CN105483230A - MiR-3197 molecular marker for detecting type 2 diabetic retinopathy and amplification primer and application thereof - Google Patents
MiR-3197 molecular marker for detecting type 2 diabetic retinopathy and amplification primer and application thereof Download PDFInfo
- Publication number
- CN105483230A CN105483230A CN201510980953.3A CN201510980953A CN105483230A CN 105483230 A CN105483230 A CN 105483230A CN 201510980953 A CN201510980953 A CN 201510980953A CN 105483230 A CN105483230 A CN 105483230A
- Authority
- CN
- China
- Prior art keywords
- mir
- retinopathy
- diabetes
- primer
- amplimer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA
Abstract
The invention discloses a miR-3197 molecular marker for detecting type 2 diabetic retinopathy and an amplification primer and an application thereof. The miR-3197 molecular marker is characterized in that a nucleotide sequence of the miR-3197 molecular marker is 5'GGAGGCGCAGGCUCGGAAAGGCG-3', and a nucleotide sequence of a positive amplification primer of the miR-3197 molecular marker is 5'-GGA GGC GCA GGC TCG GAA -3'. The miR-3197 molecular marker has the advantages of high detection efficiency and high specificity, and can be applied to auxiliary diagnosis, detection or medicament screening of the type 2 diabetic retinopathy.
Description
Technical field
The present invention relates to a kind of miRNA molecule marker, especially relating to a kind of miR-3197 molecular marked compound for detecting diabetes B retinopathy and amplimer thereof and application.
Background technology
Diabetes B (Type2diabetesmellitus, T2DM) has another name called non-insulin-dependent diabetes mellitus (NIDDM), is the topmost types of diabetes, accounts for 90%(23499527).The multifactor Metabolic Syndrome of feature that to be a group with chronic hyperglycemia be, it be global mainly lethal, disable and expend one of huge disease.Diabetic retinopathy (Diabeticretinopathy, DR), as one of the most serious microvascular complication of diabetes, has become the first reason of diabetic subject's blinding, current global DR patient about 93,000,000 (22301125).China diabetic subject 9,240 ten thousand, and occupy first, the whole world, wherein DR morbidity is 37%(20335585).And along with the increase of onset diabetes rate and the prolongation of the average life span, the morbidity of DR just constantly increases, and points out the major cause that following DR will be visual loss and visual function damage.The gold standard of diagnosis of diabetic retinopathy is fluorescence fundus angiography, but it is invasive detection, has traumatic, and expensive, time-consuming.Therefore, find the generation of the prediction of some biomarkers or warning DR, its blind rate of reduction is had great significance.
At present, there are some researches show that circulation miRNAs is the new biomarkers that a class has potential diagnostic value.But at present, also do not disclose any molecular marked compound about utilizing miRNA molecule as the retinopathy prediction of detection diabetes B or diagnosis both at home and abroad to report to the correlative study detecting diabetes B retinopathy.
Summary of the invention
Technical problem to be solved by this invention is to provide a kind of miR-3197 molecular marked compound for detecting diabetes B retinopathy and amplimer thereof and application, wherein circulation miR-3197 expression level and diabetes B retinopathy morbidity are proportionate, detection efficiency is high, with strong points.
The present invention solves the problems of the technologies described above adopted technical scheme: a kind of miR-3197 molecular marked compound for detecting diabetes B retinopathy, described miRNA molecule marker is miR-3197 molecular marker, and the nucleotides sequence of molecular marked compound miR-3197 gene fragment is classified as 5 ' GGAGGCGCAGGCUCGGAAAGGCG-3 '.
The nucleotides sequence of the forward amplimer of above-mentioned miR-3197 molecular marker is classified as 5 '-GGAGGCGCAGGCTCGGAA-3 ', and its reverse amplimer is universal primer.
For detecting a test kit for diabetes B retinopathy, this test kit comprises the forward amplimer of the above-mentioned miR-3197 gene fragment that increases: the nucleotides sequence of the forward amplimer of 5 '-GGAGGCGCAGGCTCGGAA-3 ' and cel-miR-39 reference gene is classified as: 5 '-CGTGAGTCGATCCATATTGTA-3 '.
Utilize above-mentioned miR-3197 molecular marked compound to detect a detection method for diabetes B retinopathy, step is as follows:
The extraction of a, total serum IgE;
B, employing miScript IIRTKit test kit carry out reverse transcription to miRNA;
C, pcr amplification: utilize 7500real-timePCRsystem instrument to carry out, add cel-miR-39 as reference gene, 25ul amplification system: 12.5ulSYBRGreen mixed solution, 2.5ul universal primer, 2.5ul Auele Specific Primer, 2ulcDNA solution and 5.5ul are without RNA enzyme water; Amplification reaction condition: initial activation at 95 DEG C, 15 minutes; 94 DEG C of 15s, 55 DEG C of 30s, 70 DEG C of 30s, totally 40 circulations; Melting curve analysis is carried out after having reacted; Wherein primer solution comprises the forward amplimer of amplification miR-3197 gene fragment: the forward amplimer of 5 '-GGAGGCGCAGGCTCGGAA-3 ' and cel-miR-39 reference gene, its nucleotides sequence is classified as: 5 '-CGTGAGTCGATCCATATTGTA-3 ', and reverse primer is universal primer; Each primer concentration is 10pmol/ul;
D, qualification: after having increased, utilize 2
-△ △ CTmethods analyst gene expression amount, if miR-3197 gene fragment high level expression, and expresses multiple and thinks that to be in pathogenesis of diabetic retinopathy early stage higher than 1.7.
Compared with prior art, the invention has the advantages that: the present invention makes public for the first time miR-3197 molecular marked compound for detecting diabetes B retinopathy and amplimer thereof and application, wherein molecular marked compound is miR-3197 molecular marker, reference gene is the forward primer of cel-miR-39 and amplification miR-3197, cel-miR-39; Detection method is the extraction of total serum IgE, cDNA synthesis, pcr amplification and qualification, identifies quick, easy, special and effective.The increase of circulation miR-3197 expression level can cause diabetic retinopathy to occur, and is proportionate with pathogenesis of diabetic retinopathy rate.The detection that the excavation of this marker and application can realize quickly and easily on a molecular scale to diabetes B retinopathy, detection efficiency is high, with strong points, meanwhile, the medicine being target spot with the miR-3197 expression level that circulates is expected to become a kind of new tool of diabetes B retinopathy auxiliary diagnosis, detection and screening.
Accompanying drawing explanation
Fig. 1 is the expression level otherness figure of circulation miR-3197 at DR and T2DM;
Fig. 2 is the ROC graphic representation of the miR-3197 gene fragment that pcr amplification obtains.
Embodiment
Below in conjunction with accompanying drawing embodiment, the present invention is described in further detail.
Specific embodiment
1, the collection of research object
This studies all samples is all collect under the approval of the medical research ethics council of unit and patient's informed consent situation, wherein healthy group serum sample 144 example, pre-diabetes group serum sample 70 example, T2DM serum sample 117 example and DR serum sample 75 example.Collection requirement: 1. diagnosis is all through fluorescence fundus angiography inspection confirmation, and DR is verified microangioma, hemorrhage, hard exudate, flocculence is soft the symptom such as to ooze out; Healthy group, pre-diabetes group, T2DM group verified eyes mydriasis check that eyeground is normal.All get rid of 1. acute and chronic infectious diseases; 2. severe cardiac, brain, hepatic disorder and affect other endocrinopathy glycometabolic; 3. simple eye or eyes refracting media is obviously muddy, the person that affects fundus observation.
2, use gene chip strictly match according to age, sex, BMI and medical history (>10) at 5 routine pre-diabeteses, 5 routine Healthy Peoples, 5 routine T2DM and 5 routine DR() filter out in serum sample variant obvious, closely-related circulation miRNAs may be developed with DR.
According to chip detection technology, result display circulation miR-3197, miR-2116-5P, miR-3939 and miR-1910-3p differential expression in DR and T2DM group is remarkable.The nucleotide sequence of each molecular marked compound gene fragment is as follows: the nucleotides sequence of molecular marked compound miR-3197 is classified as 5 '-GGAGGCGCAGGCUCGGAAAGGCG-3 ';
The nucleotides sequence of miR-2116-5P is classified as: 5 '-GGUUCUUAGCAUAGGAGGUCU-3 ';
The nucleotides sequence of miR-3939 is classified as: 5 '-UACGCGCAGACCACAGGAUGUC-3 ';
The nucleotides sequence of miR-1910-3p is classified as: 5 '-GAGGCAGAAGCAGGAUGACA-3 ';
3, by mating according to age, sex, BMI and medical history (>10), 45 routine DR serum and 45 routine T2DM serum samples are finally matched out, and enlarged sample checking further.
4, the serum miRNA that miRNeasySerum/PlasmaKit (Qiagen) test kit extracts sample is applied, the concentration of gained miRNA is detected again, for circulation miR-3197, miR-2116-5P, miR-3939 and miR-1910-3p fluorescence quantitative PCR detection by spectrophotometer.
5, RT-PCR detects
This research adopts quantitative fluorescent PCR (RT-PCR) to detect at DR and T2D expression level circulation miR-3197, miR-2116-5P, miR-3939 and miR-1910-3p.The ultimate principle of this technology: in PCR reaction system, add excessive SYBR fluorescence dye, after SYBR fluorescence dye non-specifically mixes DNA double chain, emitting fluorescence signal, and the SYBR dye molecule do not mixed in chain can not launch any fluorescent signal, thus ensure the increase of fluorescent signal and the increase Complete Synchronization of PCR primer.SYBR only combines with double-stranded DNA, therefore can pass through solubility curve, determines whether PCR reaction is special.MiR-3197PCR amplification forward primer sequence for testing is as follows: 5 '-GGAGGCGCAGGCTCGGAA-3 ', miR-2116-5PPCR amplification forward primer sequence: 5 '-GGGTTCTTAGCATAGGAGGTC-3 ', miR-3939PCR amplification forward primer sequence: 5 '-TTACGCGCAGACCACAGGAT-3 ', miR-1910-3pPCR amplification forward primer sequence: 5 '-TGGAGGCAGAAGCAGGATGA-3 '.Reverse primer is universal primer (nucleotide sequence is as shown in SEQIDNO.9: GAATCGAGCACCAGTTACGCATG).The nucleotides sequence of cel-miR-39 reference gene is classified as: 5 '-CCUGAGUCGAUCGAUAUAGGA-3 '.The nucleotides sequence of the forward primer of amplification cel-miR-39 reference gene is classified as: 5 '-CGTGAGTCGATCCATATTGTA-3 ', oppositely be universal primer (nucleotide sequence is as shown in SEQIDNO.9: GAATCGAGCACCAGTTACGCATG) to primer, volume is 2.5ul.
The concrete steps of above-mentioned amplification are:
(1) miRNeasy serum extracts test kit (Qiagen) and extracts serum miRNAs, adds 3.5 μ lmiRNA-39 as internal control in the serum miRNA extracted;
(2) miScript II Reverse Transcription box (Qiagen, Germany) test kit is adopted to carry out reverse transcription to miRNA;
(3) cDNA that reverse transcription in step (2) becomes is diluted 11 times at quantitative polyase chain reaction (PCR), adding cel-miR-39 is that normalized outer ginseng controls, 25ul amplification system: 12.5ulSYBRPCR mixed solution, 2.5ul universal primer, 2.5ul Auele Specific Primer, 2ulcDNA solution and 5.5ul are without RNA enzyme water.Amplification step comprises initial activation at 95 DEG C, 15 minutes; 94 DEG C of 15s, 55 DEG C of 30s, 70 DEG C of 30s, carry out 40 circulations altogether.And operate at 7500real-timePCRsystem (AppliedBiosystems) instrument.(note: Tm determines according to race PCR gradient temperature in an experiment) each primer concentration is 10pmol/ul.
6, data analysis
This studies employing 2
-△ △ CTmethod carries out to data the case figure (as shown in Figure 1) that finishing analysis obtains, and found that: detected circulation miR-3197 in DR and T2DM differential expression significantly, P=0.0033, is less than 0.01, has statistical significance.
In ROC curve (Receiver operating curve) figure (as shown in Figure 2) obtained by SPSS18.0 software analysis, area under curve (AUC) is 0.967, be greater than 0.5, this illustrates that the expression level degree of circulation miR-3197 is used for auxiliary diagnosis diabetes B retinopathy and has very strong diagnostic value.Carry out auxiliary diagnosis diabetic retinopathy by the expression level degree of test kit detection circulation miR-3197 to have the certain significance.Note: reference line and chance diagonal lines, under reference line, area (AUC) is 0.5, and under this line, then this diagnostic method does not have diagnostic value completely.
Qualification: after having increased, utilize 2
-△ △ CTmethods analyst gene expression amount, if miR-3197 gene fragment high level expression, and expresses multiple and thinks that to be in pathogenesis of diabetic retinopathy early stage higher than 1.7.
By the Measurement and analysis of test kit to circulation miRNAs expression level, we find: in total group, miR-3197 has difference between diabetes B patient with retinopathy and diabetes B control group, namely will apparently higher than control group at the expression level of diabetes B patient with retinopathy.
The test kit that the present invention can be used for detecting the circulation miR-3197 expression level degree relevant to diabetes B retinopathy has accurately and reliably, the advantage of quick and economy flexibly.
Above-mentioned explanation is not limitation of the present invention, and the present invention is also not limited to above-mentioned citing.Those skilled in the art are in essential scope of the present invention, and the change made, remodeling, interpolation or replacement, also should belong to protection scope of the present invention, protection scope of the present invention is as the criterion with claims.
Claims (4)
1. for detecting a miR-3197 molecular marked compound for diabetes B retinopathy, it is characterized in that: the nucleotides sequence of described molecular marked compound miR-3197 gene fragment is classified as 5 ' GGAGGCGCAGGCUCGGAAAGGCG-3 '.
2. one kind for detecting the amplimer of the miR-3197 molecular marked compound of diabetes B retinopathy, it is characterized in that: the nucleotides sequence of the forward amplimer of miR-3197 molecular marker according to claim 1 is classified as 5 '-GGAGGCGCAGGCTCGGAA-3 ', its reverse amplimer is universal primer.
3., for detecting a test kit for diabetes B retinopathy, it is characterized in that the forward amplimer comprising amplification miR-3197 gene fragment according to claim 2: the nucleotides sequence of the forward amplimer of 5 '-GGAGGCGCAGGCTCGGAA-3 ' and cel-miR-39 reference gene is classified as: 5 '-CGTGAGTCGATCCATATTGTA-3 '.
4. utilize the miR-3197 molecular marked compound described in claim 1 to detect a detection method for diabetes B retinopathy, it is characterized in that step is as follows:
The extraction of a, total serum IgE;
B, employing miScript II Reverse Transcription box test kit carry out reverse transcription to miRNA;
C, pcr amplification: utilize 7500real-timePCRsystem instrument to carry out, add cel-miR-39 as reference gene, 25ul amplification system: 12.5ulSYBRPCR mixed solution, 2.5ul universal primer, 2.5ulmiR-3197 Auele Specific Primer, 2ulcDNA solution and 5.5ul are without RNA enzyme water; Amplification reaction condition: initial activation at 95 DEG C, 15 minutes; 94 DEG C of 15s, 55 DEG C of 30s, 70 DEG C of 30s, totally 40 circulations; Melting curve analysis is carried out after having reacted; Wherein primer solution comprises the forward amplimer of amplification miR-3197 gene fragment: the nucleotides sequence of the forward amplimer of 5 '-GGAGGCGCAGGCTCGGAA-3 ' and cel-miR-39 reference gene is classified as: 5 '-CGTGAGTCGATCCATATTGTA-3 ', and reverse primer is universal primer; Each primer concentration is 10pmol/ul;
D, qualification: after having increased, utilize 2
-△ △ CTmethods analyst gene expression amount, if miR-3197 gene fragment high level expression, and expresses multiple and thinks that to be in pathogenesis of diabetic retinopathy early stage higher than 1.7.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510980953.3A CN105483230B (en) | 2015-12-23 | 2015-12-23 | MiR-3197 molecular marked compounds and its amplimer for detecting diabetes B retinopathy and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510980953.3A CN105483230B (en) | 2015-12-23 | 2015-12-23 | MiR-3197 molecular marked compounds and its amplimer for detecting diabetes B retinopathy and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105483230A true CN105483230A (en) | 2016-04-13 |
| CN105483230B CN105483230B (en) | 2018-07-27 |
Family
ID=55670501
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510980953.3A Active CN105483230B (en) | 2015-12-23 | 2015-12-23 | MiR-3197 molecular marked compounds and its amplimer for detecting diabetes B retinopathy and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105483230B (en) |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106119385A (en) * | 2016-08-11 | 2016-11-16 | 河南大学 | MiRNA molecule mark hsa miR 149 3p of a kind of diagnosed type 2 diabetic and application thereof |
| CN106434872A (en) * | 2016-08-11 | 2017-02-22 | 河南大学 | MiRNA molecule marker hsa-miR-152-3p for diagnosing type 2 diabetes, and application thereof |
| CN107385035A (en) * | 2017-07-18 | 2017-11-24 | 深圳大学 | The serum/plasma miRNA marker related to diabetes B PVR and its application |
| CN107557467A (en) * | 2017-08-10 | 2018-01-09 | 李永东 | A kind of clinical marker thing related to cerebral aneurysm and its application |
| CN108796063A (en) * | 2018-06-13 | 2018-11-13 | 云南省第二人民医院 | Micro-15b is preparing the application in diagnosing diabetic retinopathy reagent |
| CN109680058A (en) * | 2019-01-10 | 2019-04-26 | 华中科技大学同济医学院附属协和医院 | Application and kit of the miR-101 level detection in diabetic microvascular complication diagnostic reagent |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103045736A (en) * | 2012-12-20 | 2013-04-17 | 徐勇 | Down syndrome 21 chromosome miRNA differential expression map model, modeling method and application |
| WO2015190584A1 (en) * | 2014-06-12 | 2015-12-17 | 東レ株式会社 | Prostate cancer detection kit or device, and detection method |
-
2015
- 2015-12-23 CN CN201510980953.3A patent/CN105483230B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103045736A (en) * | 2012-12-20 | 2013-04-17 | 徐勇 | Down syndrome 21 chromosome miRNA differential expression map model, modeling method and application |
| WO2015190584A1 (en) * | 2014-06-12 | 2015-12-17 | 東レ株式会社 | Prostate cancer detection kit or device, and detection method |
Non-Patent Citations (1)
| Title |
|---|
| 张俊等: "microRNA及其在糖尿病视网膜病变中的研究进展", 《眼科新进展》 * |
Cited By (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106119385A (en) * | 2016-08-11 | 2016-11-16 | 河南大学 | MiRNA molecule mark hsa miR 149 3p of a kind of diagnosed type 2 diabetic and application thereof |
| CN106434872A (en) * | 2016-08-11 | 2017-02-22 | 河南大学 | MiRNA molecule marker hsa-miR-152-3p for diagnosing type 2 diabetes, and application thereof |
| CN106119385B (en) * | 2016-08-11 | 2019-03-05 | 河南大学 | A kind of miRNA molecule marker hsa-miR-149-3p of diagnosed type 2 diabetic and its application |
| CN107385035A (en) * | 2017-07-18 | 2017-11-24 | 深圳大学 | The serum/plasma miRNA marker related to diabetes B PVR and its application |
| CN107385035B (en) * | 2017-07-18 | 2021-01-08 | 深圳大学 | Serum/plasma miRNA marker related to type 2 diabetes retinopathy and application thereof |
| CN107557467A (en) * | 2017-08-10 | 2018-01-09 | 李永东 | A kind of clinical marker thing related to cerebral aneurysm and its application |
| CN107557467B (en) * | 2017-08-10 | 2021-05-11 | 李永东 | Clinical marker related to cerebral aneurysm and application thereof |
| CN108796063A (en) * | 2018-06-13 | 2018-11-13 | 云南省第二人民医院 | Micro-15b is preparing the application in diagnosing diabetic retinopathy reagent |
| CN109680058A (en) * | 2019-01-10 | 2019-04-26 | 华中科技大学同济医学院附属协和医院 | Application and kit of the miR-101 level detection in diabetic microvascular complication diagnostic reagent |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105483230B (en) | 2018-07-27 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105483230A (en) | MiR-3197 molecular marker for detecting type 2 diabetic retinopathy and amplification primer and application thereof | |
| Ding et al. | Circulating microRNA-122 as a potential biomarker for liver injury | |
| Wang et al. | Screening plasma miRNAs as biomarkers for renal ischemia-reperfusion injury in rats | |
| US9732388B2 (en) | Nucleic acid markers for rapid diagnosis of kawasaki disease and kit for detection of the nucleic acid markers | |
| CN107058472B (en) | Diagnostic kit for jointly diagnosing acute mountain sickness through four plasma microRNAs | |
| CN103805696A (en) | Micro RNA (Ribonucleic Acid) molecular marker for diagnosing rheumatoid arthritis and detection kit thereof | |
| CN104357566A (en) | Liver cancer detection kit | |
| CN107858434A (en) | Applications of the lncRNA in diagnosing cancer of liver and prognosis prediction | |
| EP3119905B1 (en) | Mitochondrial non-coding rnas for predicting disease progression in heart failure and myocardial infarction patients | |
| US20180044733A1 (en) | Circulatory MicroRNAs (miRNAs) as Biomarkers for Diabetic Retinopathy (DR) and Age-Related Macular Degeneration | |
| CA2978368C (en) | Signature of health | |
| CN104480106A (en) | Serum/plasma micro-RNA marker for detecting patients with mild cognitive impairment and application thereof | |
| CN105483231A (en) | MiR-2116-5p molecular marker for detecting type 2 diabetic retinopathy and amplification primer and application thereof | |
| CN110791562A (en) | miR-145-5P molecular marker for detecting type 2 diabetes mellitus, amplification primer and application thereof | |
| ES2715874T3 (en) | Bladder cancer screening methods | |
| WO2017129977A1 (en) | Chronic kidney disease diagnostic | |
| CN110373457A (en) | A kind of mRNA marker and its application for ulcerative colitis diagnosis | |
| US10900085B2 (en) | Method and kit for the diagnosis of colorectal cancer | |
| US10913979B2 (en) | Determination of miR-423-5p in heart failure | |
| WO2016133395A1 (en) | Circulating micrornas in patients with acute heart failure | |
| CA2945080A1 (en) | Methods and kits for identifying pre-cancerous colorectal polyps and colorectal cancer | |
| JP6616983B2 (en) | How to test for mild cognitive impairment | |
| EP3795700B1 (en) | Method for identifying an early stage of a cardiomyopathy | |
| CN116024345B (en) | Real-time fluorescent nucleic acid isothermal amplification detection kit for bladder cancer and special primer and probe thereof | |
| CN117487903A (en) | miRNA (micro ribonucleic acid) as molecular marker for diagnosing type 2diabetes combined coronary heart disease and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |