilization and rehydration.
The phrase as used in this article " biologic activity " mentioned as the compound polyelectrolyte limited herein refers to the ability as biology of the compound polyelectrolyte limited, cytology or pharmacy herein, particularly when sending plasmid DNA their marking proteins ability (transfection efficiency) and when sending siRNA by the ability that RNAi silent gene is expressed, all can not cause bad toxicity or immunoreation under both of these case.These biologic activity should preferably retain together with one or more in attribute A-G.
D) in order to the ease for use in clinic, as the cryodesiccated compositions limited herein being conveniently injected into Perfect Reconstruction in the finite time in experimenter.
E) in order to when it uses in clinic by limited volume injected to reach at its therapeutic dose, the polyelectrolyte complex composition as the rehydration limited herein has maximum nucleic acid concentration.
F) their excipient with minimum with rehydration to during higher final nucleic acid concentration close to isotonic.Specifically, the preparation of rehydration be closely isotonic and inject time minimize cell injury, patient's sense of discomfort or pain.
G) the polyelectrolyte complex composition as the rehydration limited herein has close to pH neutral to minimize cell injury, patient's sense of discomfort or pain when injecting.Specifically, can be slightly acidic to prevent polycation or nanoparticle precipitate in solution as the compositions limited herein.
In some practice of these embodiments, reveal in the physicochemical properties of following nano-particle as fresh, freeze thawing and/or the compositions table that is cryodesiccated and rehydration limited herein one or more:
A) nano-particle Z-on average lower than 750nm, preferably lower than 500nm, more preferably less than 250nm.Such as can measure nano-particle Z-by DLS average.
B) the average polydispersity index of nano-particle (PDI) be at the most 0.5, preferably at the most 0.35, most preferably at the most 0.25.Such as can evaluate nano-particle mean P DI by DLS.
C) the average zeta potential of nano-particle is the short-term stability being just enough to guarantee compositions.Such as can evaluate the average zeta potential of nano-particle by LDV.
D) compositions of the present invention is essentially no coalescent.Such as can evaluate coalescent existence by ESEM.
Nano-particle as the compositions limited herein also show in following external efficiency standard one or more:
A) transfection level that the transfection level that they show is greater than about 10%, be preferably greater than about 25%, be most preferably greater than the new polyelectrolyte particles without excipient of about 50%.Such as can evaluate transfection level by flow cytometer.
B) Luciferase expression levels that they show is greater than 10%, be preferably greater than 25% and be most preferably greater than 50% the expression without the fresh CS/DNA granule of excipient.Such as can evaluate Luciferase expression levels by luminescence method.
C) silence efficiency that the silence efficiency that they show is greater than 10%, be preferably greater than 25%, be most preferably greater than the fresh polyelectrolyte particles of 50%.Such as can evaluate silence efficiency by flow cytometer.
Show after the compositions rehydration limited herein in following character standard one or more and make them be suitable for Clinical practice:
A) cryodesiccated cake in about 10min, more preferably from about 9min, more preferably from about 8min, more preferably from about 7min, more preferably from about 6min most preferably from about Perfect Reconstruction in 5 minutes.The level that can be reconstructed by visual inspection evaluation when reconstructing.
B) final nucleic acid concentration be at least 0.1mg/mL, preferably at least 0.2mg/mL, more preferably at least 0.3mg/mL, more preferably at least 0.4mg/mL and most preferably at least 0.5mg/mL.Can by initial DNA content and the final DNA concentration of rehydration coefficient determination used.In some cases, final DNA concentration be at least 0.1mg/mL, preferably at least 0.2mg/mL, more preferably at least 0.3mg/mL, more preferably at least 0.4mg/mL and most preferably at least 0.5mg/mL.Final RNA concentration can be measured by initial DNA content and rehydration coefficient used.In some other cases, final RNA concentration be at least 0.1mg/mL, preferably at least 0.2mg/mL, more preferably at least 0.3mg/mL, more preferably at least 0.4mg/mL and most preferably at least 0.5mg/mL.Can by Initial R NA content and the final RNA concentration of rehydration coefficient determination used.
C) compositions as the rehydration limited herein is closely isotonic.In some cases, the osmolality that the compositions as the rehydration limited herein has, its for about between 100 to 750mOsm, preferably about between 150 to 500mOsm most preferably from about 200 to about 400mOsm.The osmolality of the compositions of the osmolality model determination rehydration of compositions can be used.
D) compositions as the rehydration limited herein has near-neutral pH.In in concrete, the compositions as the rehydration limited herein has between pH5 to 8, more preferably between 5.5 to 7.5, most preferably between 6 to 7.PH meter can be used to measure the pH of the compositions of rehydration.
In certain embodiments of the present invention, use in the treatment of disease or disease in experimenter as the compositions limited herein, wherein experimenter is animals or humans.As used herein, " treatment (treatment) " and " disposing (treating) " comprise prevention, suppression and the alleviation disease relevant with disease or disease and symptom.The compositions described herein by giving to treat effective dose can be carried out and implement treatment.In some cases, be suitable for being injected into experimenter as animal or human's apoplexy due to endogenous wind as the compositions limited herein.Injection can be in Intradermal, subcutaneous, intramuscular, intravenous, bone, in intraperitoneal, sheath, epidural, in intracardiac, intraarticular, spongy body or in vitreous body.
In some cases, may be used for gene therapy as the compositions limited herein.Term " gene therapy " as used herein refers to and uses nucleic acid if DNA is as medicine, carrys out disease therapy by being sent to enter in subject cell by therapeutic nucleic acids.The most common form of gene therapy relates to use encode functional, the nucleic acid of therapeutic genes carrys out Substitution gene.Other forms relate to direct correcting mutant, or use the DNA of encode therapeutic proteins matter medicine (instead of natural human genoid) to provide treatment.
Description of the invention will be easier to understand by referring to following examples, and these embodiments are provided for illustrating the present invention and its scope unrestricted.
Experiment and data analysis
The preparation of polyelectrolyte complex composition
Room temperature chitosan (M n10kDa, 92%DDA) weigh in 4-mLLabFile vial and Milli-Q water and HCl1N are added each bottle.Final chitosan concentration is 5mg/mL, and wherein HCl ultimate density is 28mM.Bottle to be placed on rotator and at room temperature to stir and spends the night to guarantee to dissolve completely.Filter-sterilized chitosan stock solution.
In a case where excipient is joined in compositions: 1) after complex is formed; Or 2) complex formed before, when dilute chitosan and DNA time or 3) siRNA stock solution:
1) under laminar flow hood, with Milli-Q water dilution chitosan stock solution to 271 μ g/mL, and according to 100 μ g/mL, 100 μ L are mixed to form N/P than the complex being 5 with the plasmid DNA (pEGFPLuc) of 100 μ L subsequently.By immediately drawing solution being mixed for about 10 times after adding chitosan.Sample room temperature is placed and is stablized 30 minutes, and following 400 μ L:Milli-Q water that are settled to of sample volume subsequently; And/or aseptic 2%, 4% or 20% (w/v) mannitol, sucrose, glucosan 5kDa or trehalose dihydrate compound; And/or the 70mM citric acid/trisodium citrate buffer agent of pH4.5 or 6.5; Or 13.75 of pH6.5,27.5 or 55mML-histidine.
2) under laminar flow hood, 271 μ g/mL:Milli-Q water are diluted to following on demand according to identical method chitosan original solution; And/or aseptic 2%, 4% or 20% (w/v) sucrose, glucosan 5kDa or trehalose dihydrate compound; And/or 13.75 of pH6.5 or 55mML-histidine.According to same procedure, 200 μ g/mLDNA stock solutions are diluted to 100 μ g/mL.Then, the DNA compositions of the chitosan composite of 100 μ L with 100 μ L is mixed, to form N/P than the complex being 5.By immediately solution suction about 10 times being mixed after adding chitosan.Sample room temperature is placed and stablizes 30 minutes.
3) under laminar flow hood, chitosan original solution is diluted to 271 or 542 μ g/mL with following on demand: deoxyribonuclease (RNase) water; Aseptic 8% (w/v) glucosan 5kDa and/or trehalose dihydrate compound; With the 14mML-histidine of pH6.5.According to identical method, 1mg/mLsiRNA stock solution is diluted to 100 or 200 μ g/mL.Then, the siRNA compositions of the chitosan composite of 100 μ L with 100 μ L is mixed, to form N/P than the complex being 5.By immediately solution suction about 10 times being mixed after adding chitosan.Sample room temperature is placed and stablizes 30 minutes.
To treat that the sample of freeze thawing is transferred in 1.5mL cryovial, and with the rate freezers of-1 DEG C/min to-80 DEG C, continue at least 2 hours.Sample thaw at RT 30 minutes before use.
The sample of drying to be frozen to be transferred in the serum bottle of 2mL and with the lyophilization stopper lyophilization of 13mm butyl and to prevent dust or germ contamination on tray water permeability film being positioned over splendid attire all samples.Lyophilization is implemented in one of two circulations below MillrockLaboratorySeries freezer dryer PC/PLC uses:
1) in 1 hour, be cooled to-40 DEG C from room temperature gradient, then keep constant temperature to continue 2 hours at-40 DEG C; At-40 DEG C, preliminarily dried 48 hours under 100 millitorrs; Carry out redrying with under 100 millitorrs, in 12 hours, be warming up to 30 DEG C, and subsequently 30 DEG C keep constant temperature 6 hours.
2) step is chilled to 5 DEG C and keeps isothermal 30 minutes, and step is cooled to-5 DEG C and keeps isothermal 30 minutes, is then cooled to-40 DEG C at 35 minutes inside gradients, and keeps isothermal 2 hours; At-40 DEG C, preliminarily dried 48 hours under 100 millitorrs; With redrying under 100 millitorrs, in 12 hours, temperature is increased to 30 DEG C, and keeps constant temperature 30 DEG C to reach 6 hours subsequently.
Sample clogs, be pressed into little pleat (crimp) and be stored in 4 DEG C until use.Use first 15 to 30 minutes, sample use being waited as required ought in the volume rehydration of the Milli-Q water of 100%, 20%, 10% or 5% of its initial volume.
By dynamic light scattering (DLS) to 40 μ L or 400 μ L sample determination particle diameters and polydispersity (PDI).The part of whole sample or sample is diluted for measuring with Milli-Q water or excipient.On instrument, Diluent Viscosity is regulated according to the type of excipient and ultimate density during granularmetric analysis.For each sample, at 25 DEG C, complete at least twice continuous dimension analysis, each analysis obtained by 12 to 20 continuous-readings (10s photon counting/reading) through average to obtain data set.Analyzed the number of required continuous-reading by installation optimization at every turn.By correlation function derivation Z-average diameter, particle size distribution intensity and PDI.
Granule zeta potential or surface charge is measured by LDV.Whole sample is diluted to have the sample that 800 μ L comprise 10mMNaCl with Milli-Q water and NaCl solution.In instrument, Diluent Viscosity is regulated according to the type of excipient and ultimate density thereof.For each sample, complete continuous three zeta potential analyses at 25 DEG C, each analysis of 10 to 20 continuous-reading acquisitions is passed through average to obtain data set.Analyzed the number of required continuous-reading by installation optimization at every turn.
By the form of environmental scanning electron microscope (ESEM) imaging in evaluation nano-particle.Use gas atomization method on the wafer of polishing, pulverize the sample of small size, and use golden splash coating subsequently.The fine vacuum pattern of ESEM is used to observe for larger resolution.Vacuum observation parameter is as follows: accelerating potential=20kV; Spot size=3; Operating distance ~ 5mm.
Use the pH of Microelectrode different components, require that the sample of at least 100 μ L could obtain measurement result.
In view of bulk sample relates to the osmolality measured according to the cryodesiccated sample of its initial concentration 20 times of rehydration, and the infiltrative impact of nano-particle on fresh solution obviously can be ignored, only use excipient development model to estimate compositions osmolality.The osmolality of the serial dilutions of sucrose, glucosan 5kDa, trehalose dihydrate compound and L-Histidine is used for setting up additive model, and it is verified by the compositions of the 35mML-histidine comprising 5% (w/v) glucosan, 5% (w/v) trehalose dihydrate compound and pH6.5 subsequently.Subsequently with comprising the compositions of 3.44mM histidine pH6.5 and 0.5% (w/v) sucrose, glucosan or trehalose, lyophilization and rehydration more than 5 times concentration checkings in the precision estimating to have model in the compositions of the DNA/mL nano-particle of 50 μ g.Be acceptable for the combinations thereof object model comprising sucrose or trehalose, osmotic pressure underestimates 6 and 8% respectively, but not enough for the compositions containing glucosan, underestimates osmolality 57%.
The transfection efficiency of end user's embryonic kidney 293 (HEK293) cell evaluation group compound and gene expression dose.HEK293 cell grows in the DMEM high glucose of pH7.4 being supplemented with 10% hyclone (FBS), and at 37 DEG C, 5%CO 2middle cultivation.First 24 hours of transfection, by 60,000 cells/well is inoculated in 24-wellhole orifice plate, and transfection to reach about 50% the same day converges (about every 150000, hole cell).Each sample is used for two wellholes of transfection 24-wellhole orifice plate: one for transfection efficiency analysis in flow cytometer, it is quantitative that the opposing party is used for luciferase expression.In each hole, together with transfection media (being supplemented with the DMEM high glucose of the pH6.5 of 10%FBS), add the Nanoparticulate compositions of precise volumes, to have the transfection media comprising 2.5 μ gDNA and the sample of total 500 μ L.Cell is then at 37 DEG C, 5%CO 2lower cultivation 24 hours, and replace transfection media with the growth medium of 500 μ L subsequently.Before analysis at 37 DEG C, 5%CO 2lower other cultured cell 24 hours.
Transfection efficiency is measured in flow cytometer.Each sample collection 20,000 event, and after use 488nm argon laser excites the green fluorescent protein (EGFP) strengthened in transfectional cell, measure fluorescence by the 510/20nm band filter with photomultiplier tube.Non-transfected cell is used to measure HEK293 cell line autofluorescence, and corresponding adjustment fluoroscopic examination door.Forward scatter (FSC) and lateral scattering (SSC) are also for getting rid of dead cell and fragment in the event from record.Finally, when usage data analyzes transfection efficiency, FSC is used for identifying from event and getting rid of bimodal.
By using Bright-Glo tMluciferase protein content in the quantitative sample of luciferase assay, and assess gene expression based on the total protein content normalization at each sample, as with bicinchoninic acid (BCA) assay.From comprise transfection sample to be analyzed every hole remove growth medium; With the PBS washed cell twice of 100 μ LpH7.4; Under room temperature, every hole uses 100 μ L lattice Lip river molten born of the same parents (GloLysis) buffer agent dissolved cell 5 minutes; And until analyze at subsequently cell lysate being stored in-20 DEG C.At room temperature thaw lysate.The expression of luciferase is measured: the Bright-PL of 25 μ L in white 96-wellhole orifice plate tMluciferase reagent mixes with the cell lysate of 25 μ L, and measures luminescence subsequently.Luciferase content is expressed according to relative light unit/min (RLU/min) or is used the standard curve be made up of the serial dilutions of the restructuring luciferase standard of concentration known to convert μ g to.Protein content is measured: the BCA working reagent of 200 μ L mixes with the cell lysate of 25 μ L in transparent 96-wellhole orifice plate; Sample is at 37 DEG C, 5%CO 2middle cultivation 30 minutes, and be cooled to room temperature subsequently; Be determined at the absorbance at 562nm place.Preparation standard curve, it is prepared by the serial dilutions of use 200 μ g/mL bovine serum albumin (BSA) standard, and along sample analysis so that absorbance reading is converted to protein concentration.
Use the silence efficiency of green fluorescent protein positive human non-fire power (the positive H1299 of eGFP) the cell evaluation group compound strengthened.
Growth of Cells is in the RPMI-1640 of pH7.4, and it is supplemented with 10% hyclone (FBS), and at 37 DEG C, 5%CO 2middle cultivation.First 24 hours of transfection, by 45,000 cells/well is inoculated in 24-wellhole orifice plate, and makes it transfection and reached about 75% to 85% the same day and converge.In each wellhole, add the Nanoparticulate compositions of precise volumes, together with the DMEM high glucose (without FBS) of pH6.5, to have culture medium and the sample that total 500 μ L comprises the siRNA of 100nM.Then by cell at 37 DEG C, 5%CO 2middle cultivation 4 hours, supplements 55 μ LFBS, and subsequently before analysis at 37 DEG C, 5%CO 2in cultivate 44 hours again.Survey cell instrument by streaming and measure silence efficiency.Each sample collection 10,000 event, and after use 488nm argon laser excites the green fluorescent protein (EGFP) strengthened in transfectional cell, measure fluorescence by the 510/20nm band filter with photomultiplier tube.Calculate the average decrease relative to the eGFP intensity of untreated cell.Forward scatter (FSC) and lateral scattering (SSC) are also for getting rid of dead cell and fragment in the event from record.Finally, when usage data analyzes transfection efficiency, FSC is used for identifying from event and getting rid of bimodal.
Embodiment
Embodiment 1
Freeze drying protectant prevents nano-particle after freeze-thaw cycle coalescent and maintains transfection efficiency
The preparation of 1-chitosan/DNA Nanoparticulate compositions
Chitosan (Mn10kDa, 92%DDA) is at room temperature dissolved in HCl the final chitosan concentration spending the night to obtain 5mg/mL.Stock solution is diluted to 271 μ g/mL, and 100 μ L mix according to 100 μ g/mL with the plasmid DNA (pEGFPLuc) of 100 μ L subsequently, to form N/P than the complex being 5.By immediately solution suction being implemented mixing about 10 times after adding chitosan.Sample room temperature is placed and is stablized 30 minutes, and subsequently according to table 1, sample volume aseptic Milli-Q water and/or aseptic 20% (w/v) mannitol, 20% (w/v) sucrose, 20% (w/v) glucosan 5kDa or 20% (w/v) trehalose dihydrate compound are settled to 400 μ L.
The compositions comprising freeze drying protectant that table 1. is to be analyzed before and after freeze thawing
2-sample freeze thawing (without dry)
Will the sample of freeze thawing to be transferred in 1.5mL cryovial and according to-1 DEG C/min be refrigerated to-80 DEG C at least 2 hours.Sample thaw at RT 30 minutes before use.
3-DLS measures
According to the concentration range of 0.1% to 10% (w/v), start with mannitol, sucrose and glucosan 5kDa the screening carrying out freeze drying protectant.Test trehalose dihydrate compound subsequently; but concentration range is only 0.1% to 3% (w/v); because remain unchanged higher than the upper limit to the particle diameter that first three freeze drying protectant measures, between screening, therefore add more freeze drying protectant be considered to unnecessary.Each compositions analyzes four samples: two fresh preparations with two through a freeze-thaw cycle.For each sample, complete twice continuous DLS dimension analysis, each 12 to 20 continuous-readings (10 seconds photon counting/readings) that are obtained from pass through average to obtain data set.Analyzed the number of required continuous-reading by instrument optimization at every turn.Correlation function derivation average-size intensity (meansizeinintensity) obtained by data centralization.The compositions not comprising freeze drying protectant occurs coalescent when showing freeze thawing, wherein particle diameter increase about 5 times.Comprise at least 1% (w/v) mannitol, 0.5% (w/v) sucrose, 0.5% (w/v) glucosan 5kDa or 0.1% (w/v) trehalose dihydrate compound compositions maintain nano particle diameter intensity after freeze-thaw lower than 150nm.Under higher frozen-dried protective agent content, between these samples (± 125nm), do not observe change of size.Mannitol is least effective freeze drying protectant, with 0.1 or 0.5% (w/v) concentration freeze thawing after granule be greater than 300nm (Figure 1A).
4-ESEM imaging
In the compositions of freeze thawing fore-and-aft observing without freeze drying protectant, the sample comprising low (1% (w/v)) and high (10% (w/v)) mannitol, sucrose or glucosan 5 after simultaneously observing freeze thawing.Use gas atomization method on polished wafer, pulverize the sample of small size, and sputter coated with gold again.For larger resolution, the fine vacuum pattern of environment for use scanning electron microscope (ESEM) is observed.Fine vacuum observation parameter is as follows: accelerating potential=20kV, spot size=3; Operating distance ~ 5mm.The complex size that there is lower fresh preparation without freeze drying protectant is less than 200nm and has different forms (spherical, bar-shaped or annular), and they mostly form large sphere aggregates (being greater than 500nm) after freeze thawing simultaneously.The sample of 1 or 10% freeze thawing in freeze drying protectant is closer to spherical and keep being less than 200nm (Fig. 2 A-H).The complex prepared in 1%w/v mannitol seems to be a bit larger tham the complex of preparation in sucrose or glucosan 5, as previously seen in DLS.
5-in-vitro transfection
Test pack is not in vitro had to contain the compositions of mannitol, because they are least effective in maintenance particle diameter after freeze-thaw, as previous finding.Only have and confirm that particle diameter keeps below 200nm after freeze-thaw, and the compositions comprising 3% (w/v) freeze drying protectant at the most carries out testing in vitro.They are: 0.5% to 3% (w/v) sucrose; 0.5% to 3% (w/v) glucosan 5; With 0.1% to 3% (w/v) trehalose dihydrate compound.HEK293 cell, is grown in the DMEM high glucose of the pH7.4 being supplemented with 10% hyclone (FBS), and at 37 DEG C, 5%CO 2middle cultivation, is used in vitro study.By 60 before transfection, 000 cell is inoculated in each wellhole of 24 orifice plates for 24 hours, converges for transfection (about 150000 cells/well) to reach about 50%.Two wellholes with each sample transfection 24-wellhole orifice plate: one for transfection efficiency analysis in flow cytometer, the opposing party be used for luciferase expression quantitative.In each hole, together with transfection media (being supplemented with the DMEM high glucose of the pH6.5 of 10%FBS), add the Nanoparticulate compositions of precise volumes, to have the transfection media comprising 2.5 μ gDNA and the sample of total 500 μ L.Cell is then at 37 DEG C, 5%CO 2lower cultivation 24 hours, and replace transfection media with 500 μ L growth mediums subsequently.Cell is at 37 DEG C, 5%CO before analysis 2lower cultivation in addition 24 hours.
6-transfection efficiency
Use cells were tested by flow cytometry transfection efficiency.Sample preparation: remove growth medium from each hole comprising sample to be analyzed; The cell phosphate buffered saline (PBS) (PBS) of 100 μ LpH7.4 rinses; They use 100 μ L trypsin/EDTA/ holes to carry out trypsin treatment 5 minutes at 37 DEG C; Then add 100 μ L growth mediums and whole sample is transferred in cell counting pipe.Cells were tested by flow cytometry: each sample collection 20000 events, and used in the cell of 488nm argon laser in transfection after green fluorescent protein (EGFP) excites by the 510/20nm band filter with photomultiplier tube and measure fluorescence.Non-transfected cell is used to measure HEK293 cell line autofluorescence, and corresponding adjustment fluoroscopic examination door.Forward scatter (FSC) and lateral scattering (SSC) are also for getting rid of dead cell and fragment in the event from record.Finally, when usage data analyzes transfection efficiency, FSC is used for identifying from event and getting rid of bimodal.The percentage rate of transfectional cell in freeze thawing compositions is expressed relative to the percentage rate (it has the transfection efficiency of total cell 43%) of the transfectional cell obtained with the complex of the fresh preparation without freeze drying protectant (0FT).All transfection efficiency is maintained, the transfection level at least 87% of the complex of wherein fresh preparation after testing in vitro all comprise the compositions freeze thawing of freeze drying protectant.Under existing without freeze drying protectant, the nano-particle of freeze thawing has the transfection level (Figure 1B) of 25% of the transfection level of the complex for only new preparation.
7-luciferase expression
Use Bright-Glo tMluciferase assay measures luciferase expression (in relative light unit (RLU/min) per minute), and based on the total protein content normalization of each sample, this use bicinchoninic acid (BCA) assay.Sample preparation: remove growth medium from the every hole comprising sample to be analyzed; Cell is washed twice with the PBS of 100 μ LpH7.4; Under room temperature, every hole uses 100 μ LGloLysis buffer agent dissolved cell 5 minutes; Subsequently cell lysate is stored at-20 DEG C until analyze.At room temperature thaw lysate before use.The expression of luciferase is quantitative: in white 96-wellhole orifice plate, the Bright-PL of 25 μ L tMluciferase reagent mixes with 25 μ L cell lysates, and measures luminescence subsequently.Protein content is quantitative: in transparent 96-wellhole orifice plate, is mixed by the BCA working reagent of 200 μ L with 25 μ L cell lysates; Sample is at 37 DEG C, 5%CO 2middle cultivation 30 minutes, and be cooled to room temperature subsequently; Be determined at the absorbance at 562nm place.Preparation standard curve, it is prepared by the serial dilutions of use 200 μ g/mL bovine serum albumin (BSA) standard, and along sample analysis so that absorbance reading is converted to protein concentration.For not existing under freeze drying protectant (0FT) based on value (it has 8.03E10RLU/minmg protein expression level) the normalization Luciferase expression levels that fresh chitosan/DNA complex obtains.The expression of luciferase is similar between fresh complex and the complex without freeze thawing under freeze drying protectant; except the sample prepared with 1% and 3% (w/v) trehalose, it has the expression than fresh control thing low 40% to 60% respectively.Without few 75% (Fig. 1 C) of luciferase that the sample of freeze drying protectant freeze thawing is expressed than fresh control thing.
The performance of 22 kinds of different components of test in table 2 embodiment 1.
Embodiment 2
Low freeze drying protectant content composition coalescent after preventing nano-particle freeze thawing can not prevent during lyophilizing coalescent.
The preparation of 1-chitosan/DNA Nanoparticulate compositions
Do not contain freeze drying protectant (compositions #1) according to the description preparation in embodiment 1 or comprise 0.5% (w/v) sucrose (compositions #9), the Nanoparticulate compositions of 0.5% (w/v) glucosan 5 (compositions #15) or 0.5% (w/v) trehalose dihydrate compound (compositions #21).The sample of drying to be frozen to be transferred in 2mL serum vial and with the lyophilization of 13mm butyl lyophilization stopper, and water permeable membrane is positioned over all samples is housed tray on prevent dust or germ contamination.
The lyophilization of 2-sample
MillrockLaboratorySeries freezer dryer PC/PLC use following circulation implement lyophilization: in 1 hour, be cooled to-40 DEG C from room temperature gradient, then maintenance constant temperature at-40 DEG C 2 hours; At-40 DEG C, preliminarily dried 48 hours under 100 millitorrs; Carry out redrying with under 100 millitorrs, in 12 hours, be warming up to 30 DEG C, and subsequently 30 DEG C keep constant temperature 6 hours.Sample clogs, be pressed into little pleat and be stored in 4 DEG C until use.Use first 15 to 30 minutes, sample etc. is carried out lyophilizing after the volume rehydration of the Milli-Q water in its initial volume.Although all samples is rehydration in 5 minutes all; But with freeze drying protectant rehydration be moment and need not any freeze drying protectant slower a little.
3-DLS measures
Each compositions analyzes four samples: two fresh preparations with two lyophilizations after and rehydration to initial volume.For each sample, carry out twice or three continuous print dimension analysis, each analysis being obtained from 12 to 20 continuous-readings (10 seconds photon counting/readings) is passed through average to obtain data set.Analyzed the number of required continuous-reading by instrument optimization at every turn.The correlation function derivation Z-average diameter, average-size intensity and the PDI that are obtained by data centralization.Compared to the nano-particle of fresh preparation, the compositions of all lyophilizations and rehydration produces coalescent greatly, and: Z-on average increases and is up to 24 times (Fig. 3 A), the increase of average-size intensity is up to 9.5 times (Fig. 3 B), and PDI value is more than 0.7, balanced growth about 4 times (Fig. 3 C).
4-zeta potential measures
Each compositions analyzes four samples: two fresh preparations with two through lyophilization and rehydration to initial volume.Freeze drying example carried out rehydration with the volume of the Milli-Q water equaling its volume before lyophilization, and was placed subsequently and stablize 15 to 30 minutes.The sample of fresh sample and rehydration 400 μ L20mMNaCl supplement, and where necessary its volume Milli-Q water are settled to 800 μ L and just carry out zeta potential analysis.Zeta potential is measured by LDV (LDV).For each sample, complete continuous three zeta potential analyses, passed through by each analysis of 10 to 20 continuous-reading acquisitions average to obtain data set.Analyzed the number of required continuous-reading by installation optimization at every turn.It is zeta potential between 30 to 32mV that the compositions of all fresh preparations has, and therefore the surface charge of freeze drying protectant on nano-particle does not affect.Cryodesiccated and compositions that is rehydration have be 0 to-5mV zeta potential (Fig. 3 D).
The performance of table 3.4 kind of different components
Embodiment 3
Citric acid/trisodium citrate buffer system promotes chitosan gelling with the compositions-trisodium citrate based on chitosan
The preparation of 1-chitosan/DNA Nanoparticulate compositions
Chitosan (Mn10kDa, 92%DDA) room-temperature dissolution spends the night the final chitosan concentration obtaining 5mg/mL in HCl.Stock solution is diluted to 271 μ g/mL, and 100 μ L mix according to 100 μ g/mL with 100 μ L plasmid DNA (pEGFPLuc) subsequently, to form N/P than the complex being 5.By immediately mixing being implemented in solution suction about 10 times after adding chitosan.Sample room temperature is placed and is stablized 30 minutes, and subsequently according to table 4, the aseptic 70mM citric acid/trisodium citrate buffer agent of aseptic 2% (w/v) sucrose of sample volume, 2% (w/v) glucosan 5kDa or 2% (w/v) trehalose dihydrate compound and pH4.5 or 6.5 is settled to 400 μ L.
Table 4. comprises the compositions of freeze drying protectant and citric acid/trisodium citrate buffer agent.
The freeze thawing of 2-sample
According to the description freeze thawing sample in embodiment 1.
3-DLS measures
According to the description in embodiment 2, size and PDI are analyzed to the sample of the fresh of preparation and freeze thawing.The compositions comprising citric acid/trisodium citrate defined bulky grain before freeze thawing, had the average-size intensity (Fig. 4 B) being greater than 900nm.After freeze thawing, sample is completely coalescent, and be not suitable for DLS analyze, Z-average more than 3500nm (Fig. 4 A) and PDI value higher than 0.66 (Fig. 4 C).
4-citric acid/trisodium citrate incompatibility
According to table 5, chitosan, sucrose or trehalose dihydrate compound are mixed with the citric acid/trisodium citrate buffer agent of pH6.2, or chitosan only mixes with citric acid or trisodium citrate.
Table 5. is for the preparation of the sample of incompatibility evaluating citric acid/trisodium citrate and compositions.
Under buffer agent or three sodium citrates exist, chitosan solution becomes muddy, but under the existence of citric acid not muddy (data are not shown).Under the existence of three sodium citrates, turbidity is maximum, after chitosan/trisodium citrate mixture generation gelling, form white clouds shape structure (data are not shown) in the solution.Gelation (data are not shown) can be caused by being cross-linked positive electricity chitosan chain by electronegative trivalent three sodium citrate.
The performance of table 6.6 kind of different components
Embodiment 4
L-Histidine is compatible with the compositions based on chitosan and obtains the nano granule suspension with low polydispersity index
1-prepares chitosan/DNA Nanoparticulate compositions and is used for ESEM imaging
Chitosan/DNA complex is prepared according to the description in embodiment 3.After complex room-temperature stable 30 minutes, according to table 7, with aseptic 4% (w/v) sucrose, 4% (w/v) glucosan 5kDa or 4% (w/v) trehalose dihydrate compound, sample volume is settled to 400 μ L by the aseptic 55mML-histidine buffer of pH6.5 or Milli-Q water.
Table 7. is for the compositions with freeze drying protectant and L-Histidine of ESEM imaging.
2-ESEM imaging
ESEM sample preparation and imaging are implemented in description as embodiment a kind.Under existing without freeze drying protectant or histidine, the fresh nano-particle of preparation has spherical, bar-shaped or annular form (Fig. 5 A), and they are adding pH6.5's and (Fig. 5 B) more spherical in shape after the L-Histidine of ultimate density 13.75mM.According to 1% (w/v) freeze drying protectant, the complex used and prepare without 13.75mM histidine, has similar impact to the nano-particle observed.
The Nanoparticulate compositions that 3-prepares chitosan/DNA is analyzed for the DLS after freeze thawing
Chitosan/DNA complex is prepared according to the description in embodiment 3.After complex ambient-temp-stable 30 minutes, according to table 8, with aseptic 2% (w/v) sucrose, 2% (w/v) glucosan 5kDa or 2% (w/v) trehalose dihydrate compound, and the L-Histidine buffer agent of aseptic 55mMpH6.5 or Milli-Q water sample volume are settled to 400 μ L.Sample is as freeze thawing in embodiment 1.
The compositions containing freeze drying protectant and L-Histidine of table 8 freeze thawing research.
4-DLS measures
The fresh preparation of each compositions (compositions #9 to 11) copy without histidine is analyzed; Containing the fresh preparation of (compositions #12 to 14) copy of often kind of compositions and the freeze thawing post analysis of histidine.Size and PDI analysis is carried out according to the description of embodiment 2 kinds.Add histidine almost not affect (Fig. 6 A-C) fresh compositions: Z-on average adds 30nm and 13nm respectively under sucrose and trehalose, and reduce 34nm under glucosan exists; Average-size intensity adds difference 12 and 29nm in the existence of sucrose and trehalose, and have dropped 48nm in glucosan existence; 0.05 is have dropped in all freeze drying protectant existence with PDI.Under the existence of histidine, after freeze thawing, do not observe untoward reaction (Fig. 6 A-C) in the composition: the average and average size and intensity of Z-lower than 200nm and mean P DI value lower than 0.35.
The performance of table 9.14 kind of different components.
Embodiment 5
When adding in the combination comprising freeze drying protectant, L-Histidine prevents nano-particle coalescent after freeze
Compositions can be concentrated into 20 times and significantly can not change size and the PDI of nano-particle; And
L-Histidine can minimize in compositions, prevents particles coalesce after freeze simultaneously.
1-prepares chitosan/DNA Nanoparticulate compositions and is used for lyophilization rehydration to higher concentration
As chitosan/DNA complex is prepared in the description in embodiment 3.Complex is after ambient-temp-stable 30 minutes, by table 10, with aseptic 2% (w/v) sucrose, 2 or 4% (w/v) glucosan 5kDa or trehalose dihydrate compound, and sample volume is settled to 400 μ L by the L-Histidine buffer agent of 55mMpH6.5.
Table 10. drying to be frozen and with the compositions of higher concentration rehydration.
For Rh1X, Rh5X and Rh10X: prepare six samples of compositions #3 to 5 (see table 10) and lyophilization according to the description of embodiment 2; For often kind of compositions, two samples by 400 μ LMilli-Q (Rh1X) rehydration to its initial volume, the concentration (Rh5X) that two use 80 μ LMilli-Q rehydration 5 times is dense, and the concentration (Rh10X) that two use 40 μ LMilli-Q rehydration 10 is doubly denseer.For Rh1X and Rh20X: as compositions #1 is prepared in the description in embodiment 2, four samples (see table 10) of 2 and 4 lyophilization; For often kind of compositions, two sample 400 μ LMilli-Q rehydration concentration (Rh20X) that two use 20 μ LMilli-Q rehydration 20 is doubly denseer to its initial volume (Rh1X).The sample of rehydration is placed before analysis and stablizes 15 to 30 minutes.Rehydration in all samples 5 minutes, but Rh20X is more difficult to realize, because the little rehydration volume of cake volume relatively.
2-rehydration measures to the DLS of the compositions of higher concentration
Size and PDI analysis is completed according to the description in embodiment 2.Rehydration compositions #3 to 5 (13.75mM histidine, together with 1% (w/v) glucosan, 0.5 or 1% (w/v) trehalose dihydrate compound) to being up to 10 times of denseer concentration (Rh1X to Rh10X), on granule Z-, average or average-size intensity does not affect, granule Z-on average changes (Fig. 7 A) from 120nm to 155nm,, average-size intensity changes from 131nm to 165nm (Fig. 7 B).Nano-particle PDI value is reduced to 0.05 (Fig. 7 C) from 0.18 along with the rising of concentration factor.Comprise the compositions of 0.5% sucrose or trehalose, merge with 13.75mM histidine, according to 20 times of its initial concentration rehydration, produce the granule being less than 250nm (Z-is average, Fig. 7 D) or 200nm (average-size intensity, Fig. 7 E); The compositions and the Rh20X that comprise glucosan have the Z-average (Fig. 7 D) of 305nm and the average-size intensity (Fig. 7 E) of 324nm.Except the Rh1X of 0.5% glucosan have be 0.37 PDI except, all compositionss have the PDI lower than 0.2; Nano-particle in compositions Rh20X has the PDI value (Fig. 7 F) lower than those in compositions RH1X.
3-prepares chitosan/DNA Nanoparticulate compositions and is used for lower histidine content lyophilization
Chitosan/DNA complex is prepared according to the description in embodiment 3.At room temperature after stable compound 30 minutes, according to table 11, with aseptic 2% (w/v) sucrose, glucosan 5kDa or trehalose dihydrate compound, and 55 of pH6.5,27.5 or 13.75mML-histidine buffer sample volume is settled to 400 μ L.
Table 11. drying to be frozen and with the compositions of higher concentration rehydration.
Prepare often kind of compositions copy and lyophilizing according to the description in embodiment 2, then use 400 μ LMilli-Q rehydration to its initial volume (Rh1X).
4-measures with the DLS of the compositions of lower histidine content lyophilizing
As the analysis of size and PDI is carried out in the description in embodiment 2.Histidine content reduction does not have an impact to the particle diameter of the rehydration compositions comprising 0.5% (w/v) sucrose or trehalose dihydrate compound, and the diameter of granule is less than 160nm (Fig. 7 G-H).When histidine content is reduced to 3.44mM from 13.75mM, the PDI of these two kinds of compositionss is still less than or equal to 0.25 (Fig. 7 I).Average and the average size and intensity of the Z-of glucan composition Rh1X is reduced to 71nm from 151nm respectively when histidine concentrations is reduced to 3.44mM from 13.75mM and is reduced to 157nm (Fig. 7 G-H) from 477nm.After histidine content is reduced to 6.88mM from 13.75mM, the mean P DI of these compositionss drops to 0.25 from 0.37, and final PDI is 0.24 (Fig. 7 I) when histidine is 3.44mM.
5-osmolality model and estimation
Development model is to estimate compositions osmolality, because the fresh sample of large volume needs the osmolality measuring the cryodesiccated sample of rehydration in the volume (20 times concentrate) of 20 times less.Hypothetical nanoparticle osmolality is negligible, only uses the serial dilution Modling model of excipient (sucrose, glucosan 5kDa, trehalose dihydrate compound and L-Histidine).The model prediction obtained comprises the osmolality of the compositions of the L-Histidine of 5% (w/v) glucosan, 5% (w/v) trehalose dihydrate compound and 35mMpH6.5, and precision is 1.8%.Based on model, depend on concentration factor when freeze drying protectant, histidine content and rehydration, osmolality changes between 4 to 570mOsm.For containing the compositions of sucrose, osmolality is higher, and for comprising those of glucosan 5kDa, osmolality is lower.Two kinds of compositionss are close to isotonic: 0.5%dex-his (13.75)-Rh20X is 279mOsm and 0.5%dex-his (13.75)-Rh10X is 268mOsm.
The performance of table 12.14 kind of different components
Embodiment 6
By freeze drying protectant and buffer agent being added in nucleic acid and chitosan before forming complex, the concentrations of nanoparticles in fresh composition can be maximized;
Freeze drying protectant in these compositionss and buffer content are minimized and allows that filter cake reconstruct maintains nearly isotonicity to higher concentration simultaneously; With
These compositionss can be concentrated into and be up to 20 times and the physicochemical properties and the transfection efficiency that significantly do not change nano-particle;
1-preparation comprises the concentrated chitosan/DNA Nanoparticulate compositions of 13.75mM histidine
Chitosan (Mn10kDa, 92%DDA) room-temperature dissolution spends the night the final chitosan concentration obtaining 5mg/mL in HCl.By table 13; use aseptic freeze-dried protective agent solution (2 or 4% (w/v) sucrose, glucosan 5kDa or trehalose dihydrate compound), chitosan stock solution is diluted to 271 μ g/mL by the L-Histidine buffer agent of aseptic 55mMpH6.5 and Milli-Q water.
Table 13. dilutes chitosan with excipient before forming complex.
According to table 14; use the L-Histidine buffer agent of aseptic freeze-dried protective agent solution (2 or 4% (w/v) sucrose, glucosan 5kDa or trehalose dihydrate compound), 55mMpH6.5 and/or Milli-Q water that DNA (pEGFPLuc, 200 μ g/mL) stock solution is diluted to 100 μ g/mL.
Table 14. used excipient dilution DNA before formation complex.
Prepare often kind of compositions copy.For each copy, mixed by its complementary DNA solution (such as, chitosan composite #1 and DNA compositions #1) of 100 μ L chitosan solutions and 100 μ L, making it to form N/P ratio is the complex of 5.By immediately solution suction about 10 times being mixed after adding chitosan.Before analysis, sample room temperature is placed and stablizes 30 minutes.
The DLS that 2-comprises the concentrate composition of 13.75mM histidine measures
As described in Example 2 in the analysis carrying out size and PDI.To be formed before complex but not in chitosan or DNA, add freeze drying protectant and L-Histidine allows the compositions that production twice is concentrated afterwards; wherein Z-is on average lower than 200nm; average-size intensity is lower than 250nm, and PDI value is lower than 0.3 (Fig. 8 A-D).It is average that the compositions prepared without L-Histidine has the granule Z-changed between 115 to 176nm, and average-size intensity is between 144 to 214nm, and PDI value is 0.21 to 0.26; The compositions size prepared with L-Histidine is slightly large, and wherein between Z-average out to 143 to 187nm, average-size intensity is between 165 to 237nm, but has less PDI value (0.13 to 0.18) (Fig. 8 A-C).Although formed in the forward direction chitosan of complex and DNA add excipient create than previous just added after forming nano-particle fashionable seen by larger a little granule, but PDI value still keeps similar (see " 0FT; without His " and " 0FT; 13.75mMHis; pH6.5 ", Fig. 8 C-E).
3-for the preparation of rehydration to the concentrated chitosan/DNA Nanoparticulate compositions comprising 3.44mM histidine of higher concentration
By table 15 and 16, as prepared chitosan/DNA complex in part 1, but the histidine stock solution employing 13.75mM instead of 55mM is to dilute chitosan and DNA.
Table 15. diluted chitosan with excipient form complex in 3.44mM histidine before.
Table 16. used excipient dilution DNA form complex in 3.44mM histidine before.
Cryodesiccated sample as described in Example 2.Rh1X sample 200 μ LMilli-Q water rehydration, Rh10X sample 20 μ LMilli-Q water rehydration, and Rh20X sample 10 μ LMilli-Q water carry out rehydration.All samples is rehydration in 5 minutes all, but Rh20X is comparatively difficult to realize, because relative to cake volume rehydration small volume.
4-rehydration measures to the DLS comprising the concentrate composition of 3.44mM histidine of higher concentration
Six copy of other compositionss (#17 to 19) are often planted: 2 Rh1X, 2 Rh0X and 2 Rh20X according to the preparation described in Section 3.Analyze according to complete size and PDI described in embodiment 2.Only with the nano-particle of 3.44mM histidine lyophilizing can rehydration to reaching 20 times and have no particles coalesce; Compared to Rh1X, granule Z-balanced growth 3 to 68nm and average-size intensity adds 7 to 46nm, this depends on freeze drying protectant (Fig. 8 D-E).When rehydration concentration factor is increased to 20X from 1X, PDI value reduces; PDI is reduced to 0.06 for sucrose composition from 0.17, is reduced to 0.18 for glucan composition from 0.40, and is reduced to 0.10 (Fig. 8 F) for trehalose dihydrate polymer composition from 0.5.
5-rehydration measures to the zeta potential comprising the concentrate composition of 3.44mM histidine of higher concentration
Six copy (two fresh, two Rh1X and two Rh20X) of preparation each other compositionss (#17 to 19) of Rh1X also described in Section 3 prepared by the copy of compositions #15.The all samples of rehydration is placed and is stablized 5 to 30 minutes.All samples is rehydration in 5 minutes, but Rh20X is comparatively difficult to realize, because relative and cake volume rehydration small volume.The sample of fresh sample and rehydration supplements 600 μ L13mMNaCl also, if needed, before carrying out zeta potential analysis, with MIlli-Q, their volume is settled to 800 μ L.According to the mensuration zeta potential described in embodiment 2.The zeta potential that the compositions of fresh preparation has 24mV is; It is the zeta potential of 18 to 21mV that lyophilizing the compositions of rehydration have, and with their freeze drying protectant or rehydration volume irrelevant (Fig. 8 G).
6-rehydration is to the ESEM imaging comprising the concentrate composition of 3.44mM histidine of higher concentration
6 copy according to other compositionss (#17 to 19) each of the preparation described in Section 3: two Rh1X, two Rh0X and two Rh20X.According to the enforcement ESEM sample preparation described in embodiment 1 and imaging.Viewed compared to the previous compositions for comprising 13.75mM histidine, the nano-particle observed for the compositions comprising 3.44mM histidine is more not spherical in shape, and this is consistent with the change of the PDI observed in DLS.Lyophilization and do not observe significant difference between the compositions of then Rh1X or Rh20X, but they seem to have more spheroidal particle than the compositions of fresh preparation.The most diameter of granule is lower than 200nm (data are not shown).
7-in-vitro transfection
Six copy according to each compositions of the preparation described in Section 3 (#15 to 22): two fresh, two Rh1X and two Rh20X.Lipid complex based on Fugene is used as the positive control of transfection efficiency.Press according to the enforcement in-vitro transfection described in embodiment 1.
8-pH value
In the sample of fresh preparation and in lyophilization and rehydration to its initial volume (Rh1X) or the pH value measuring compositions #15 to 22 to the sample of twentieth initial volume (Rh20X).Without under the existence of L-Histidine, the sample of fresh preparation has the mean ph value of 5.8 ± 0.2, has nothing to do with the existence of freeze drying protectant or character.Its mean ph value is 7.0 ± 0.2 and after Rh20X is 5.1 ± 0.2 after Rh1X.The compositions comprising 3.44mML-histidine of fresh preparation have be 6.42 ± 0.05 average pH, have nothing to do with the existence of freeze drying protectant or character, and cryodesiccated sample pH value after Rh1X is 6.50 ± 0.06 and be 6.48 ± 0.02 after Rh20X.
9-osmolality
Because said method produces the compositions with twice complex content, for compositions #17 to 19, lyophilization and rehydration more than 5 times concentrate, the effectiveness of the osmolality model of exploitation before checking.Model is acceptable for the compositions comprising sucrose (#17) or trehalose (#19), and osmolality underestimates 6% and 8% respectively, but be insufficient for those (#18) comprising glucosan, osmolality underestimates 57%.To fresh or rehydration to its initial volume (Rh1X), to the osmolality of the cryodesiccated sample estimation compositions #17 and 19 of its initial volume 1/10th (Rh10X) and initial volume 1/20th (Rh20X).Based on model, osmolality is between 19 to 372mOsm for the sample comprising sucrose, and is between 17 to 339mOsm for the sample comprising trehalose dihydrate compound.These two kinds of compositions Rh20X are close to isotonic: 0.5%suc-his (3.44)-Rh20X is 372mOsm and 0.5%tre-his (3.44)-Rh20X is 339mOsm.
10-transfection efficiency
According to the mensuration transfection efficiency described in embodiment 1.Based on the value obtained for the fresh complex without excipient (Fig. 9 A, A: without Lyo-His (0)-fresh) normalization sample transfection efficiency, it has the transfection efficiency of 53% of total cell.Fugene has the transfection efficiency (Fig. 9 A and 9C) of 116% of fresh control thing.Fresh composition without histidine has the transfection efficiency (Fig. 9 A) of 90% to 100% of fresh control thing; The fresh composition with 3.44mM histidine has the transfection efficiency of 108% to 113% (Fig. 9 C) of fresh control thing.There is not the cryodesiccated compositions of freeze drying protectant, to have or without under 3.44mM histidine, have lower than tester 22% transfection efficiency (Fig. 9 A and 9C).By the cryodesiccated compositions of 0.5% (w/v) freeze drying protectant, but without histidine, there is the transfection efficiency (Fig. 9 A) of about 40% of tester.By 0.5% (w/v) freeze drying protectant and the cryodesiccated compositions of 3.44mM histidine; and rehydration 1X (Rh1X); the transfection efficiency had relative to fresh control thing is as follows: be 100% for sucrose; be 85% for glucosan, and be 83% (Fig. 9 C) for trehalose.By 0.5% (w/v) freeze drying protectant and the cryodesiccated compositions of 3.44mM histidine; and rehydration 20X (Rh20X); the transfection efficiency had relative to fresh control thing is as follows: be 48% for sucrose; be 53% for glucosan, and be 78% (Fig. 9 C) for trehalose.
11-luciferase expression
According to the quantitative fluorescence element expression of enzymes described in embodiment 1.The standard curve that made by the restructuring luciferase serial dilutions of concentration known is used to be changed into by the luciferase relative light unit (RLU/min) per minute of mensuration μM.Based on the value normalization fluorescent element expression of enzymes level obtained for the fresh chitosan/DNA complex (Ctl) without excipient, above-mentioned complex has the expression of the albumen of the luciferase/mg of 6.76E-5 μ Μ.Without freeze drying protectant, have or without the cryodesiccated compositions of 3.44mM histidine, express the luciferase level (Fig. 9 B and 9D) recorded tester measured less than 10%.With 0.5% (w/v) freeze drying protectant, but without the cryodesiccated compositions of histidine express for tester measure less than 25% the luciferase level (Fig. 9 B) recorded.With 0.5% (w/v) freeze drying protectant and the lyophilization of 3.44mM histidine and the Luciferase expression levels that the compositions of rehydration 1X (Rh1X) has is similar to the positive control of sucrose and trehalose dihydrate compound, and there is 56% expression (Fig. 9 D) of the positive control for glucosan.With 0.5% (w/v) freeze drying protectant and the lyophilization of 3.44mM histidine and the compositions of rehydration 20X (Rh20X) have the positive control being similar to sucrose Luciferase expression levels, for glucosan positive control 12% expression and for trehalose dihydrate compound positive control 65% expression (Fig. 9 D).
The performance of table 17.22 kind of different components.
Embodiment 7
Use two continuous print lyophilizations/rehydration circulation compositions can be concentrated into and be up to 20 times, final rehydration (higher rehydration volume ratio cake volume) before promoting injection thus, these physicochemical properties for nano-particle and transfection efficiency do not change significantly
1-is for the preparation of the repeatedly cryodesiccated chitosan/DNA-Nanoparticulate compositions comprising 0.5% (w/v) trehalose dihydrate compound and 3.5mM histidine
Chitosan (Mn10kDa, 92%DDA) room-temperature dissolution spends the night the final chitosan concentration obtaining 5mg/mL in HCl.By table 18, use aseptic 2% (w/v) trehalose dihydrate compound, chitosan stock solution is diluted to 271 μ g/mL by the L-Histidine buffer agent of aseptic 14mMpH6.5 and Milli-Q water.
Table 18. dilutes chitosan with excipient before forming complex.
According to table 19, use the L-Histidine buffer agent of aseptic 2% (w/v) trehalose dihydrate compound, aseptic 14mMpH6.5 and Milli-Q water that DNA (pEGFPLuc, 400 μ g/mL) stock solution is diluted to 100 μ g/mL.
Table 19. uses excipient dilution DNA before forming complex.
Prepare 21 samples.For each sample, the chitosan solution (table 18) that 625 μ L dilute mixes to form N/P than the complex being 5 with the DNA solution (table 19) that 625 μ L dilute.By immediately solution suction about 10 times being mixed after adding chitosan.Before analysis or lyophilization, sample room temperature is placed and stablizes 30 minutes.
The lyophilizing of 2-sample
Lyophilization 15 samples.According to table 20, for each sample, 1200 μ L are transferred in 10mL serum vial, and with the lyophilization of 20mm butyl lyophilization stopper, as described in Example 2.By 6 samples, 120 μ L rehydration Rh10X, and transfer in 2mL serum vial according to table 20 each sample by 100 μ L subsequently, and with the lyophilization of 13mm butyl lyophilization stopper, as described in Example 2.By 3 samples, 240 μ L rehydration Rh5X, and fill with 200 μ L the 2mL serum bottle that two have 100 μ L samples subsequently: according to table 20, a bottle carries out DLS analysis, and another carries out transfection.Sample 13mm butyl lyophilization stopper lyophilization, as described in Example 2.
Table 20. dilutes chitosan with excipient before forming complex.
3-rehydration sample is used for DLS or transfection
Experiment shows, sample rehydration, to nano-particle character (size, zeta potential, transfection efficiency etc.) not impact, therefore, to be diluted by the sample of dilution rehydration as follows before analysis.
30 minutes by sample #1 60 μ LMilli-Q rehydration Rh20X before analysis, then within 15 minutes, dilute with 1140 μ LMilli-Q before analysis.
30 minutes by sample #2 50 μ LMilli-Q rehydration Rh20X (10X+2X) before analysis, then within 15 minutes, dilute with 950 μ LMilli-Q before analysis.
30 minutes by sample #3 25 μ LMilli-Q rehydration Rh20X (5X+4X) before analysis, then within 15 minutes, dilute with 475 μ LMilli-Q before analysis.
All samples is rehydration in 5 minutes, but sample #1 (Rh20X) is difficult to realize, because relative to cake volume rehydration small volume.Sample #2 and 3 easily and rapid rehydration, and also reaches the final enrichment factor of 20X simultaneously.
4-rehydration measures to the DLS comprising the concentrate composition of 0.5% (w/v) trehalose dihydrate compound and 3.5mm histidine of higher concentration
According to three copy of the fresh preparation described in Section 1, and according to 3 cryodesiccated copy of each compositions of the rehydration described in Section 3.Complete size and PDI as described in Example 2 analyze.The nano-particle be formulated in 0.5% (w/v) trehalose dihydrate compound and 3.5mML-histidine lyophilizing can not see particles coalesce to reach the final enrichment factor of 20X (Rh20X) twice.Compared to the granule of fresh preparation, Z-on average improves 56 to 68nm and average-size intensity adds 54 to 63nm, and this depends on the number of times of lyophilization for reaching Rh20X and rehydration circulation.Z-average (180 to 192nm) and average size and intensity (204 to 213nm) are similar between sample Rh20X, the number circulated with enforcement lyophilization and rehydration irrelevant (Figure 10 A-B).PDI value raises a little after lyophilization and rehydration, is increased to (Figure 10 C) between 0.20 to 0.25 after Rh20X from 0.17 during fresh preparation.
5-rehydration measures to the zeta potential comprising the concentrate composition of 0.5% (w/v) trehalose dihydrate compound and 3.5mM histidine of higher concentration
The sample previously analyzed by DLS (Section 4) supplements 400 μ L20mMNaCl, then according to its zeta potential of mensuration described in embodiment 2.The nano-particle of fresh preparation has the average zeta potential of 19mV; The compositions of lyophilization and rehydration has the zeta potential of 18 to 21mV, and has nothing to do (Figure 10 D) with the lyophilization cycle number for arriving Rh20X.
6-rehydration is to the in-vitro transfection comprising the concentrate composition of 0.5% (w/v) trehalose dihydrate compound and 3.5mm histidine of higher concentration
As three copy of the fresh preparation described in Section 1, and according to three cryodesiccated copy of each compositions of the rehydration described in Section 3.According to carrying out in-vitro transfection described in embodiment 1.
7-rehydration is to the transfection efficiency comprising the concentrate composition of 0.5% (w/v) trehalose dihydrate compound and 3.5mM histidine of higher concentration
According to the mensuration transfection efficiency described in embodiment 1.Based on the value normalization sample transfection efficiency (Figure 10 E: fresh) obtained for the fresh complex be prepared in the L-Histidine of 0.5% (w/v) trehalose dihydrate compound and 3.5mMpH6.5, it has the transfection efficiency of 44% of total cell.All cryodesiccated compositionss have the transfection efficiency (Figure 10 E) of fresh control thing 85% to 100%: the compositions of rehydration 20X has the transfection efficiency equaling (100%) fresh sample after single lyophilization cycle (FD/Rh20X); Rehydration 10X, then lyophilization the compositions of Rh2X [Rh (10X+2X)], have the transfection efficiency of 86% of tester; And rehydration 5X, the then compositions of lyophilization and Rh4X [Rh (5X+4X)], there is the transfection efficiency of 85% of tester.
8-rehydration is to the luciferase expression comprising the concentrate composition of 0.5% (w/v) trehalose dihydrate compound and 3.5mM histidine of higher concentration
Quantitative fluorescence element expression of enzymes as described in Example 1, and represent with relative light unit (RLU/min) per minute.Based on value normalization fluorescent element expression of enzymes level (Figure 10 F: fresh) obtained for the fresh complex be prepared in the L-Histidine of 0.5% (w/v) trehalose dihydrate compound and 3.5mMpH6.5, it has the expression of 5.24E+8RLU/min*mg albumen.The all cryodesiccated compositions of final Rh20X has similar Luciferase expression levels, has the value (Figure 10 F) of 64% to 69% of fresh control thing Luciferase expression levels: after the compositions list lyophilization cycle of rehydration 20X, (FD/Rh20X) has the Luciferase expression levels of 64% of tester; Rehydration 10X, then the compositions of lyophilization and Rh2X [Rh (0X+2X)], has the Luciferase expression levels of 69% of tester; And rehydration 5X, then lyophilization the compositions of Rh4X [Rh (5X+4X)], have the Luciferase expression levels of 66% of tester.
The performance of table 21.5 kind of different components.
Embodiment 8
Compared to CS/DNA nano-particle, chitosan/siRNA nano-particle can be prepared according to higher original nucleic acid concentration, but necessary corresponding increase excipient content;
These compositionss can be concentrated into and be up to 10 times and physicochemical properties and the silence efficiency that significantly can not change nano-particle.
1-concentrates the preparation of chitosan/siRNA Nanoparticulate compositions
Chitosan (Mn10kDa, 92%DDA) room-temperature dissolution spends the night the final chitosan concentration obtaining 5mg/mL in HCl.According to table 22, use aseptic freeze-dried protective agent solution (8% (w/v) glucosan 5kDa or trehalose dihydrate compound), the L-Histidine buffer agent of aseptic 14mMpH6.5 and the water of deoxyribonuclease that chitosan stock solution is diluted to 271 or 542g/mL.
Table 22. dilutes chitosan with excipient before forming complex.
According to table 23; with the L-Histidine buffer agent of aseptic freeze-dried protective agent solution (8% (w/v) glucosan 5kDa or trehalose dihydrate compound), 14mMpH6.5 and/or deoxyribonuclease water by anti-ApoBsiRNA (justice: GUCAUCACACUGAAUACCAAU; antisense: AUUGGUAUUCAGUGUGAUGACAC, 1mg/mL) stock solution is diluted to 100 or 200 μ g/mL.
Table 23. dilutes siRNA with excipient before forming complex.
For each copy, the chitosan solution of 100 μ L and its complementary siRNA solution of 100 μ L (such as, chitosan composite #1 and siRNA compositions #1) mix to form N/P than the complex being 5.By immediately solution suction being mixed for about 10 times after adding chitosan.Before analysis, sample room temperature is placed and stablizes 30 minutes.
The Nanoparticulate compositions of chitosan/siRNA that 2-lyophilization is concentrated
The sample of drying to be frozen is transferred in 2mL serum vial also with the lyophilization of 13mm butyl lyophilization stopper.Being positioned over by water permeable membrane is equipped with on the pallet of all samples, to prevent dust or germ contamination.On MillrockLaboratorySeries freezer dryer PC/PLC, following circulation is used to implement lyophilization: step is chilled to 5 DEG C and keeps isothermal 30 minutes, step is chilled to-5 DEG C and keeps isothermal 30 minutes, is then cooled to-40 DEG C at 35 minutes inside gradients, and keeps isothermal 2 hours; At-40 DEG C, preliminarily dried 48 hours under 100 millitorrs; And redrying, under 100 millitorrs, in 12 hours, temperature is increased to 30 DEG C, then keeps constant temperature 30 DEG C to reach 6 hours.Sample clogs, and is rolled into little pleat and until use at being stored in 4 DEG C.Use first 15 to 30 minutes, Rh1X sample 200 μ L deoxyribonuclease water rehydration, Rh10X sample 20 μ L deoxyribonuclease water rehydration, and Rh20X sample 10 μ L deoxyribonuclease water rehydration.All samples is rehydration in 5 minutes all.
The DLS that 4-concentrates chitosan/siRNA Nanoparticulate compositions measures
Nine copy of compositions are often planted: 3 fresh preparations (without FD), 3 Rh1X and three Rh20X according to the preparation described in the 1st and Section 2.Analyze according to complete size and PDI described in embodiment 2.Although all compositionss all prevent seriously coalescent after Rh20X, compared to fresh composition, only compositions #2 and 4 particle diameter after Rh1X and/or Rh20X does not have significant change; Their Z-on average then increases 21 and 9nm (Figure 11 A) respectively.Mean P DI value is mostly lower than 0.25 (except compositions #1, Rh1X), and wherein compositions #2 and 4 has the PDI value (Figure 11 B) of 0.16 and 0.20 respectively after Rh20X.
The zeta potential of chitosan/siRNA Nanoparticulate compositions that 5-is concentrated measures
Nine copy according to the description preparation often kind of compositions in the 1st and Section 2: (without FD), three Rh1X and three Rh10X of three fresh preparations.The sample of rehydration is placed to stablize 5 to 30 minutes, although all samples all rehydration in 5 minutes.With deoxyribonuclease water, the volume of the sample of fresh sample and rehydration is settled to 400 μ L, then before carrying out zeta potential analysis, adds 400 μ L20mMNaCl.According to the mensuration zeta potential described in embodiment 2.The compositions of fresh preparation has the zeta potential for 21mV; It is the zeta potential of 21 to 23mV that lyophilization the compositions of rehydration have, and has nothing to do with their rehydration volumes.
The ESEM imaging of chitosan/siRNA Nanoparticulate compositions that 6-is concentrated
Nine copy according to the preparation compositions #2 described in the 1st and 2 joints: (without FD), three Rh1X and three Rh10X of 3 fresh preparations.According to the enforcement ESEM sample preparation described in embodiment 1 and imaging.The nano-particle shape of all observations all spherical in shape and mostly diameter lower than 100nm.Significant difference is not observed between granule that is fresh, Rh1X or Rh10X compositions.
The external silence of chitosan/siRNA Nanoparticulate compositions that 7-is concentrated
Nine copy according to the preparation compositions #2 described in the 1st and Section 2: (without FD), three Rh1X and three Rh20X of 3 fresh preparations.DharmaFECT2 is used as the positive control for silence efficiency.To be grown in the RPMI-1640 of the pH7.2 of supplementary 10% hyclone (FBS), and at 37 DEG C, 5%CO 2the positive H1299 cell of eGFP of middle cultivation is used in vitro study.Before transfection 24 hours, by 45,000 cell was inoculated in each hole of 24-wellhole orifice plate and converges for about 75% to 85% of transfection to reach.In each hole, replace culture medium with the DMEM high glucose (without FBS) of pH6.5 and Nanoparticulate compositions, for the solution comprising the siRNA of 100nM of 500 μ L altogether.Cell is at 37 DEG C, 5%CO 2middle cultivation 4 hours, then supplements with 55 μ LFBS, and cultivates another 44 hours subsequently before analysis.
8-concentrates the silence efficiency of chitosan/siRNA Nanoparticulate compositions
Use cells were tested by flow cytometry silence efficiency.Sample preparation: remove growth medium from each hole comprising sample to be analyzed; Cell is rinsed with the phosphate buffer saline (PBS) of 500 μ LpH7.4; Use every hole 75 μ L trypsin/EDTA, at 37 DEG C, they are carried out trypsin treatment 5 minutes; Then add 325 μ L growth mediums, and whole sample is transferred in cell counting pipe.Cells were tested by flow cytometry: each sample collection 10000 events, and average fluorescent strength is measured by the 510/20nm band filter with photomultiplier tube after use 488nm argon laser excites the green fluorescent protein of enhancing (EGFP) in cell.Forward scatter (FSC) and lateral scattering (SSC) are also for getting rid of dead cell and fragment in the event from record.Finally, when usage data analyzes transfection efficiency, FSC is used for identifying from event and getting rid of bimodal.EGFP intensity more than average residual is expressed as the percentage rate that the average eGFP that measures for untreated cell expresses.Although the silence efficiency of compositions #2 is lower than DharmaFECT2, the remaining eGFP with 5% expresses (data are not shown), and the silence efficiency of FD to CS/siRNA does not have negative effect.The remaining eGFP that fresh composition has 52% of untreated cell expresses; Rh1X is 49%; And Rh10X is 47% (Figure 11 C).
The performance of table 24. different components
Although describe the present invention in conjunction with its detailed description of the invention, but should be understood that, it can be revised further, and in general the application be intended to contain follow principle of the present invention of the present invention any change, purposes or adjustment, and comprise depart from present disclosure and set forth essential feature can be applied to above in the known in the art or usual practice that the present invention relates to, and be in those in the scope of claims as follows.
The all documents mentioned in this description are all incorporated herein by reference.
List of references
1.Xu，L.andT.Anchordoquy，Drugdeliverytrendsinclinicaltrialsandtranslationalmedicine：Challengesandopportunitiesinthedeliveryofnucleicacid-basedtherapeutics.JournalofPharmaceuticalSciences，2011.100(1)：p.38-52.
2.Tang，X.L.andM.J.Pikal，Designoffreeze-dryingprocessesforpharmaceuticals：Practicaladvice.PharmaceuticalResearch，2004.21(2)：p.191-200.
3.Wang，W.，Lyophilizationanddevelopmentofsolidproteinpharmaceuticals.InternationalJournalofPharmaceutics，2000.203(1-2)：p.1-60.
4.Abdelwahed，W.，etal.，Freeze-dryingofnanoparticles：Formulation，processandstorageconsiderations.AdvancedDrugDeliveryReviews，2006.58(15)：p.1688-1713.
5.Anchordoquy，T.J.，etal.，PhysicalstabilizationofDNA-basedtherapeutics.DrugDiscoveryToday，2001.6(9)：p.463-470.
6.Schwarz，C.andW.Mehnert，Freeze-dryingofdrug-freeanddrug-loadedsolidlipidnanoparticles(SLN).InternationalJournalofPharmaceutics，1997.157(2)：p.171-179.
7.Hinrichs，W.L.J.，etal.，ThechoiceofasuitableoligosaccharidetopreventaggregationofPEGylatednanoparticlesduringfreezethawingandfreezedrying.InternationalJoumalofPharmaceutics，2006.311(1-2)：p.237-244.
8.Mao，H.-Q.，etal.，Chitosan-DNAnanoparticlesasgenecarriers：synthesis，characterizationandtransfectionefficiency.JournalofControlledRelease，2001.70(3)：p.399-421.
9.Andersen，M. etal.，DeliveryofsiRNAfromlyophilizedpolymericsurfaces.Biomaterials，2008.29(4)：p.506-512.
10.Tahara，K.，etal.，EstablishingchitosancoatedPLGAnanosphereplatformloadedwithwidevarietyofnucleicacidbycomplexationwithcationiccompoundforgenedelivery.InternationalJournalofPharmaceutics，2008.354(1-2)：p.210-216.
11.Anchordoquy，T.J.andG.S.Koe，Physicalstabilityofnonviralplasmid-basedtherapeutics.JournalofPharmaceuticalSciences，2000.89(3)：p，289-296，
12.Liu，J.S.，Physicalcharacterizationofpharmaceuticalformulationsinfrozenandfreeze-driedsolidstates：Techniquesandapplicationsinfreeze-dryingdevelopment.PharmaceuticalDevelopmentandTechnology，2006.11(1)：p.3-28.
13.Schersch，K.，etal.，SystematicinvestigationoftheeffectoflyophilizatecollapseonpharmaceuticallyrelevantproteinsI：Stabilityafterfreeze-drying.JournalofPharmaceuticalSciences，2009.99(5)：p.2256-2278.
14.Hinrichs，W.L.J.，M.G.Prinsen，andH.W.Frijlink，Inulinglassesforthestabilizationoftherapeuticproteins.InternationalJournalofPharmaceutics，2001.215(1-2)：p.163-174.
15.Anchordoquy，T.J.，T.KArmstrong，andM.d.C.Molina，Lowmolecularweightdextransstabilizenonviralvectorsduringlyophilizationatlowosmolalities：concentratingsuspensionsbyrehydrationtoreducedvolumes.JournalofPharmaceuticalSciences，2005.94(6)：p.1226-1236.
16.Allison，S.D.andT.J.Anchordoquy，Mechanismsofprotectionofcationiclipid-DNAcomplexesduringlyophilization.JournalofPharmaceuticalSciences，2000.89(5)：p.682-691.
17.Hinrichs，W.L.J.，etal.，Inulinisapromisingcryo-andlyoprotectantforPEGylatedlipoplexes.JournalofControlledRelease，2005.103(2)：p.465-479.
18. K.M.，M.H. andO. Acidhydrolysisofchitosans.CarbohydratePolymers，2001.46(1)：p.89-98.
19.Chen，R.H.，etal.，ChangesintheMark-Houwinkhydrodynamicvolumeofchitosanmoleculesinsolutionsofdifferentorganicacids，atdifferenttemperaturesandionicstrengths.CarbohydratePolymers，2009.78(4)：p.902-907.
20.Gómez，G.，M.J.Pikal，andN.Rodríguez-Hornedo，EffectofInitialBufferCompositiononpHChangesDuringFar-From-EquilibriumFreezingofSodiumPhosphateBufferSolutions.PharmaceuticalResearch，2001.18(1)：p.90-97.
21.Sundaramurthi，P.，E.Shalaev，andR.Suryanarayanan，CalorimetricandDiffractometricEvidencefortheSequentialCrystallizationofBufferComponentsandtheConsequentialpHSwinginFrozenSolutions.JournalofPhysicalChemistryB，2010.114(14)：p.4915-4923.
22.Shalaev，E.Y.，etal.，Thermophysicalpropertiesofpharmaceuticallycompatiblebuffersatsub-zerotemperatures：Implicationsforfreeze-drying.PharmaceuticalResearch，2002.19(2)：p.195-201.
23.Bhatnagar，B.S.，R.H.Bogner，andM.J.Pikal，ProteinStabilityDuringFreezing：SeparationofStressesandMechanismsofProteinStabilization.PharmaceuticalDevelopmentandTechnology，2007.12(5)：p.505-523.
24.Alkhamis，KA.，InfluenceofSolid-StateAcidityontheDecompositionofSucroseinAmorphousSystemsII(EffectofBuffer).DrugDevelopmentandIndustrialPharmacy，2009.35(4)：p.408-416.
25. T.andT.Wadsten，Physicalstateof-histidineafterfreeze-dryingandlong-termstorage.EuropeanJournalofPharmaceuticalSciences，1999.8(4)：p.301-308.
26.Cun，D.，etal.，Preparationandcharacterizationofpoly(dl-lactide-co-glycolide)nanoparticlesforsiRNAdelivery.InternationalJournalofPharmaceutics，2010.390(1)：p.70-75.
27.Katas，H.，E.Cevher，andH.O.Alpar，Preparationofpolyethyleneimineincorporatedpoly(d，l-lactide-co-glycolide)nanoparticlesbyspontaneousemulsiondiffusionmethodforsmallinterferingRNAdelivery.InternationalJournalofPharmaceutics，2009.369(1-2)：p，144-154.
28.Zhang，J.andP.Ng，Composition，usefulinareconstitutedcompositionfortreatinge.g.cancer，comprisesaparticlecomprisingmanyhydrophobicpolymer-agentconjugates，andmanyhydrophilic-hydrophobicpolymers，asurfactant，andacyclicoligosaccharide，2011，ZHANGJ(ZHAN-Individual)NGP(NGPP-Individual).p.265.
29.Miyata，K.，etal.，Freeze-driedformulationsforinvivogenedeliveryofPEGylatedpolyplexmicelleswithdisulfidecross/inkedcorestotheliver.JournalofControlledRelease，2005.109(1-3)：p.15-23.
30.Troiano，G.，etal.，Lyophilizedpharmaceuticalcompositionfordeliveringtherapeuticagente.g.anticanceragentcomprisespolymericnanoparticles，whereuponreconstitutioninaqueousmediumthecompositioncomprisesmicroparticlesofspecificparticlesizes，2011，BINDBIOSCIENCES(BIND-Non-standard)TROIANOG(TROl-lndividual)SONGY(SONG-Individual)ZALESE(ZALE-Individual)WRIGHTJ(WRIG-Individual)VANGEENHT(VGEE-Individual).p.63.
31.Zillies，J.C.，etal.，Formulationdevelopmentoffreeze-driedoligonucleotide-loadedgelatinnanoparticles.EuropeanJournalofPharmaceuticsandBiopharmaceutics，2008.70(2)：p.514-521.
32.Molina，M.d.C.，S.D.Allison，andT.J.Anchordoquy，Maintenanceofnonviralvectorparticlesizeduringthefreezingstepofthelyophilizationprocessisinsufficientforpreservationofactivity：Insightfromotherstructuralindicators.JournalofPharmaceuticalSciences，2001.90(10)：p.1445-1455.
33.Pfeifer，C.，etal.，Drypowderaerosolsofpolyethylenimine(PEI)-basedgenevectorsmediateefficientgenedeliverytothelung.JournalofControlledRelease，2011.154(1)：p.69-76.
34.Brus，C.，etal.，Stabilizationofoligonucleotide-polyethyleniminecomplexesbyfreeze-drying：physicochemicalandbiologicalcharacterization.JournalofControlledRelease，2004.95(1)：p.119-131.
35.Anwer，K.，etal.，Newcompositioncomprisesamixtureofacationiclipopolymerandanucleicacidsuspendedinanaqueoussolution，andafillerexcipient，usefulforgenedeliverysystemsfortransfectingamammaliancell，2009，EXPRESSIONGENETICSINC(EXPR-Non-standard)MATARM(MATA-Individual)FEWELLJ(FFWE-Individual)LEWISDH(LEVVI-Individual)ANWERK(ANWE-Individual)EGENINC(EGEN-Non-standard).p.2178509-A2：.
36.Kasper，J.C.，etal.，Developmentofalyophilizedplasmid/LPEIpolyplexformulationwithlong-termstability-Astepcloserfrompromisingtechnologytoapplication.JournalofControlledRelease，2011.151(3)：p.246-255.
37.Csoergao，S.B.Z.，etal.，Pharmaceuticalcompositionusefulfortreatmentofe.g.allergicrhinitis，comprisesnanoparticlescomposedofmacromoleculese.g.antigen，andalinearpolyethylenimine，inaliquidorlyophilizedformulation，2010，GENETICIMMUNITYKFT(GENE-Non-standard).p.65.
38.Lavertu，M.，etal.，Highefficiencygenetransferusingchitosan/DNAnanoparticleswithspecificcombinationsofmolecularweightanddegreeofdeacetylation.Biomaterials，2006.27(27)：p.4815-4824.
39.Methot，S.，etal.，Efficientinvivogenedeliveryusingchitosan/DNAnanoparticlesforapplicationsincartilagerepair.OsteoarthritisandCartilage，2007.15，SupplementB(0)：p.B74.
40.Jean，M.，etal.，Chitosan-plasmidnanoparticleformulationsforIMandSCdeliveryofrecombinantFGF-2andPDGF-BBorgenerationofantibodies.GeneTherapy，2009.16(9)：p.1097-1110.
41.Ma，P.L.，etal.，NewInsightsintoChitosan-DNAInteractionsUsingIsothermalTitrationMicrocalorimetry.Biomacrornolecules，2009.10(6)：p.1490-1499.
42.Thibault，M.，etal.，IntracellularTraffickingandDecondensationKineticsofChitosan-pDNAPolyplexes.MolTher，2010.
43.Nimesh，S.，etal.，EnhancedGeneDeliveryMediatedbyLowMolecularWeightChitosan/DNAComplexes：EffectofpHandSerum.MolecularBiotechnology，2010：p.1-15.
44.Thibault，M.，etal.，Excesspolycationmediatesefficientchitosan-basedgenetransferbypromotinglysosomalreleaseofthepolyplexes.Biomaterials，2011.32(20)：p.4639-4646.
45.Jean，M.，etal.，Chitosan-basedtherapeuticnanoparticlesforcombinationgenetherapyandgenesilencingofinvitrocelllinesrelevanttotype2diabetes.EuropeanJournalofPharmaceuticalSciences，2012.45(1-2)：p.138-149.
46.Kim，D.-G.，etal.，Retinol-encapsulatedlowmolecularwater-solublechitosannanoparticles.InternationalJournalofPharmaceutics，2006.319(1-2)：p.130-138.
47.Sonaje，K.，etal.，Enteric-coatedcapsulesfilledwithfreeze-driedchitosan/poly(Y-glutamicacid)nanoparticlesfororalinsulindelivery.Biomaterials，2010.31(12)：p.3384-3394.
48.Yin，L.，etal.，Drugpermeabilityandmucoadhesionpropertiesofthiolatedtrimethylchitosannanoparticlesinoralinsulindelivery.Biomaterials，2009.30(29)：p.5691-5700.
49.Motwani，S.K.，etal.，Chitosan-sodiumalginatenanoparticlesassubmicroscopicreservoirsforoculardelivery：Formulation，optimisationandinvitrocharacterisation.EuropeanJournalofPharmaceuticsandBiopharmaceutics，2008.68(3)：p.513-525.
50.Seo，D.-H.，etal.，Methotrexate-incorporatedpolymericnanoparticlesofmethoxypoly(ethyleneglycol)-graftedchitosan.ColloidsandSurfacesB：Biointerfaces，2009.69(2)：p.157-163.
51.Sung，H.，etal.，Composition，usefulfore.g.lodgingnanoparticlesintargettissuetotreatosteoporosis，comprisescomponentofpositivelychargedchitosan，componentofnegativelychargedsubstrateandbioactiveagentencapsulatedwithinnanoparticles，2011，GPMEDICALINC(GPME-Non-standard)UNIVNATTSING-HUA(UNTH).p.39.
52.Mumper，R.J.andA.Rolland，Compositionusefulfordeliveryofnucleicacidsoroligo：nucleotide(s)tocells-comprisesthenucleicacidoroligo：nucleotideandachitosan-basedcompound，1997，GENEMEDICINEINC(GENE-Non-standard)VALENTISINC(VALE-Non-standard)ROLLANDA(ROLL-Individual)MUMPERRJ(MUMP-Individual).p.914161-A2：.
53.Tahara，K.，etal.，Improvedcellularuptakeofchitosan-modifiedPLGAnanospheresbyA549cells.InternationalJournalofPharmaceutics，2009.382(1-2)：p.198-204.
54.Okahata，S.，etal.，MoldingDNA/chitosancomplex，involvesfillingDNA/chitosancomplexinmold，supplyingbuffertocomplex，freezedryingthecomplexcontainingbuffer，andobtainingDNA/chitosancomplexmoldedaccordingtoshapeofmold，2007，OKAHATAY(OKAH-Individual)FUKUSHIMAT(FUKU-Individual)NICHIROKK(NCHR)OKAHATAS(OKAH-Individual).p.10.

Claims (75)

1. a polyelectrolyte complex composition, comprises polymer, nucleic acid molecules, freeze drying protectant and buffer agent, and described compositions keeps the biologic activity of described compound polyelectrolyte after lyophilization and rehydration.
2. polyelectrolyte complex composition according to claim 1, the Z-that described compositions has lower than about 750nm after lyophilization and rehydration is average.
3. polyelectrolyte complex composition according to claim 1 and 2, described compositions is essentially no coalescent after lyophilization and rehydration.
4. polyelectrolyte complex composition according to any one of claim 1 to 3, described compositions has the polydispersity index of at the most 0.5 after lyophilization and rehydration.
5. polyelectrolyte complex composition according to any one of claim 1 to 4, described compound polyelectrolyte realizes at least about 10% transfection level after lyophilization and rehydration.
6. polyelectrolyte complex composition according to any one of claim 1 to 5, described compositions reconstructs after lyophilization and rehydration in about 10min.
7. polyelectrolyte complex composition according to any one of claim 1 to 5, described compositions reconstructed after lyophilization and rehydration in about 5 minutes.
8. polyelectrolyte complex composition according to any one of claim 1 to 7, described compositions is nearly osmolality after lyophilization and rehydration.
9. polyelectrolyte complex composition according to any one of claim 1 to 7, described compositions has about 100mOsm to the osmolality about between 750mOsm after lyophilization and rehydration.
10. polyelectrolyte complex composition according to any one of claim 1 to 9, described compositions has the pH of weakly acidic pH after lyophilization and rehydration.
11. polyelectrolyte complex compositions according to any one of claim 1 to 9, described compositions has the pH between about 5 to 8 after lyophilization and rehydration.
12. polyelectrolyte complex compositions according to any one of claim 1 to 11 are cryodesiccated.
13. polyelectrolyte complex compositions according to any one of claim 1 to 12, wherein said polymer is chitosan.
14. polyelectrolyte complex compositions according to claim 13, wherein said chitosan number-average molecular weight (M n) be between 4 to 200kDa.
15. polyelectrolyte complex compositions according to claim 13 or 14, wherein said chitosan M nbe between 10 to 80kDa.
16. according to claim 13 to the polyelectrolyte complex composition according to any one of 15, and wherein said deacetylating degree of chitosan (DDA) is between 70% to 100%.
17. according to claim 13 to the polyelectrolyte complex composition according to any one of 15, and wherein said chitosan DDA is between 80% to 95%.
18. according to claim 13 to the polyelectrolyte complex composition according to any one of 17, and wherein chitosan/nucleic acid N/P ratio is between 1.2 to 30.
19. according to claim 13 to the polyelectrolyte complex composition according to any one of 17, and wherein chitosan/nucleic acid N/P ratio is between 2 to 10.
20. according to claim 13 to the polyelectrolyte complex composition according to any one of 17, and wherein chitosan/nucleic acid N/P ratio is 5.
21. polyelectrolyte complex compositions according to any one of claim 1 to 20, wherein said nucleic acid molecules is at least one in plasmid (pDNA), micro-ring, oligodeoxynucleotide (ODN) and ribonucleic acid molecule.
22. polyelectrolyte complex compositions according to claim 21, wherein said ribonucleic acid molecule is small interference ribonucleic acid (siRNA), bobby pin ribonucleic acid (shRNA) or Messenger RNA (mRNA).
23. polyelectrolyte complex compositions according to any one of claim 1 to 22, wherein said freeze drying protectant is disaccharide, trisaccharide, oligosaccharide/polysaccharide, polyhydric alcohol, polymer, high molecular weight excipients, amino acid molecular or their any combination.
24. polyelectrolyte complex compositions according to claim 23, wherein said disaccharide is at least one in sucrose, trehalose, lactose, maltose, cellobiose and 6-(.alpha.-D-galactosido)-D-glucose..
25. polyelectrolyte complex compositions according to claim 23, wherein disaccharide concentration is between 0.1% to 10% (w/v).
26. polyelectrolyte complex compositions according to claim 23, wherein disaccharide concentration is between 0.5% to 5% (w/v).
27. polyelectrolyte complex compositions according to claim 23, wherein disaccharide concentration is between 0.5% to 2% (w/v).
28. polyelectrolyte complex compositions according to claim 23, wherein said trisaccharide is at least one in maltotriose and Raffinose.
29. polyelectrolyte complex compositions according to claim 23, wherein trisaccharide concentration is between 0.1% to 10% (w/v).
30. polyelectrolyte complex compositions according to claim 23, wherein trisaccharide concentration is between 0.5% to 5% (w/v).
31. polyelectrolyte complex compositions according to claim 23, wherein trisaccharide concentration is between 0.5% to 2% (w/v).
32. polyelectrolyte complex compositions according to claim 23, wherein said oligosaccharide/polysaccharide is at least one in glucosan, cyclodextrin, maltodextrin, hetastarch, ficoll, cellulose, hydroxypropyl emthylcellulose and inulin.
33. polyelectrolyte complex compositions according to claim 32, wherein said glucosan M nbe between 1 to 70kDa.
34. polyelectrolyte complex compositions according to claim 32 or 33, wherein said glucosan M nbe between 1 to 5kDa.
35. polyelectrolyte complex compositions according to claim 23, wherein oligosaccharide/polysaccharide concentration is between 0.1% to 10% (w/v).
36. polyelectrolyte complex compositions according to claim 23, wherein oligosaccharide/polysaccharide concentration is between 0.5% to 5% (w/v).
37. polyelectrolyte complex compositions according to claim 23, wherein oligosaccharide/polysaccharide concentration is between 0.5% to 2% (w/v).
38. polyelectrolyte complex compositions according to claim 23, wherein said polyhydric alcohol is at least one in mannitol and inositol.
39. polyelectrolyte complex compositions according to claim 23, wherein said polyhydric alcohol concentration is between 0.1% to 10% (w/v).
40. polyelectrolyte complex compositions according to claim 23, wherein said polyhydric alcohol concentration is between 0.5% to 5% (w/v).
41. polyelectrolyte complex compositions according to claim 23, wherein said polyhydric alcohol concentration is between 2% to 3% (w/v).
42. polyelectrolyte complex compositions according to claim 23, wherein said amino acid molecular is at least one in lysine, arginine, glycine, alanine and phenylalanine.
43. polyelectrolyte complex compositions according to claim 23, wherein said amino acid molecular concentration is between 1 to 100mM.
44. polyelectrolyte complex compositions according to claim 23, wherein said amino acid molecular concentration is between 3 to 14mM.
45. polyelectrolyte complex compositions according to claim 23, wherein said amino acid molecular concentration is between 3 to 8mM.
46. polyelectrolyte complex compositions according to claim 23, wherein said amino acid molecular concentration is more preferably between 3 to 4mM.
47. polyelectrolyte complex compositions according to claim 23, wherein said high molecular weight excipients is at least one in PEG, gelatin, polydextrose and PVP.
48. polyelectrolyte complex compositions according to any one of Claims 1-4 7, wherein said buffer agent is at least one in sodium citrate, histidine, natrium malicum, sodium tartrate and sodium bicarbonate.
49. polyelectrolyte complex compositions according to any one of Claims 1-4 8, wherein said buffer concentration is between 1 to 100mM.
50. polyelectrolyte complex compositions according to any one of Claims 1-4 8, wherein said buffer concentration is between 3 to 14mM.
51. polyelectrolyte complex compositions according to any one of Claims 1-4 7, wherein said buffer concentration is between 3 to 8mM.
52. polyelectrolyte complex compositions according to any one of Claims 1-4 8, wherein said buffer concentration is between 3 to 4mM.
53. polyelectrolyte complex compositions according to any one of claim 1 to 13, wherein said freeze drying protectant is trehalose and described buffer agent is histidine.
54. polyelectrolyte complex compositions according to claim 53, wherein said freeze drying protectant is the trehalose of 0.5% to 2% (w/v) and described buffer agent is the histidine of 3 to 4mM.
55. polyelectrolyte complex compositions according to any one of claim 1 to 13, wherein said freeze drying protectant is sucrose and described buffer agent is histidine.
56. polyelectrolyte complex compositions according to claim 55, wherein said freeze drying protectant is the sucrose of 0.5% to 2% (w/v) and described buffer agent is the histidine of 3 to 4mM.
57. polyelectrolyte complex compositions according to any one of claim 1 to 13 and 53 to 56, wherein said nucleic acid is DNA.
58. 1 kinds of polyelectrolyte complex compositions, comprise chitosan, DNA (deoxyribonucleic acid) that content is about 50 μ g/mL, content are trehalose between about 0.5% (w/v) to about 1% (w/v) and content is that about 3mM is to the histidine about between 4mM.
59. 1 kinds of polyelectrolyte complex compositions, comprise chitosan, DNA (deoxyribonucleic acid) that content is about 100 μ g/mL, content are trehalose between about 1% (w/v) to 2% (w/v) and content is that about 6mM is to the histidine about between 8mM.
60. 1 kinds of methods preparing polyelectrolyte complex composition, described polyelectrolyte complex composition keeps its biologic activity after lyophilization and rehydration, said method comprising the steps of:
A) chitosan is mixed to form chitosan composite with freeze drying protectant and buffer agent;
B) independently nucleic acid is mixed to form nucleic acid compositions with described freeze drying protectant and described buffer agent; With
C) described chitosan composite is mixed with described nucleic acid compositions form described polyelectrolyte complex composition.
61. methods according to claim 60, wherein said chitosan is the chitosan dissolved.
62. methods according to claim 60 or 61, wherein step a) relates to and dilutes described chitosan with described freeze drying protectant and described buffer agent.
63. methods according to any one of claim 60 to 62, wherein step b) relate to and dilute described chitosan with described freeze drying protectant and described buffer agent.
64. methods according to any one of claim 60 to 62, comprise steps d further), described steps d) be in step c) and in the described compositions lyophilization that obtains.
65. methods according to any one of claim 60 to 64, wherein said nucleic acid molecules is at least one in plasmid (pDNA), oligodeoxynucleotide (ODN) and ribonucleic acid molecule.
66. methods according to any one of claim 60 to 65, wherein said freeze drying protectant is disaccharide, trisaccharide, oligosaccharide/polysaccharide, polyhydric alcohol, polymer, high molecular weight excipients, amino acid molecular or their any combination.
67. methods according to any one of claim 60 to 66, wherein said buffer agent is at least one in sodium citrate, citric acid, histidine, natrium malicum, sodium tartrate and sodium bicarbonate.
68. 1 kinds of test kits, comprise as any one of claim 1 to 59 the polyelectrolyte complex composition that limits; With the description for reconstructing described compositions.
69. test kits according to claim 68, comprise water further.
70. test kits according to claim 68, wherein said water is the water being applicable to being expelled in experimenter.
71. test kits according to any one of claim 68 to 70, comprise the description for reconstruct before being expelled in experimenter further.
72. test kits according to claim 69, wherein said polyelectrolyte complex composition reconstructs in water according to the concentration of its initial concentration 5 times.
73. test kits according to claim 69, wherein said polyelectrolyte complex composition reconstructs in water according to the concentration of its initial concentration 10 times.
74. test kits according to claim 69, wherein said polyelectrolyte complex composition reconstructs in water according to the concentration of its initial concentration 20 times.
75. polyelectrolyte complex compositions as limited in any one of claim 1 to 59 are used for delivery of nucleic acids to needing its purposes of experimenter.
CN201480042301.9A 2013-06-10 2014-06-09 Freeze-dried polyelectrolyte complexes that maintain size and biological activity Pending CN105492014A (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US201361833010P 2013-06-10 2013-06-10
US61/833,010 2013-06-10
PCT/CA2014/000490 WO2014197970A1 (en) 2013-06-10 2014-06-09 Freeze-dried polyelectrolyte complexes that maintain size and biological activity

Publications (1)

Publication Number Publication Date
CN105492014A true CN105492014A (en) 2016-04-13

Family

ID=52021515

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201480042301.9A Pending CN105492014A (en) 2013-06-10 2014-06-09 Freeze-dried polyelectrolyte complexes that maintain size and biological activity

Country Status (7)

Country Link
US (1) US20160130606A1 (en)
EP (1) EP3007707A4 (en)
JP (1) JP2016521727A (en)
CN (1) CN105492014A (en)
AU (1) AU2014280796A1 (en)
CA (1) CA2915131A1 (en)
WO (1) WO2014197970A1 (en)

Families Citing this family (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2121048B9 (en) 2007-02-19 2016-02-24 Marine Polymer Technologies, Inc. Hemostatic compositions and therapeutic regimens
SG11201707663SA (en) 2015-04-17 2017-11-29 Curevac Ag Lyophilization of rna
EP3928800A3 (en) 2015-05-20 2022-03-23 CureVac AG Dry powder composition comprising long-chain rna
EP3334776A4 (en) * 2015-08-13 2019-03-27 The Johns Hopkins University Methods of preparing polyelectrolyte complex nanoparticles
KR102175069B1 (en) * 2017-11-10 2020-11-05 주식회사 삼양바이오팜 Composition and process for freeze-drying of lipid nanoparticles for delivering an anionic drug
CN113092767B (en) * 2021-04-02 2024-03-12 丹娜(天津)生物科技股份有限公司 Limulus reagent freeze-dried microsphere and preparation method and application thereof
CN114606300A (en) * 2022-03-29 2022-06-10 武汉明德生物科技股份有限公司 Freeze-drying system for nucleic acid detection
US11833224B1 (en) 2023-02-08 2023-12-05 Leuvian Llc Lyoprotectant compositions and uses thereof

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2009006905A1 (en) * 2007-07-06 2009-01-15 Aarhus Universitet Dehydrated chitosan nanoparticles

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2007059605A1 (en) * 2005-11-04 2007-05-31 Bio Syntech Canada Inc. Composition and method for efficient delivery of nucleic acids to cells using chitosan
WO2010125544A1 (en) * 2009-04-30 2010-11-04 Genetic Immunity Kft. Immunogenic nanomedicine composition and preparation and uses thereof
CA2835147A1 (en) * 2011-05-24 2012-11-29 Polyvalor S.E.C. Compositions and methods for efficacious and safe delivery of sirna using specific chitosan-based nanocomplexes
CA2867888C (en) * 2012-03-21 2021-06-01 Engene, Inc. Dually derivatized chitosan nanoparticles and methods of making and using the same for gene transfer in vivo

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2009006905A1 (en) * 2007-07-06 2009-01-15 Aarhus Universitet Dehydrated chitosan nanoparticles

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
WASSIM ABDELWAHED ETAL: "Freeze-drying of nanoparticles：formulation，process and storage consideration", 《ADVANCED DRUG DELIVERY REVIEWS》 *

Also Published As

Publication number Publication date
CA2915131A1 (en) 2014-12-18
WO2014197970A1 (en) 2014-12-18
US20160130606A1 (en) 2016-05-12
AU2014280796A1 (en) 2016-01-28
JP2016521727A (en) 2016-07-25
EP3007707A1 (en) 2016-04-20
EP3007707A4 (en) 2017-01-04

Similar Documents

Publication Publication Date Title
CN105492014A (en) Freeze-dried polyelectrolyte complexes that maintain size and biological activity
Ma et al. Biomimetic nanoerythrosome‐coated aptamer–DNA tetrahedron/maytansine conjugates: pH‐responsive and targeted cytotoxicity for HER2‐positive breast cancer
Zhu et al. Tumor‐specific self‐degradable nanogels as potential carriers for systemic delivery of anticancer proteins
Tian et al. A doxorubicin delivery platform using engineered natural membrane vesicle exosomes for targeted tumor therapy
Song et al. Peptide-conjugated fluorescent silicon nanoparticles enabling simultaneous tracking and specific destruction of cancer cells
EP2776056B1 (en) Novel composition for gene delivery
CN101448939B (en) Freeze-dried product for transferring nucleic acid, oligonucleic acid or derivative thereof
CN107980004A (en) Purposes for the excretion body for the treatment of disease
CN101184511B (en) Preparation comprising microparticles of complex composed of nucleic acid molecule and collagen
Fan et al. Engineered extracellular vesicles as intelligent nanosystems for next-generation nanomedicine
CN105188905B (en) Substance encapsulation micro-capsule and preparation method thereof
CN103906504A (en) Method of producing lipid nanoparticles for drug delivery
Chen et al. Smart hypoxia-responsive transformable and charge-reversible nanoparticles for the deep penetration and tumor microenvironment modulation of pancreatic cancer
CN104958258A (en) Substance-encapsulating vesicle and process for producing the same
Zackova Suchanova et al. The protein corona does not influence receptor-mediated targeting of virus-like particles
JP2022551531A (en) Methods for providing John Cunningham virus VLPs
Choi et al. Targeted delivery of exosomes armed with anti-cancer therapeutics
Luo et al. Live‐cell imaging of octaarginine‐modified polymer dots via single particle tracking
Wu et al. Oxygen microcapsules improve immune checkpoint blockade by ameliorating hypoxia condition in pancreatic ductal adenocarcinoma
Lin et al. Amelioration of cirrhotic portal hypertension by targeted cyclooxygenase-1 siRNA delivery to liver sinusoidal endothelium with polyethylenimine grafted hyaluronic acid
Guarro et al. Efficient extracellular vesicles freeze-dry method for direct formulations preparation and use
Han et al. Inhibition of SerpinB9 to enhance granzyme B-based tumor therapy by using a modified biomimetic nanoplatform with a cascade strategy
Henderson et al. Leveraging biological buffers for efficient messenger RNA delivery via lipid nanoparticles
Xu et al. PEG modification enhances the in vivo stability of bioactive proteins immobilized on magnetic nanoparticles
Li et al. Rod-shaped polypeptide nanoparticles for siRNA delivery

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
WD01 Invention patent application deemed withdrawn after publication
WD01 Invention patent application deemed withdrawn after publication

Application publication date: 20160413