CN105483241A - LAMP (Loop-mediated isothermal amplification) detection primer group and kit and detection method for gene cry1Ie of transgenic plants - Google Patents

Abstract

The invention discloses an LAMP (Loop-mediated isothermal amplification) detection primer group and kit and a detection method for a gene cry1Ie of transgenic plants. The primer group consists of 5 specific primers and has nucleotide sequences shown in SEQ ID NO: 1-5. The detection kit comprises a detection primer solution, DNA polymerase with strand displacement activity, a 10x reaction buffer, a dNTPs solution and a color developing agent. The detection method comprises the steps of carrying out amplification on a DNA template of a sample at the temperature of 63-65 DEG C by adopting the specific primers and the DNA polymerase with strand displacement activity, and judging whether the sample contains a gene cry1Ie component or not by adopting a color developing agent added color change observing method. The detection primer group and kit and the detection method do not need special instruments, have the characteristics of rapidness, high efficiency, simplicity and convenience in operation, high specificity and the like and are applicable to field detection.

Description

The LAMP detection primer group of cry1Ie gene, test kit and detection method in transgenic plant

Technical field

The invention belongs to technical field of molecular biology, relate to the detection method of transgenic plant and products thereof, be specifically related to one and utilize in loop-mediated isothermal amplification technique (LAMP) rapid detection transgenic plant cry1Iethe primer sets of gene, test kit and detection method.

Background technology

Within 2014, global genetically modified crops cultivated area is up to 1.815 hundred million hectares, increases more than 100 doubly than the commercialization initial stage in 1996.The genetically modified crops of current commercial growth mainly contain soybean, corn, cotton, rape, and major traits is pest-resistant and antiweed.Derive from bacillus thuringiensis ( bacillusthuringiensis, bt) anti insect gene be at present most widely used in transgenic plant anti insect gene, comprise cry1Ab, cry1F, cry1Ie, cry1C, cry34Ab, cry35Ab, vip3Adeng, wherein cry1Iegene is the efficient anti insect gene of one of China's independent research, has been widely applied in the new variety research of transgenic corns, soybean.For cry1Iegene carries out the detection method research of fast accurate, is the GMO bio-safety management technical support implemented smoothly of relevant laws and regulations and guarantee.

Detection of GMOs technology is mainly divided into two large classes: a class is detected object with foreign DNA, as PCR, gene chip etc., another kind of with the protein of exogenous gene expression for detected object, as ELISA, immunity test strip etc.In the above-mentioned methods, current round pcr is most widely used, but the transgenic detection method of PCR-based needs the special instrument such as PCR instrument, gel imaging system equipment, and amplification and product detection time longer (about 3 ~ 4h), be difficult to reach field quick detection object, therefore, need in real work a kind of more convenient, accurate and be applicable to the detection GMOs new technology of execute-in-place.

LAMP technology is that the basic characteristics of this technology are: 1. constant-temperature amplification: whole amplified reaction carries out at constant temperature (60 ~ 65 DEG C), does not need special instruments and equipment by a kind of new gene amplification of Japanese Eiken Chemical exploitation in 2000; 2. rapidly and efficiently: whole amplification and product detect and can complete in 1h; 3. high specific: 6 zone design 4 for target sequence detect primer, and specific amplification is high; 4. highly sensitive: limit of detection can be low to moderate 10 copies or lower; 5. identify easy: by the precipitation change in naked eyes or turbidimeter observing response pipe, or to add after staining agent by methods such as visual color changes in reaction tubes, amplified production is detected easily.

LAMP method has rapidly and efficiently, easy and simple to handle, high specificity, sensitivity high, does not need specific apparatus, is applicable to field quick detection, has broad application prospects in transgenic plant detection field.LAMP method is not yet utilized to detect in transgenic plant at present cry1Iethe detection method of gene and test kit.

Summary of the invention

One object of the present invention is in open a kind of transgenic plant cry1Iethe LAMP detection primer group of gene.

Another object of the present invention is in open a kind of transgenic plant cry1Iethe LAMP detection kit of gene.

Another object of the present invention is that open one detects in transgenic plant based on above-mentioned primer sets and test kit cry1Iethe LAMP detection method of gene.

The technical solution adopted in the present invention is as follows:

According to cry1Iethe nucleotide sequence of gene, design cry1Iethe LAMP detection primer group of gene, its nucleotide sequence is as SEQIDNO:1 ~ 5; Determine the technical parameter of LAMP detection method, and the specificity of detection method is verified.

In transgenic plant cry1Iethe LAMP detection primer group of gene, comprises outer primer F3, outer primer B3, inner primer FIP, inner primer BIP and ring primer LF, and its nucleotide sequence is as follows respectively:

Outer primer F3:CCTGCGCATGAGCGAG(SEQIDNO:1);

Outer primer B3:GGTCGATCAGCTCCTCCA(SEQIDNO:2);

Inner primer FIP:AGGATCTTGCCGGCGATGCCACGAGAGCATCGACCCCT(SEQIDNO:3);

Inner primer BIP:GCCTGTACAGCTTCATCCTGGGCGTGCTCCATGAAGATCTCC(SEQIDNO:4);

Ring primer LF:CCGGTCTGGATGGTGCT(SEQIDNO:5).

In transgenic plant cry1Iethe LAMP detection kit of gene, comprises following component:

(1) detect primer solution: the detection primer solution prepared by above-mentioned 5 primers, the concentration of outer primer F3, outer primer B3, inner primer FIP, inner primer BIP and ring primer LF is followed successively by 4 ~ 6 μm of ol/L, 4 ~ 6 μm of ol/L, 32 ~ 48 μm of ol/L, 32 ~ 48 μm of ol/L and 4 ~ 6 μm ol/L;

(2) there is the BstDNA polysaccharase of strand-displacement activity: concentration is 7 ~ 9U/ μ L;

(3) 10 × reaction buffers: 200mmol/LTris-HCl, pH8.8,100mmol/LKCl, 100mmol/L (NH ₄) ₂sO ₄, 40 ~ 100mmol/LMgSO ₄, 6 ~ 14mol/L trimethyl-glycine;

(4) dNTPs solution, dATP, dCTP, dGTP, dTTP tetra-kinds of deoxyribonucleotide solution equal-volumes being respectively 10mmol/L by concentration mix;

(5) developer: 1000 × SYBRGREENI fluorescence dye.

Preferably, containing 5 μm of ol/L outer primer F3,5 μm of ol/L outer primer B3,40 μm of ol/L inner primer FIP, 40 μm of ol/L inner primer BIP, 5 μm of ol/L ring primer LF in described detection primer solution.

Preferably, the concentration of described BstDNA polysaccharase is 8U/ μ L.

Preferably, MgSO in 10 described × reaction buffer ₄, beet paper mill wastewater is respectively 80mmol/L and 8mol/L.

Above-described test kit is utilized to detect cry1Iethe method of gene, comprises the steps:

(1) genomic dna of testing sample is extracted;

(2) the LAMP detection reaction system of testing sample is prepared: in 200 μ LPCR reaction tubess, adding template DNA 2 ~ 5 μ L, detect primer solution 1 μ L, BstDNA polysaccharase 1 μ L, 10 × reaction buffer 2.5 μ L, dNTPs solution 2 ~ 5 μ L, is 25 μ L with sterilizing deionized water or ultrapure water polishing to cumulative volume;

(3) cover the developer adding 1 μ L at reaction tubes, cover on reaction tubes;

(4) LAMP amplified reaction is run: be placed on by reaction tubes in thermostat water bath, hatch 60min for 65 DEG C, hatch 5min termination reaction for 80 DEG C;

(5) qualification of LAMP amplification: put upside down reaction tubes, the developer that pipe is covered fully mixes with reaction soln, if reaction tubes shows green, is positive, if manifest orange, is negative.

Prove by experiment, provided by the invention cry1Iethe advantages such as the LAMP detection primer group of gene, test kit and detection method have rapidly and efficiently, easy and simple to handle, high specificity.

Accompanying drawing explanation

Fig. 1 is the result figure carrying out specific detection in embodiment 2,1 ~ 8 be followed successively by turn cry1Ie gene corn IE09S034, turn cry1C trans-genetic hybrid rice T1c-19, turn cry1F gene corn TC1507, turn cry34Ab and cry35Ab gene corn 59122, turn vip3A gene M IR162, turn dmo transgenic soybean MON87708, turn aad1 gene corn DAS40278-9 and non-transgenic corn contrast.

Embodiment

Below in conjunction with embodiment, the present invention is further illustrated.

Embodiment 1 test kit and detection method thereof.

By following formula preparation cry1Iethe LAMP detection kit of gene, the specification of each test kit is 100 secondary responses:

(1) primer solution is detected: synthesis outer primer F3, outer primer B3, inner primer FIP, inner primer BIP and ring primer LF, primer dry powder ultrapure water is made into the mother liquor that concentration is 100 μm of ol/L respectively, then 5 μ L outer primer F3,5 μ L outer primer B3,40 μ L inner primer FIP, 40 μ L inner primer BIP, 5 μ L ring primer LF, 5 μ L sterilizing deionized waters are got respectively, put into a new 1.5mL centrifuge tube, abundant mixing, is made into 100 μ L's cry1Iethe LAMP detection primer solution of gene, wherein primer sequence is respectively:

Outer primer F3:CCTGCGCATGAGCGAG(SEQIDNO:1);

Outer primer B3:GGTCGATCAGCTCCTCCA(SEQIDNO:2);

Inner primer FIP:AGGATCTTGCCGGCGATGCCACGAGAGCATCGACCCCT(SEQIDNO:3);

Inner primer BIP:GCCTGTACAGCTTCATCCTGGGCGTGCTCCATGAAGATCTCC(SEQIDNO:4);

Ring primer LF:CCGGTCTGGATGGTGCT(SEQIDNO:5);

(2) BstDNA polysaccharase: concentration is 8U/ μ L, packing 100 μ L puts into a new 1.5mL centrifuge tube;

(3) 10 × reaction buffers: comprise 200mmol/LTris-HCl, pH8.8,100mmol/LKCl, 100mmol/L (NH ₄) ₂sO ₄, 80mmol/LMgSO ₄with 8mol/L trimethyl-glycine, packing 250 μ L puts into a new 1.5mL centrifuge tube;

(4) dNTPs solution, dATP, dCTP, dGTP, dTTP tetra-kinds of deoxyribonucleotide solution equal-volumes being respectively 10mmol/L by concentration mix, and packing 500 μ L puts into a new 1.5mL centrifuge tube;

(5) developer: 1000 × SYBRGREENI fluorescence dye, packing 200 μ L puts into a new brown 1.5mL centrifuge tube.

By the following method testing sample is detected with above-mentioned test kit:

(1) extract the genomic dna of testing sample: adopt the plant DNA extraction kit method that Beijing Tian Gen company produces, extract the genomic dna of testing sample, be diluted to 25ng/ μ L;

(2) prepare the LAMP detection reaction system of testing sample: the reaction system adopting 25 μ L, in 200 μ L reaction tubess, add ultrapure water 15.5 μ L, template DNA 2 μ L successively, detect primer solution 1 μ L, BstDNA polysaccharase 1 μ L, 10 × reaction buffer 2.5 μ L, dNTPs solution 3 μ L;

(3) cover the developer adding 1 μ L at reaction tubes, cover on reaction tubes;

(4) LAMP amplified reaction is run: be placed on by reaction tubes in thermostat water bath, hatch 60min for 65 DEG C, hatch 5min termination reaction for 80 DEG C;

(5) qualification of LAMP amplification: put upside down reaction tubes, the developer that pipe is covered fully mixes with reaction soln, if reaction tubes shows green, is positive, if manifest orange, is negative.

The specificity experiments of embodiment 2 test kit and detection method.

Prepare test kit by the test kit preparation method described in embodiment 1, and specificity test carried out to its detection method:

(1) genomic dna turning cry1Ie gene corn IE09S034, turn cry1C trans-genetic hybrid rice T1c-19, turn cry1F gene corn TC1507, turn cry34Ab and cry35Ab gene corn 59122, turn vip3A gene M IR162, turn dmo transgenic soybean MON87708, turn 8 kinds of test materialss such as aad1 gene corn DAS40278-9 and non-transgenic corn is extracted, measure DNA concentration with ND1000 nucleic acid microdetermination instrument, be diluted to 25ng/ μ L with ultrapure water;

(2) in eight unions of 200 μ L, according to the step described in embodiment 1, in each pipe, add ultrapure water 15.5 μ L successively, detect primer solution 1 μ L, BstDNA polysaccharase 1 μ L, 10 × reaction buffer 2.5 μ L, dNTPs solution 3 μ L, then add respectively in 1-8 pipe IE09S034, the T1c-19 of 2 μ L, TC1507,59122, MIR162, MON87708, DAS40278-9, non-transgenic corn sample DNA contrast;

(3) cover the developer adding 1 μ L at each pipe of eight union lids, cover in eight unions;

(4) LAMP amplified reaction is run: be placed in thermostat water bath by eight unions, hatch 60min for 65 DEG C, hatch 5min termination reaction for 80 DEG C;

(5) qualification of LAMP amplification: put upside down reaction tubes, the developer that eight unions are covered fully mixes with reaction soln, if reaction tubes shows green, is positive, if manifest orange, is negative.

In the present embodiment, only containing cry1Ieshows green in the transgenic corns IE09S034 sample hose of gene, shows test kit of the present invention and detection method pair cry1Iegene has good specificity.

Should be noted that; above-described embodiment is specific embodiments of the invention; but embodiments of the present invention are not restricted to the described embodiments; all distortion that those of ordinary skill in the art can directly derive from content disclosed by the invention or associate, all should think protection scope of the present invention.

Claims (6)

1. in transgenic plant cry1Iethe LAMP detection primer group of gene, comprises outer primer F3, outer primer B3, inner primer FIP, inner primer BIP and ring primer LF, and its nucleotide sequence is as follows respectively:

Outer primer F3:CCTGCGCATGAGCGAG(SEQIDNO:1);

Outer primer B3:GGTCGATCAGCTCCTCCA(SEQIDNO:2);

Inner primer FIP:AGGATCTTGCCGGCGATGCCACGAGAGCATCGACCCCT(SEQIDNO:3);

Inner primer BIP:GCCTGTACAGCTTCATCCTGGGCGTGCTCCATGAAGATCTCC(SEQIDNO:4);

Ring primer LF:CCGGTCTGGATGGTGCT(SEQIDNO:5).

2. in transgenic plant cry1Iethe LAMP detection kit of gene, comprises following component:

(1) detect primer solution: the detection primer solution prepared by 5 primers according to claim 1, the concentration of outer primer F3, outer primer B3, inner primer FIP, inner primer BIP and ring primer LF is followed successively by 4 ~ 6 μm of ol/L, 4 ~ 6 μm of ol/L, 32 ~ 48 μm of ol/L, 32 ~ 48 μm of ol/L and 4 ~ 6 μm ol/L;

(2) there is the BstDNA polysaccharase of strand-displacement activity: concentration is 7 ~ 9U/ μ L;

(3) 10 × reaction buffers: 200mmol/LTris-HCl, pH8.8,100mmol/LKCl, 100mmol/L (NH ₄) ₂sO ₄, 40 ~ 100mmol/LMgSO ₄, 6 ~ 14mol/L trimethyl-glycine;

(4) dNTPs solution, dATP, dCTP, dGTP, dTTP tetra-kinds of deoxyribonucleotide solution equal-volumes being respectively 10mmol/L by concentration mix;

(5) developer: 1000 × SYBRGREENI fluorescence dye.

3. according to claim 2 cry1Iethe LAMP detection kit of gene, is characterized in that: containing 5 μm of ol/L outer primer F3,5 μm of ol/L outer primer B3,40 μm of ol/L inner primer FIP, 40 μm of ol/L inner primer BIP, 5 μm of ol/L ring primer LF in described detection primer solution.

4. according to claim 2 cry1Iethe LAMP detection kit of gene, is characterized in that: the concentration of described BstDNA polysaccharase is 8U/ μ L.

5. according to claim 2 cry1Iethe LAMP detection kit of gene, is characterized in that: MgSO in 10 described × reaction buffer ₄, beet paper mill wastewater is respectively 80mmol/L, 8mol/L.

6. utilize the test kit described in any one of claim 2 ~ 5 to detect cry1Iethe method of gene, comprises the following steps:

(1) genomic dna of testing sample is extracted;

(2) the LAMP detection reaction system of testing sample is prepared: in 200 μ L reaction tubess, adding template DNA 2 ~ 5 μ L, detect primer solution 1 μ L, BstDNA polysaccharase 1 μ L, 10 × reaction buffer 2.5 μ L, dNTPs solution 2 ~ 5 μ L, is 25 μ L with sterilizing deionized water or ultrapure water polishing to cumulative volume;

(3) cover the developer adding 1 μ L at reaction tubes, cover on reaction tubes;

(4) LAMP amplified reaction is run: be placed on by reaction tubes in thermostat water bath, hatch 60min for 65 DEG C, hatch 5min termination reaction for 80 DEG C;

(5) qualification of LAMP amplification: put upside down reaction tubes, the developer that pipe is covered fully mixes with reaction soln, if reaction tubes shows green, is positive, if manifest orange, is negative.